Literature DB >> 32316522

Identification and Genetic Characterization of a Novel Respirovirus in Alpine Chamois (rupicapra rupicapra rupicapra).

Camilla Luzzago1, Erika Ebranati2, Antonio Lavazza3, Martina Besozzi4,5, Gianguglielmo Zehender2, Paolo Lanfranchi4, Stefania Lauzi4.   

Abstract

The Respirovirus genus, family Paramamixoviridae, includes respiratory viral pathogens. Here we report the identification and genetic characterization of a respirovirus in an Alpine chamois showing interstitial pneumonia associated with catarrhal bronchopneumonia. The full-genome characterization of this respirovirus, named ChamoisRV/IT2014, revealed low similarities to caprine respirovirus (77.1%), bovine respirovirus (74.5%) and human respirovirus (72.0%). The phylogenetic analyses based on the full-length genome sequence of the novel isolate and reference respirovirus strains showed that ChamoisRV/IT2014 clustered with caprine respirovirus but formed a separate branch. The phylogenetic tree topology of complete large protein amino acid sequences, representing the current species demarcation criterion for Respirovirus genus, showed a 0.05 branch length of ChamoisRV/IT2014 sequence between the nearest node and the tip of the branch, suggesting that this virus belongs to a novel species. This new isolate in a new host species raises several questions to be addressed on the epidemiological role of chamois and the risks of cross-transmission between wild ruminants and livestock.

Entities:  

Keywords:  Paramixoviridae; chamois; novel respirovirus; pneumonia; wild ruminants

Year:  2020        PMID: 32316522      PMCID: PMC7222786          DOI: 10.3390/ani10040704

Source DB:  PubMed          Journal:  Animals (Basel)        ISSN: 2076-2615            Impact factor:   2.752


1. Introduction

In recent years, novel respiroviruses have been identified in goats suffering respiratory syndrome in China [1,2] and in the Sri Lankan Giant squirrel introduced in Germany [3]. To date, the Respirovirus genus in the family Paramyxoviridae includes six species: human respirovirus 1 and 3 (HRV1, HRV3; formerly human parainfluenza virus 1 and 3), porcine respirovirus 1 (PRV3, formerly porcine parainfluenza virus 1), bovine respirovirus 3 (BRV3, formerly bovine parainfluenza virus 3), caprine respirovirus 3 (CRV3, formerly caprine parainfluenza virus 3) and murine respirovirus (MRV, formerly Sendai virus), as recently revised [4]. CRV3 (formerly CPIV3) was first identified in goats [2] and recently also in sheep in China [5]. To date, CRV3 has not been reported in other countries. BRV3 (formerly BPIV3) is a worldwide cattle respiratory pathogen involved in bovine respiratory disease (BRD) [6], a multifactorial disease for which viral pathogens have a prominent role as primary agents [7]. Serological evidence of BRV3 infection has been reported in several wild ruminant species, including Alpine chamois in Italy [8], bighorn sheep [9] and white-tailed deer [10] in North America. Due to the impact of the pneumonia complex on chamois populations, investigation on respiratory pathogens is of considerable interest [11]. The Alpine chamois is the most abundant subspecies of Rupicapra spp. with nearly 500,000 individuals distributed among France, Italy, Switzerland, Liechtenstein, Germany, Austria, Slovenia and Croatia [12]. This expansion favours the interactions between livestock and wild ruminants, implying an increased risk of cross-transmission of pathogens. Indeed, some of the major outbreaks reported in chamois in Europe have been triggered by pathogens initially cross-transmitted at the interface with livestock [13]. Considering the need to widen the knowledge on respiratory infection of chamois, in the present study we report a novel respirovirus isolated from chamois with lung lesions that was characterized by the full-genome sequence and phylogeny.

2. Materials and Methods

2.1. Study Area and Sampling

The study area was located in the north-western Italian Alps (45°56′ N, 8°34′ E) where chamois, roe deer (Capreolus capreolus), red deer (Cervus elaphus) and ibex (Capra ibex) are present. Furthermore, cattle and small ruminant herds share alpine pastures during summer season. Chamois, roe deer and red deer are legally selectively hunted in accordance with Italian law (N. 157 of 11/02/1992) and inspected by veterinarians at the wildlife control centres of the area. In autumn 2014, coughing chamois were reported by hunters. In September–October 2014, 191 chamois were legally selectively hunted (11 kids, 61 yearlings, 119 >2 years old). To collect data on respiratory infections, lungs were available only for 14 yearlings, both with and without macroscopic lesions, and for 7 adults with macroscopic lesions. Lung samples were collected and stored at −20 °C for 1–2 weeks in the control centres facility and subsequently transferred to the laboratory at −80 °C until further processing. Blood samples, collected from major blood vessels or heart clots, were also available for 1 kid, 3 yearlings and 7 adults. Samples were centrifuged and the serum was stored at −20 °C until further processing.

