Literature DB >> 32311850

Clonal Distribution of Clindamycin-Resistant Erythromycin-Susceptible (CRES) Streptococcus agalactiae in Korea Based on Whole Genome Sequences.

Takashi Takahashi1, Takahiro Maeda1, Seungjun Lee2, Dong-Hyun Lee3, Sunjoo Kim2,4.   

Abstract

BACKGROUND: The clindamycin-resistant erythromycin-susceptible (CRES) phenotype is rare in Streptococcus agalactiae (group B streptococci). We aimed to determine the molecular characteristics of CRES S. agalactiae using whole genome sequencing (WGS).
METHODS: Sixty-six S. agalactiae isolates obtained from blood (N=26), cerebrospinal fluid (N=10), urine (N=17), and vaginal discharge (N=13) between 2010 and 2017 in Korea were subjected to WGS. Based on the WGS data, we analyzed antimicrobial resistance (AMR) determinants, sequence types (STs), capsular polysaccharide (CPS) genotypes, and virulence gene profiles, and constructed a phylogenetic tree. We included the clindamycin-susceptible erythromycin-resistant (CSER) phenotype for comparison.
RESULTS: We identified seven CRES S. agalactiae isolates from urine (N=5) and vaginal discharge (N=2) collected between 2010 and 2011. All CRES isolates harbored AMR determinants of lnu(B), lsa(E), and aac(6')-aph(2″), revealed ST19 and CPS genotype III, and had a virulence gene profile of rib-lmb-cylE. Phylogenetic tree analysis revealed that all CRES isolates belonged to the same cluster, suggesting a clonal distribution. In contrast, seven CSER isolates showed a diverse distribution and clustered separately from the CRES isolates.
CONCLUSIONS: CRES isolates collected between 2010 and 2011 showed a unique cluster with ST19 and CPS genotype III in Korea. This is the first report on WGS-based characteristics of S. agalactiae in Korea.

Entities:  

Keywords:  Antimicrobial resistance; CRES (clindamycin-resistant erythromycin-susceptible); Clonal distribution; Group B streptococci; Sequence types; Streptococcus agalactiae; Whole genome sequencing

Mesh:

Substances:

Year:  2020        PMID: 32311850      PMCID: PMC7169627          DOI: 10.3343/alm.2020.40.5.370

Source DB:  PubMed          Journal:  Ann Lab Med        ISSN: 2234-3806            Impact factor:   3.464


INTRODUCTION

Streptococcus agalactiae (group B β-hemolytic streptococci) can cause several invasive infections, including sepsis, infective endocarditis, septic arthritis, and meningitis, especially in neonates and the elderly [1, 2]. S. agalactiae infections are classified as invasive (blood, cerebrospinal fluid, joint fluid, pleural effusion, ascites, and closed pus) or non-invasive (urine and vaginal discharge) [3]. Multilocus sequence typing (MLST) for sequence type (ST) determination has been used to evaluate the clonal distribution or persistence of S. agalactiae from urine and vagina [3]. S. agalactiae possesses numerous virulence factors, including capsular polysaccharide (CPS), alpha and beta antigens of the surface-associated C protein, and the surface protein Rib. CPS is the most important virulence factor and is used for strain typing [4]. Alpha antigen of the surface-associated C protein (encoding gene bca) mediates adherence to the epithelium, whereas beta antigen of the surface-associated C protein (encoding gene bac) is involved in invasiveness and resistance to phagocytic clearance [5, 6]. Protein Rib (encoding gene rib), which exhibits resistance to proteases, confers protective immunity and is detected in most CPS III isolates, which cause severe infections in neonates [5]. lmb and cylE encode human laminin binding protein and beta-hemolysin, respectively. There are two major phenotypes of macrolide resistance in streptococci: an MLSB phenotype is resistant to macrolides, lincosamides, and streptogramin B, and an M phenotype is resistant to macrolides, but not to lincosamides and streptogramin B [7]. The MLSB phenotype in streptococci can result from induced/constitutive expression of the antimicrobial resistance (AMR) determinants, erm(A) and erm(B), whereas the M phenotype can be caused by the mef(A) determinant [7]. In addition, an L phenotype exists, which is resistant to lincosamides, but not to macrolides [8]. The clindamycin-resistant erythromycin-susceptible (CRES) phenotype corresponds to the L phenotype [9]. The CRES phenotype (L phenotype) is rare in S. agalactiae. It has been described in clinical isolates from Korea and is caused by antimicrobial modification mediated by lnu(B) [10]. Members of the lnu gene family encode nucleotidyl transferase enzymes that catalyze the adenylation of lincomycin and clindamycin. The CRES phenotype is also mediated by two genes of the lsa gene family, namely lsa(C) and lsa(E), which encode ATP-binding proteins that have been classified as class 2 ATP-binding cassette transporters (antibiotics efflux pumps) [11]. While the overall frequency of this phenotype in S. agalactiae was quite low (65/21,186=0.31%), it had increased in 2014–2015 in the USA [11]. We aimed to determine the genetic characteristics of CRES S. agalactiae in Korea based on whole genome sequencing (WGS). To the best of our knowledge, this is the first report on WGS-based characteristics of S. agalactiae in Korea.

MATERIALS AND METHODS

Study design

S. agalactiae isolates collected between 2010 and 2017 were randomly selected from the repository at Gyeongsang National University Hospital (GNUH) in Gyeongnam Province, Korea. We included a total of 66 isolates: invasive isolates from blood (N=26) and cerebrospinal fluid (CSF) (N=10) as well as non-invasive isolates from urine (N=17) and vaginal discharge (N=13); repeated isolates from the same patients were excluded. Bacterial identification was conducted using a Vitek-2 automated identification system (bioMerieux Inc., Marcy l’Etoile, France). All isolates were stored at −70°C to −80°C before being processed for further evaluation. Patients’ sex and age were obtained from the electronic medical records. In total, 66 patients with a median age of 50.5 years (range, 0–86 years), including 12 children, 54 adults, and 32 males (48.5%), were enrolled. The study protocol was approved by the Institutional Review Board of GNUH (approval number: GNUH 2016-03-010). Informed consent was waived because of the retrospective nature of the study.

Antimicrobial susceptibility testing (AST)

AST was conducted using 11 antimicrobial agents, including β-lactam, tetracycline, macrolide/lincosamide (ML), and fluoroquinolone, to evaluate AMR levels by the broth microdilution method using a Vitek-2 System and an ST-01 test kit (bioMerieux Inc.). CRES S. agalactiae was defined as having a minimum inhibitory concentration of >1 μg/mL for clindamycin and of <0.25 μg/mL for erythromycin. Seven isolates showed the CRES phenotype. We also included seven isolates showing the clindamycin-susceptible erythromycin-resistant (CSER) phenotype for comparison. In addition, we included 13 isolates that were clindamycin-resistant erythromycin-resistant, and 29 isolates that were clindamycin-susceptible erythromycin-susceptible. The seven CRES isolates were recovered from urine (N=5) and vaginal discharge (N=2) during a limited period (March 2010 to August 2011). Bacterial identification and AST had been performed previously by routine microbiological procedures, whereas WGS and bioinformatics analysis had been conducted for this study.

WGS

S. agalactiae isolates were grown at 35°C in Todd-Hewitt broth (Becton Dickinson, Sparks, MD, USA) for 16–18 hours. Genomic DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) after pretreatment with lysozyme (Thermo Fisher Scientific, Waltham, MA, USA) and proteinase K (Qiagen) [12]. S. agalactiae isolates were identified by 16S rRNA gene sequencing with amplifying/sequencing primer set (27F: AGAGTTTGATCMTGGCTCAG and 1485R: TACGGTTACCTTGTTACGAC) developed in-house using an ABI 3730 DNA sequencing instrument (Applied Biosystems, Foster City, CA, USA). The sequencing library was prepared using a TruSeq DNA LT Sample Prep Kit (Illumina, San Diego, CA, USA) for the Illumina MiSeq system. Draft genome sequences of the isolates were determined based on 300-bp paired-end reads. Illumina sequencing data were assembled using SPAdes 3.13.0 (Algorithmic Biology Lab, St. Petersburg Academic University of the Russian Academy of Sciences). For gene-finding and functional annotation, we used the whole genome analysis pipeline of ChunLab (Seoul, Korea). Protein-coding DNA sequences were predicted using Prodigal 2.6.2 (https://github.com/hyattpd/Prodigal) [13].