2.2. Viral Isolation

Tissue homogenates (approx. 10% w/v) of lungs were inoculated in 24-well plates in sub-confluent monolayers of Madin–Darby bovine kidney cells (MDBK ATCC CCL-22). MDBK cells were maintained in minimal essential medium (MEM) with 1% L-glutamine 200 mM, 100 U/mL penicillin, 100 µg/mL streptomycin, 2.5 µg/mL fungizone and 10% of fetal bovine serum (FBS), free of antibodies to bovine herpes virus-1, bovine respiratory syncytial virus, bovine parainfluenza virus 3 and free of both virus and antibodies to bovine viral diarrhea virus. The inoculated plates were incubated at 37 °C in 5% CO2 and after a 1–2 h adsorption period the cell cultures were rinsed and maintenance medium was added. The cell cultures were observed daily for cytopathic effect (CPE) for 6 days. Two blind passages were made if no CPE was observed; the cell cultures were scraped and vigorously mixed with culture medium and used for inoculation of fresh monolayers.

2.3. RT-PCR

Viral RNA was extracted from lysates of cell cultures showing CPE using TRIZOL® LS reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. The RNA was retrotranscribed using a QIAamp One-For-All Nucleic Acid kit (Qiagen, Mississauga, ON, Canada) and cDNA was subject to PCR according to previous published protocols for bovine and ovine respiratory syncytial virus [14,15], pan-coronavirus [16], pestivirus [17,18] and mammalian orthoreoviruses [19].

2.4. Bacteriological Examination

Bacteriological examination of tissue samples was performed on blood–agar plates under aerobic and microaerophilic conditions. Plates were incubated at 37 ± 2 °C for 24 and 48 h.

2.5. Negative Staining Electron Microscopy

Due to negative results from specific PCR panels, the supernatant fluid from cell culture showing CPE was submitted to negative staining electron microscopy (nsEM) using the Airfuge method [20]. Samples were ultracentrifuged (Airfuge, Beckman Coulter Inc. Life Sciences, Indianapolis, Indiana, USA) for 15 min at 82,000× g using a rotor holding six 175-μL test tubes in which specific adapters for 3 mm carbon-coated Formvar copper grids were placed. Grids were stained with 2% NaPT, pH 6.8 for 1.5 min and examined at 13,500–43,000x by using a Tecnai G2 Spirit Biotwin transmission electron microscope (FEI, Hillsboro, Oregon, OR, USA) operating at 85 kV and at 20,500–43,000× for at least 15 min before being considered negative. Attempts to identify the observed viral particles were based on their morphological characteristics.

2.6. Whole Genome Sequence

The whole genome was amplified by using the sequence-independent single-primer amplification (SISPA method) and sequenced by Next Generation Sequencing (NGS) method [21]. In detail, RNA was extracted from the cell culture supernatant by the QIAamp viral RNA mini Kit and the automatic QIACUBE robot (Qiagen, GmbH, Hilden, Germany). Extracted RNA was reverse-transcribed using the random primer FR26RV-N (5′GCCGGAGCTCTGCAGATATCNNNNNN3′) at a concentration of 10 µM. Viral cDNA was denatured at 94 °C for three min and chilled on ice for two min. Five units of Klenow fragment (New England Biolabs, Ipswich, MA, USA) were directly added to the reaction to perform the second strand cDNA synthesis. The incubation was carried out at 37 °C for one h and at 75 °C for 10 min. Following this step, 5 µL of double-stranded DNA was added to a PCR master mix containing 5 µL of 10× AccuPrime PCR buffer I; 0.2 µL of AccuPrime Taq DNA Polymerase, high fidelity; 4 µL of 10 µM FR20RV (5′GCCGGAGCTCTGCAGATATC3′) and 35.8 µL of water. The incubation was performed under the following thermal conditions: 94 °C for two min, followed by 40 cycles of 94 °C for 30 s, 55 °C for one min and 68 °C for three min. The PCR product was purified and quantified using a TECAN plate reader. The sample was diluted to an initial concentration of 0.2 ng/µL in accordance with the Illumina protocol, and 1 ng was used for the library preparation (Nextera XT sample preparation Kit, Illumina Inc., San Diego, CA, USA). Genomic libraries were sequenced on the Illumina MiSeq platform (Illumina, Inc.) with 2 × 151 base pairs paired-end runs. Finally, the obtained reads were evaluated for sequence quality and read-pair length using FastQC ver. 0.11.5. The reads were assembled using Geneious software v. 11.1.5 (Biomatters, New Zealand) and re-sequencing analysis was performed with the complete genomes retrieved from Genbank. The full-length genome sequence of the chamois isolate was deposited into GenBank (accession number MT180123).