AMR genotyping

AMR genotyping was conducted based on the contig sequences obtained using ResFinder version 3.2 (https://cge.cbs.dtu.dk/services/ResFinder/) managed by the Center for Genomic Epidemiology [14]. This tool can detect genes conferring resistance to β-lactams, macrolide, lincosamide, tetracycline, quinolone, oxazolidinone, sulfonamide/trimethoprim, glycopeptide, aminoglycoside, phenicol, fosfomycin, nitroimidazole, rifampicin, fusidic acid, and colistin. AMR genotypes were determined based on an identity threshold >90% and a minimum length of 60% as compared with the reference sequence in the database.

MLST

MLST (allelic profile: adhP–pheS–atr–glnA–sdhA–glcK–tkt) was conducted based on the contig sequences using the MLST server (https://cge.cbs.dtu.dk/services/MLST/) managed by the Center for Genomic Epidemiology [15]. The STs were grouped into clonal complexes (CCs), whereby related STs were classified as single-locus variants differing in only one housekeeping gene. An expansion of the goeBURST algorithm implemented in PHYLOViZ (http://www.phyloviz.net/) was used to produce a minimum-spanning tree representing possible relationships among the STs [16].

CPS genotyping

CPS genotyping and detection of the S. agalactiae-specific dltS gene were conducted based on the contig sequences by PCR simulation [17] in the online application, Serial Cloner (http://serialbasics.free.fr/Serial_Cloner.html). The CPS genotypes included Ia, Ib, II, III, IV, V, VI, VII, and VIII.

Virulence gene profiling

The presence of five virulence genes (bca-rib-bac-lmb-cylE) was determined based on the contig sequences by PCR simulation in Serial Cloner [18-20]. Sequence identity of the virulence genes in all simulation PCR-positive strains was confirmed using the basic local alignment search tool (BLAST) (http://blast.ddbj.nig.ac.jp/blastn?lang=ja).

Phylogenetic tree analysis

A phylogenetic tree was constructed using Orthologous Average Nucleotide Identity Tool, which measures similarity among multiple genome sequences based on the OrthoANI algorithm and BLAST calculations, on EZBioCloud (https://www.ezbiocloud.net/tools/orthoani) [21].

Statistical analysis

We used Fisher’s exact probability tests (two-sided) to determine significant differences between CRES and CSER isolates using SPSS Statistics version 22.0 (IBM Corp., Armonk, NY, USA). P<0.05 indicated statistical significance.

RESULTS

We deposited the draft genome sequences of the 66 S. agalactiae isolates into the National Center for Biotechnology Information (NCBI) database (Table 1). The WGS of the S. agalactiae isolate NCTC8181 (accession number UAVB00000000) obtained from environmental milk was used as a reference genome. The number of contigs ranged from eight (for isolate GCH73) to 90 (for isolate GCH63).
Table 1

Specimen, date of collection, and accession numbers of draft genome sequences of 66 isolates of Streptococcus agalactiae

StrainSpecimenDate of specimen collection (yr/month)SexAge (yr)Accession numbers
GCH2Blood2016/03M75WHUI00000000
GCH4Blood2016/05F83WHUJ00000000
GCH5Blood2016/06F78WHUK00000000
GCH7Blood2016/07M74WHUL00000000
GCH8Blood2016/07M79WACQ00000000
GCH9Blood2016/07M0VYJX00000000
GCH10Blood2016/08F72VYJI00000000
GCH11Blood2016/08M40VYJJ00000000
GCH13Blood2016/10M64VYJK00000000
GCH14Blood2016/12M67VYJL00000000
GCH15Blood2016/12M76VYJM00000000
GCH16Blood2017/01M43VYJN00000000
GCH18Blood2017/02M77VYJO00000000
GCH19Blood2017/02M60VYJP00000000
GCH21Blood2017/03F85VYJQ00000000
GCH22Blood2017/05M46VYJR00000000
GCH25Blood2017/06M64VYJS00000000
GCH26Blood2017/07M86VYJT00000000
GCH28Blood2017/08M54VYJU00000000
GCH29Blood2017/10M0VYJV00000000
GCH30Blood2017/10F74VYJW00000000
GCH32Blood2017/12M51VYQL00000000
GCH33Blood2016/08F56VYQM00000000
GCH34Blood2016/11F73VYQN00000000
GCH35Blood2017/05M84VYQO00000000
GCH36Blood2017/07F73VYQP00000000
GCH37CSF2014/07M51VYQQ00000000
GCH38CSF2014/10M0VYQR00000000
GCH39CSF2014/12M0VYQS00000000
GCH40CSF2015/08F0VYQT00000000
GCH41CSF2015/08F0VYQU00000000
GCH42CSF2016/06M50VYQV00000000
GCH43Urine2017/02M32VYQW00000000
GCH44Urine2017/02F56VYQX00000000
GCH45Urine2017/05F84VYQY00000000
GCH46Urine2017/07M61VYQZ00000000
GCH47Urine2017/07F34VYRA00000000
GCH48Urine2017/08F73VYRB00000000
GCH49Urine2017/08M65VYRC00000000
GCH50Urine2017/11F13VYRD00000000
GCH51Urine2017/12M53VYRE00000000
GCH53Vaginal discharge2016/04F34VYRF00000000
GCH54Vaginal discharge2016/05F33VYRG00000000
GCH55Vaginal discharge2016/10F33VYRH00000000
GCH56Vaginal discharge2017/01F22VYRI00000000
GCH57Vaginal discharge2017/01F33VYRJ00000000
GCH58Vaginal discharge2017/02F37VYRK00000000
GCH59Vaginal discharge2017/04F39VYRL00000000
GCH60Vaginal discharge2017/07F33VYRM00000000
GCH61Urine2010/03M51VYRN00000000
GCH62Vaginal discharge2010/03F38VYRO00000000
GCH63Urine2010/04M44VYRP00000000
GCH64Urine2010/10F83VYRQ00000000
GCH65Urine2010/12F49VYRR00000000
GCH66Vaginal discharge2010/12F42VYRS00000000
GCH67Urine2011/08F55VYRT00000000
GCH68CSF2011/04M0VYRU00000000
GCH70CSF2012/01F0VYRW00000000
GCH71CSF2012/03M0VYRX00000000
GCH72CSF2012/08F0VYRY00000000
GCH73Vaginal discharge2014/07F33WHUM00000000
GCH74Vaginal discharge2014/08F40WHUN00000000
GCH75Vaginal discharge2016/02F25WHUO00000000
GCH76Urine2015/11F79WHUP00000000
GCH77Urine2016/02M60WHUQ00000000
GCH78Urine2014/10M0WHUR00000000

Abbreviations: CSF, cerebrospinal fluid; M, male; F, female.

The goeBURST diagram is shown in Fig. 1. All seven CRES isolates belonged to ST19 (CC19), suggesting a clonal distribution of the CRES isolates (Table 2), whereas the seven CSER isolates belonged to ST19 (CC19) (N=3), ST2/ST1 (CC2) (N=2), or ST23 (N=2).
Fig. 1

goeBURST diagram of the relationships among STs of 66 S. agalactiae isolates. The numbers in the circles indicate the STs, and the numbers near the lines indicate the number of differing alleles between the two connected STs. Putative CCs are identified by an outer dotted frame and correspond to the STs with the highest number of single locus variants.

Abbreviations: CC, clonal complex; ST, sequence type.