2.7. Phylogenetic Analysis

The novel complete genome and nucleotide sequences of genome segments were compared for similarity against all sequences available from GenBank using Basic Local Alignment Search Tool (BLAST) analysis. Multiple sequence alignments of the novel complete genome were performed with reference sequences of genus Respirovirus using Clustal W. The phylogeny of the complete genome was estimated by the neighbor-joining algorithm (NJ) and the maximum likelihood (ML) method (MEGA version X), with 1000 replicates. Sequence identity of the nucleotide and deduced amino acid sequences of genome segments were calculated against reference sequences of genus Respirovirus using Bioedit software version 7.0 [22]. Analysis of DNA polymorphisms and synonymous or nonsynonymous sites were performed using DnaSP software [23]. Estimations of positive selection sites were performed using Datamonkey [24]. The non-synonymous and synonymous substitution rates were calculated the following methods: random effects likelihood (REL); fixed effects likelihood (FEL); a single likelihood ancestor counting (SLAC) and branch-site Unrestricted Statistical Test for Episodic Diversification (BUSTE).

2.8. Serological Screening

Sera were tested by virus neutralization tests (VNT) against the novel chamois strain, bovine respiratory syncytial virus (BRSV Strain 375) and bovine viral diarrhea virus (BVDV strain NADL). Two-fold serial dilutions of heat-inactivated serum in duplicate were mixed with equal volumes of virus containing 100 TCID50. The VNT was performed on MDBK cells, maintained in MEM supplemented as previously described and with 10% of FBS. The plates were incubated at 37 °C with 5% of CO2 for 96 h for Chamois strain and BVDV, and for 5 days for BRSV. VN titer was defined as the highest serum dilution able to inhibit virus replication. A titer > 4 was defined as positive.

3. Results

At the control center, macroscopic lesions of interstitial pneumonia in association with catarrhal bronchopneumonia were observed in four adult chamois (two males and two females) and interstitial pneumonia was observed in five yearlings (four males and one female) and three adult females. Relevant bacterial pathogens known to cause respiratory disease were not identified by bacteriological examination of the lungs. Evidence of virus growth was detected only from the lung of a 13-year-old hunted male chamois with interstitial pneumonia associated with catarrhal bronchopneumonia. The CPE was observed at the first passage of the cell lines from 72 h post infection (Figure 1).
Figure 1

Madin–Darby bovine kidney (MDBK) cells infected with ChamoisRV/IT2014 strain showing lytic cytopathic effect (CPE) at 72 h post infection.

The CPE–positive sample was negative to specific PCR panels. The supernatant of the infected cell cultures preliminarily observed by the nsEM revealed the presence of virus particles with morphological features indicative of the paramyxovirus family. In particular, in addition to some intact virions, several disintegrating particles with free nucleocapsid chains were observed (Figure 2). Subsequently, a complete viral genome was efficiently obtained starting from the cell culture supernatant.
Figure 2

Long fragment of free nucleocapsid chains originating from the disintegration of respirovirus particles in the supernatant of a CPE-positive MDBK cell culture infected with ChamoisRV/IT2014. Negative staining electron microscopy (nsEM), NaPT 2%. Bar = 200 nm.