Table 2

Phenotypic and genotypic features of S. agalactiae for AMR, CPS, ST, and virulence

IsolateAntimicrobial susceptibility patternMacrolide/lincosamide resistance geneTetracycline resistance geneAminoglycoside resistance geneSTCPS genotypeVirulence gene profile
GCH2CRERerm(B), lnu(B), lsa(E), mre(A)tet(O)ant(6)-Ia, ant(6)-Ia, aph(3′)-III12Ibbca-bac*-lmb-cylE
GCH4CSESmre(A)2VIIIrib-lmb-cylE
GCH5CSESmre(A)2VIIIrib-lmb-cylE
GCH7CSESmre(A)2VIIIrib-lmb-cylE
GCH8CSESmre(A)654Ibbca-bac*-lmb-cylE
GCH9CRERerm(A), mre(A)tet(M)335IIIrib-lmb-cylE
GCH10CIESmre(A)tet(M)23Ialmb-cylE
GCH11CSESmre(A)tet(M)23Ialmb-cylE
GCH13CSESmre(A)1,371VIIIrib-lmb-cylE
GCH14CRERerm(A), mre(A)tet(M)335IIIrib-lmb-cylE
GCH15CSESmre(A)2VIIIrib-cylE
GCH16CSESerm(B)*, lnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, aph(3′)-III19IIIrib-lmb-cylE
GCH18CSESlsa(C), mre(A)tet(M)23Ialmb-cylE
GCH19CREIerm(B)*, lnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, aph(3′)-III19IIIrib-lmb-cylE
GCH21CREIlsa(C), mre(A)tet(M)23Ialmb-cylE
GCH22CSESmre(A)88IIlmb-cylE
GCH25CSESmre(A)1VIbca-lmb-cylE
GCH26CSESmre(A)tet(O)2VIIIrib-lmb-cylE
GCH28CSESmre(A)tet(M)19IIIrib-lmb-cylE
GCH29CSESmre(A)2VIIIrib-lmb-cylE
GCH30CRERerm(B), mre(A)tet(M)1Vlmb-cylE
GCH32CSESmre(A)2VIIIrib-lmb-cylE
GCH33CRERerm(A), mre(A)tet(M)335IIIrib-lmb-cylE
GCH34CSESmre(A)tet(M)24Iabca-lmb-cylE
GCH35CSESmre(A)10Ibbca-bac*-lmb-cylE
GCH36CSESmre(A)10Ibbca-bac*-lmb-cylE
GCH37NAmre(A)88Ialmb-cylE
GCH38CREIerm(B)*, lnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, aph(3′)-III1,369IIIbca-lmb-cylE
GCH39CSESmre(A)tet(M)17IIIrib-cylE
GCH40CRERerm(A), mre(A)tet(M)335IIIrib-lmb-cylE
GCH41CRERerm(B), mre(A)tet(O)ant(6)-Ia, ant(6)-Ia, aph(3′)-III17IIIrib-cylE
GCH42CSESmre(A)2VIIIrib-cylE
GCH43CREIlnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, ant(6)-Ia, aph(3′)-III19IIIrib-lmb-cylE
GCH44CSEImre(A)2VIIIrib-lmb-cylE
GCH45CSERmre(A)2VIIIrib-lmb-cylE
GCH46CSESmre(A)654Ibbca-bac*-lmb-cylE
GCH47CRERerm(A), lnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, aph(3′)-III19VcylE
GCH48CRERerm(A), mre(A)tet(M)1Vlmb-cylE
GCH49CRERlsa(C), mef(A), mre(A), msr(D)tet(O)861IIIrib-lmb-cylE
GCH50CREIerm(B)*, lnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, ant(6)-Ia, aph(3′)-III19IIIrib-lmb-cylE
GCH51CRERerm(B), mre(A)10Ibbca-bac*-lmb-cylE
GCH53CSESmre(A)tet(M)1IIlmb-cylE
GCH54CSESmre(A)10Ibbca-bac*-lmb-cylE
GCH55CREIerm(B)*, lnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, ant(6)-Ia, aph(3′)-III19IIIrib-lmb-cylE
GCH56CSESmre(A)2VIIIrib-lmb-cylE
GCH57CRERmre(A)654Ibbca-bac*-lmb-cylE
GCH58CREIerm(B)*, lnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, aph(3′)-III19IIIrib-lmb-cylE
GCH59CRERerm(A), mre(A)tet(M)335IIIrib-lmb-cylE
GCH60CSESmre(A)tet(M)19IIIrib-lmb-cylE
GCH61CRESerm(B)*, lnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, aph(3′)-III19IIIrib-lmb-cylE
GCH62CRESlnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, ant(6)-Ia*, aph(3′)-III19IIIrib-lmb-cylE
GCH63CRESerm(B)*, lnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, ant(6)-Ia, aph(3′)-III19IIIrib-lmb-cylE
GCH64CRESerm(B)*, lnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, aph(3′)-III19IIIrib-lmb-cylE
GCH65CRESerm(B)*, lnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, aph(3′)-III19IIIrib-lmb-cylE
GCH66CRESlnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, aph(3′)-III19IIIrib-lmb-cylE
GCH67CRESerm(B)*, lnu(B), lsa(E), mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, aph(3′)-III19IIIrib-lmb-cylE
GCH68CSESerm(A), mre(A)tet(M)335IIIrib-lmb-cylE
GCH70CSESerm(A), mre(A)tet(M)335IIIrib-lmb-cylE
GCH71CSESmre(A)tet(M)23Ialmb-cylE
GCH72CSESerm(B)*, mre(A)tet(M)aac(6′)-aph(2″), ant(6)-Ia*, aph(3′)-III19IIIrib-lmb-cylE
GCH73CSERmre(A)1VIbca-lmb-cylE
GCH74CSERmre(A)tet(M)19IIIrib-lmb-cylE
GCH75CSERmef(A), mre(A), msr(D)tet(M)23Ialmb-cylE
GCH76CSERerm(A), mre(A)tet(M)19Vlmb-cylE
GCH77CSERmef(A), mre(A), msr(D)tet(M)23Ialmb-cylE
GCH78CSERerm(B)*, mef(A), mre(A), msr(D)tet(M)ant(6)-Ia*, aph(3′)-III19IIIrib-lmb-cylE

Identical nucleotide length<100% of the reference sequence in the database.

Abbreviations: AMR, antimicrobial resistance; CPS, capsular polysaccharide; CRER, clindamycin-resistant erythromycin-resistant; CSES, clindamycin-susceptible erythromycin-susceptible; CIES, clindamycin-intermediate erythromycin-susceptible; CREI, clindamycin-resistant erythromycin-intermediate; CSEI, clindamycin-susceptible erythromycin-intermediate; CSER, clindamycin-susceptible erythromycin-resistant; CRES, clindamycin-resistant erythromycin-susceptible; ST, sequence type.

All CRES isolates showed the lnu(B)-lsa(E) ML resistance genotype (Table 2). However, none of the CSER isolates possessed the lnu(B)-lsa(E) genotype (P=0.001). All CRES isolates showed the aac(6′)-aph(2″) aminoglycoside resistance genotype, whereas none of the CSER isolates did. All isolates did not show AMR genes for β-lactams, quinolone, oxazolidinone, sulfonamide/trimethoprim, glycopeptide, phenicol (except for cat[pC194] in isolate GCH2), fosfomycin, nitroimidazole, rifampicin, fusidic acid, and colistin. All isolates possessed the dltS gene specific to S. agalactiae, validating species identification. All CRES isolates were CPS III, whereas the CSER isolates possessed diverse CPS types (Table 2). All CRES isolates exhibited the rib-lmb-cylE profile (Table 2). The CSER isolates had a diverse virulence gene profile. There was a significant difference in the frequency of lnu(B)-lsa(E) or lsa(C) between invasive (N=6/36, 16.7%) and non-invasive (N=13/30, 43.3%, P=0.017) isolates. There was no difference in the frequency of lnu(B)-lsa(E) or lsa(C) between urine (N=9/17, 52.9%) and vaginal discharge (N=4/13, 30.8%, P=0.200). The phylogenetic tree revealed that all CRES isolates belonged to the same group, whereas CSER isolates belonged to diverse groups, corroborating the clonal distribution of the CRES isolates (Fig. 2). The group distribution on the tree was in accordance with the CPS genotype distribution (e.g., Ia, Ib, III, V, and VIII).
Fig. 2