BLAST analysis of the whole genome of the chamois virus, named ChamoisRV/IT2014, revealed CRV3 as the most similar sequence (accession number MK091103 80.1%). The whole genome of ChamoisRV/IT2014 showed 77.1% nucleotide identity with CRV3 reference strain JS2013, 74.5% with BRV3 genotype A (BRV3a) strain TVMDL60, 74.2% with BRV3 genotype B strain Q5592, 73.9% with BRV3 genotype C strain SD0835 and 72.0% with HRV3 strain AUS/5/2007. The phylogenetic tree with other respirovirus strains, including publicly available sequences of BRV3, CRV3, HRV1–3, PRV1 and MRV, showed that ChamoisRV/IT2014 clustered with RV3 (Figure 3) and formed a significant clade with CRV3 [2] using the ML method. Similar results were obtained using NJ.
Figure 3

Phylogenetic tree based on the complete genome of ChamoisRV/IT2014 and a selection of representative sequences of the Respirovirus genus. Molecular evolutionary genetic analyses were performed with MEGA X software using the maximum likelihood (ML) method based on the Tamura–Nei model. Bootstrap values > 70% are shown. Published sequences and references are identified by the GenBank accession number [25]. The black diamond indicates the novel sequence from chamois obtained in the present study.

Pairwise comparisons of the nucleotide sequence of coding regions and corresponding deduced amino acid sequences of ChamoisRV/IT2014 with reference strains of CRV3, BRV3 and HRV3 genotypes are reported in Table 1. The ChamoisRV/IT2014 nucleotide sequence of coding regions showed a slightly higher identity with CRV3 compared to BRV3, reaching values ranging from 78.2% for hemagglutinin-neuraminidase (HN) to 81.9% for the nucleoprotein (N) gene. The only exception was phosphoprotein (P) that shared a similar identity with both CRV3 (72.2%) and BRV3 (72.2%–73.1%). The matrix (M), large (L) and N protein sequences showed higher amino acid identity values compared to the other coding regions, sharing with CRV3 the highest values of 91.5%, 89.2% and 89.1%, respectively. The P protein sequence showed the lowest amino acid identity values compared to the other coding regions, ranging from 53.0% with HRV3 to 59.2% with CRV3. The phylogenetic tree topology of complete L protein amino acid sequences of members of the family Paramyxoviridae showed a 0.05 branch length of ChamoisRV/IT2014 sequence between the nearest node and the tip of the branch (Figure 4).
Table 1

Nucleotide and amino acid identities for each gene segment of the novel respirovirus sequence from chamois compared to respirovirus reference strains from GenBank.

Coding RegionsIdentity %
ChamoisRV/IT2014Gene RegionCRV3JS2013BRV3aTVMDL60BRV3bQ5592BRV3cSD0835HRV3AUS/5/2007
nt 1 aa 2 nt aa nt aa nt aa nt aa
Nucleoprotein (N)81.989.180.188.080.387.478.485.178.281.6
Phosphoprotein (P)72.259.272.756.673.157.472.256.069.853.0
Matrix protein (M)82.491.578.486.779.187.878.687.878.486.7
Fusion protein (F)79.284.177.180.776.981.375.779.473.375.5
Hemagglutinin/neuraminidase (HN)78.283.775.077.275.877.973.875.071.669.7
Large protein (L)81.189.280.387.979.487.679.486.978.485.3

nucleotide amino acid.

Figure 4

Phylogenetic analysis of complete large (L) protein amino acid sequences of members of the family Paramyxoviridae. (a) Complete L protein amino acid sequences were aligned by Clustal W with gap generation penalties of 5 and extension penalties of 1 in both multiple and pairwise alignments. The evolutionary history was inferred by using the Maximum Likelihood method and JTT matrix-based model. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Bootstrap values > 70% are shown and clades of other than the respirovirus genus are compressed (b) The respirovirus genus subtree is expanded, showing branch lengths measured in the number of substitutions per site. Evolutionary analyses were conducted in MEGA X software. Sequence alignment is downloaded from [26].

A highly conserved motif, located near the middle of the N proteins and thought to be essential in N–N self-assembly and the N–RNA interaction process, was found in the central domain of the N proteins from the chamois virus, as 323FAPGNYPALWSYAM336, and was also observed in CRV3 [2]. The HN protein contained the conserved binding site sequence, 254NRKSCS259 [26], suggesting a neuraminic acid containing cellular receptor. The results of the analysis of DNA polymorphisms and synonymous or nonsynonymous sites are reported in the Supplementary data (Table S1). Concerning the analysis of the estimation of positive selection sites, there was no evidence that any sites have experienced diversifying selection. Concerning the serological analysis (Table 2), four animals were positive to ChamoisRV/IT2014 strain, with VN titers ranging from 8 to 256; two chamois demonstrated seropositivities to BRSV, including one chamois with lung lesions that showed seropositivity also to ChamoisRV/IT2014 strain. All sera were negative for BVDV.
Table 2

Virus neutralization titers of hunted chamois sera against the chamois strain from this study, bovine respiratory syncytial virus and bovine viral diarrhea virus.