Phylogenetic tree of 66 S. agalactiae isolates. The phylogenetic tree was constructed using OAT, based on the OrthoANI algorithm, with S. agalactiae strain NCTC8181 (accession number UAVB00000000) as a reference. Asterisks (*) indicate CRES isolates, daggers (†) indicate CSER isolates. There was a concordance of the group distribution on the tree with the CPS genotype distribution (Ia, Ib, III, V, and VIII).

Abbreviations: CPS, capsular polysaccharide; CRES, clindamycin-resistant erythromycin-susceptible; CSER, clindamycin-susceptible erythromycin-resistant; CRER, clindamycin-resistant erythromycin-resistant; CSES, clindamycin-susceptible erythromycin-susceptible; CSEI, clindamycin-susceptible erythromycin-intermediate; CREI, clindamycin-resistant erythromycin-intermediate; CIES, clindamycin-intermediate erythromycin-susceptible; OAT, Orthologous Average Nucleotide Identity Tool.

The erm(B) sequence of the CRES isolate GCH61 in our study was compared with the previously registered sequence (738 bp) of S. agalactiae isolate KMP104 (RefSeq accession number DQ355148). This sequence (accession number LC512876) contained C222T (N74N), T224C (I75T), and A299G (N100S) nucleotide (amino acid) substitutions in addition to the insertion of an IS1216E element at nucleotide position 642, which resulted in the deletion of a segment spanning nucleotides 642–738 (97 bp) (Fig. 3).
Fig. 3

Comparison of sequences of GCH61, NUBL-9601, and KMP104. Sequence of erm(B) from isolate GCH61 (accession number VYRN00000000) with the CRES phenotype contained C222T (N74N), T224C (I75T), and A299G (N100S) nucleotide (amino acid) substitutions, in addition to the insertion of an IS1216E element at nucleotide position 642, which resulted in the deletion of a segment spanning nucleotides 642–738 (97 bp). This sequence was identical to that from the CRES isolate NUBL-9601 (accession number LC430933). The sequence of erm(B) from the isolate KMP104 was used as a reference (RefSeq accession number DQ355148).

Abbreviation: CRES, clindamycin-resistant erythromycin-susceptible.