Chamois Id.CollectionDateAgein YearsGenderChamois RV/IT2014BRSVBVDV
57311 a28-9-20141M64642
10097128-9-20142F2232
8172028-9-20143F822
207811-10-20144M222
232041-10-20141F222
75777 b1-10-201411F222
832841-10-20144F222
235045-10-20146M3222
397668-10-2014<1M222
8346919-10-20141M25622
6251622-10-201413F222

a interstitial pneumonia, negative to virus isolation; b interstitial pneumonia and catarrhal bronchopneumonia, negative to virus isolation.

4. Discussion

We report the isolation, identification and genetic characterization of a novel RV3, found in a hunted, free-living Alpine chamois showing interstitial pneumonia associated with catarrhal bronchopneumonia. The finding of the novel RV3 being limited to one animal only could be related to a likely short–phase of virus replication in the lungs, and direct detection was thus restricted. Moreover, virus isolation is a diagnostic technique that requires a virus that is able to replicate in cell culture, therefore the sensitivity could be limited. The use of pan-paramyxoviridae primers previously published, especially universal primers for respiroviruses [27], as well as the set-up of a specific RT-PCR have to be considered in respiratory pathogen panels to improve the diagnostic sensitivity and confirm the presence of the novel RV3 RNA in lung samples of chamois. The evidence of seropositive chamois, showing VN antibodies against ChamoisRV/IT2014, supports the circulation of this infection in the study area. This needs to be investigated to determine the real diffusion of this novel agent in chamois population and establish its epidemiological role. The absence of other respiratory agents in the lungs of the RV3-positive and other chamois supports the hypothesis that the novel virus in chamois may be the etiological agent of the lung lesions that could either be interstitial pneumonia and/or catarrhal bronchopneumonia. Nevertheless, the negative results for other viral or bacterial respiratory pathogens could be biased by the storage condition of lung samples (−20 °C) and by an analytical protocol focused on viral isolation. The phylogenetic analyses based on the full-length genome sequence of the novel isolate and reference respirovirus strains showed that ChamoisRV/IT2014 significantly clustered with CRV3 but formed a separated branch. Despite this, we generated a comprehensive dataset of animal RV3 publicly available from GenBank; there were relatively few whole genome sequences available, and no other RV3 sequence clustered with ChamoisRV/IT2014. The nucleotide identity for the ChamoisRV/IT2014 complete genome with respirovirus reference strains, including CRV3, was 80% or below, revealing nucleotide differences higher than the ones observed among genotypes and members of Respirovirus genus [2,28]. The comparison of complete L protein amino acid sequences, representing the current species demarcation criterion for Respirovirus genus [26], shows that ChamoisRV/IT2014 possesses sequence differences from the other respirovirus species. Moreover, although the phylogenetic analysis of ChamoisRV/IT2014 based on M, HN and F genes, used as targets for genetic typing of RV3 [5], confirms the highest nucleotide identity with CRV3, it shows low nucleotide identity for all three genes. Overall, the results of the full genome phylogenetic tree, sequence identities with other respirovirus and species demarcation criterion for the Respirovirus genus, indicate that ChamoisRV/IT2014 is distinct from already defined species and suggest that it is a putative novel member of the genus Respirovirus. This new isolate in a new host species raises several questions to be addressed. Studies on the epidemiological role of chamois, the risks of cross-transmission between wild ruminant and livestock and the evolution mechanisms, including genomic changes driven by the adaptation of viruses to new hosts, are suggested. The new powerful methods for genomic characterization will contribute to increase the availability of whole genome sequences to deepen the understanding of the origin and evolution of respiroviruses.
  23 in total

1.  Comparison of targeting F and G protein genes to detect bovine and ovine respiratory syncytial viruses.

Authors:  Nasser Z Eleraky; Stephen A Kania; James F Evermann; Leon N D Potgieter
Journal:  J Vet Diagn Invest       Date:  2003-05       Impact factor: 1.279

2.  Analysis on the complete genome of a novel caprine parainfluenza virus 3.

Authors:  Leilei Yang; Wenliang Li; Li Mao; Fei Hao; Zhongyu Wang; Wenwen Zhang; Jiawu Deng; Jieyuan Jiang
Journal:  Infect Genet Evol       Date:  2015-11-26       Impact factor: 3.342

3.  Microorganisms associated with a pneumonic epizootic in Rocky Mountain bighorn sheep (Ovis canadensis canadensis).

Authors:  Karen M Rudolph; David L Hunter; Richard B Rimler; E Frances Cassirer; William J Foreyt; Walter J DeLong; Glen C Weiser; Alton C S Ward
Journal:  J Zoo Wildl Med       Date:  2007-12       Impact factor: 0.776

4.  Serological study of a population of alpine chamois (Rupicapra r rupicapra) affected by an outbreak of respiratory disease.

Authors:  C V Citterio; C Luzzago; M Sala; G Sironi; P Gatti; A Gaffuri; P Lanfranchi
Journal:  Vet Rec       Date:  2003-11-08       Impact factor: 2.695

5.  Environmental Factors Influencing White-Tailed Deer (Odocoileus virginianus) Exposure to Livestock Pathogens in Wisconsin.

Authors:  Shelli Dubay; Christopher Jacques; Nigel Golden; Bryant Kern; Kathleen Mahoney; Andrew Norton; Devi Patnayak; Timothy Van Deelen
Journal:  PLoS One       Date:  2015-06-01       Impact factor: 3.240

6.  Genomic and antigenic characterization of bovine parainfluenza-3 viruses in the United States including modified live virus vaccine (MLV) strains and field strains from cattle.

Authors:  R W Fulton; J D Neill; J T Saliki; C Landis; L J Burge; M E Payton
Journal:  Virus Res       Date:  2017-04-14       Impact factor: 3.303

7.  A novel parainfluenza virus type 3 (PIV3) identified from goat herds with respiratory diseases in eastern China.

Authors:  Wenliang Li; Li Mao; Suping Cheng; Qiusheng Wang; Jiachun Huang; Jiawu Deng; Zhongyu Wang; Wenwen Zhang; Leilei Yang; Fei Hao; Yonglong Ding; Yinhua Sun; Jianzhong Wei; Ping Jiang; Jieyuan Jiang
Journal:  Vet Microbiol       Date:  2014-09-06       Impact factor: 3.293

8.  Detection and genotyping of bovine diarrhea virus by reverse transcription-polymerase chain amplification of the 5' untranslated region.

Authors:  C Letellier; P Kerkhofs; G Wellemans; E Vanopdenbosch
Journal:  Vet Microbiol       Date:  1999-01       Impact factor: 3.293

9.  A pancoronavirus RT-PCR assay for detection of all known coronaviruses.

Authors:  Leen Vijgen; Elien Moës; Els Keyaerts; Sandra Li; Marc Van Ranst
Journal:  Methods Mol Biol       Date:  2008

10.  Viral genome sequencing by random priming methods.

Authors:  Appolinaire Djikeng; Rebecca Halpin; Ryan Kuzmickas; Jay Depasse; Jeremy Feldblyum; Naomi Sengamalay; Claudio Afonso; Xinsheng Zhang; Norman G Anderson; Elodie Ghedin; David J Spiro
Journal:  BMC Genomics       Date:  2008-01-07       Impact factor: 3.969

View more
  2 in total

1.  Passive Disease Surveillance of Alpine Chamois (Rupicapra r. rupicapra) in Slovenia between 2000 and 2020.

Authors:  Gorazd Vengušt; Urška Kuhar; Klemen Jerina; Tanja Švara; Mitja Gombač; Petra Bandelj; Diana Žele Vengušt
Journal:  Animals (Basel)       Date:  2022-04-27       Impact factor: 3.231

2.  Divergent Viruses Discovered in Swine Alter the Understanding of Evolutionary History and Genetic Diversity of the Respirovirus Genus and Related Porcine Parainfluenza Viruses.

Authors:  Jin Zhao; Jiumeng Sun; Xinxin Li; Gang Xing; Yifang Zhang; Alexander Lai; Guy Baele; Xiang Ji; Shuo Su
Journal:  Microbiol Spectr       Date:  2022-06-01
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.