DISCUSSION

Our study revealed that CRES isolates have unique features compared with CSER isolates, including their AMR genotype [lnu(B)-lsa(E) with aac(6′)-aph(2″)], ST19/CC19, CPS type III, virulence gene profile of rib-lmb-cylE, and in terms of cluster on the phylogenetic tree. We searched for the presence of CRES S. agalactiae isolates in the Isolates Database on the MLST website (https://pubmlst.org/bigsdb?db=pubmlst_sagalactiae_isolates&page=query). Interestingly, only one CRES isolate was previously recovered from a 61-year-old female patient with bacteremia in Kangwon Province in the north of Korea in 2010 [22]. Another CRES isolate of CPS genotype III was isolated from a patient with bacteremia in Bergen, Norway, in 2010 [23]. Three CRES isolates of serotype III were recovered from clinical specimens in Seoul during 2010–2013 [9, 24]. These findings are in line with our observation that all CRES isolates in Gyeongnam Province in the south of Korea were recovered between March 2010 and August 2011. Thus, the CRES isolates appeared to be epidemic in Korea and other countries during this limited period. In line with a previous study [11], we found a significant difference in the distribution of AMR genotype of lnu(B)-lsa(E) between the CRES and CSER isolates. For all CRES isolates, the lnu(B) locus was adjacent to the lsa(E) locus within the same contigs, with a short 53-bp distance between these two loci. Therefore, in our study, the lnu(B)-lsa(E) gene combination seems to mainly contribute to the CRES phenotype. Further observation of the dynamic changes in the CRES phenotype and the corresponding gene transfer is needed. The erm(B) confers constitutive resistance (cMLSB) through a conformational change in 23S ribosomal RNA methyltransferase [8]. Deletion of a segment in erm(B) sequence in CRES suggests loss of function of the erm(B) protein in this isolate, resulting in an erythromycin-susceptible phenotype. Interestingly, three CRES isolates (NUBL-9601, NUBL-9602, and NUBL-9603) isolated at a hospital in Seoul during 2010–2013 had the identical sequences (accession numbers LC430933, LC430934, and LC430935) (3) [9, 10]. Furthermore, we observed the IS1216E insertion in erm(B) (accession numbers LC512881, LC512882, LC512883, LC512885, and LC512886) in five isolates (GCH16, GCH19, GCH38, GCH55, and GCH58, respectively) of this study. Thus, IS1216E seems to be common among CRES isolates in Korea. Four CRES isolates (GCH63, GCH64, GCH65, and GCH67) in our study possessed truncated variant sequences of erm(B) (624 and 678 bps) due to insertion of a TAA stop codon into the open reading frame (accession numbers LC512877, LC512878, LC512879, and LC512880), suggesting that an immature erm(B) protein leads to the erythromycin-susceptible phenotype. Three other phenotypes (GCH50, GCH72, and GCH78) also had truncated variant sequences (660, 678, and 510 bps, respectively) (accession numbers LC512884, LC512887, and LC512888, respectively) harboring the erythromycin-susceptible phenotype. Therefore, we may explain the mechanism of the presence of erm(B)-gene with the erythromycin-susceptible phenotype in CRES S. agalactiae. This study has several limitations. First, clinical data, such as antibiotic treatment, outcome, and complications, does not suffice to demonstrate the relationship with the AMR genotype or virulence gene profile. Second, we cannot explain why the clonal outbreak occurred only during a limited period and is absent nowadays. Third, we did not determine translational activities and enzymatic functions of the IS1216E insertion-erm(B) and the truncated variant sequences. In conclusion, CRES isolates were obtained during a limited period (2010–2011) and showed a genetic cluster having ST19 and CPS III in Korea as revealed by WGS. This rare AMR phenotype should be meticulously monitored, and the therapeutic efficacy of optimal antibiotics should be further evaluated.
  22 in total

1.  Multilocus sequence typing of total-genome-sequenced bacteria.

Authors:  Mette V Larsen; Salvatore Cosentino; Simon Rasmussen; Carsten Friis; Henrik Hasman; Rasmus Lykke Marvig; Lars Jelsbak; Thomas Sicheritz-Pontén; David W Ussery; Frank M Aarestrup; Ole Lund
Journal:  J Clin Microbiol       Date:  2012-01-11       Impact factor: 5.948

2.  OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

Authors:  Imchang Lee; Yeong Ouk Kim; Sang-Cheol Park; Jongsik Chun
Journal:  Int J Syst Evol Microbiol       Date:  2015-11-09       Impact factor: 2.747

3.  Erythromycin-Susceptible but Clindamycin-Resistant Phenotype of Clinical ermB-PCR-Positive Group B Streptococci Isolates with IS1216E-Inserted ermB.

Authors:  Hiroaki Moroi; Kouji Kimura; Ayaka Ido; Hirotsugu Banno; Wanchun Jin; Jun-Ichi Wachino; Keiko Yamada; Fumitaka Kikkawa; Yeon-Joon Park; Yoshichika Arakawa
Journal:  Jpn J Infect Dis       Date:  2019-06-28       Impact factor: 1.362

4.  Pyogenic Sternoclavicular Arthritis Caused by Streptococcus agalactiae in an Elderly Adult with Diabetes Mellitus.

Authors:  Akiyoshi Shibayama; Tomoyuki Yoshizaki; Mitsugu Tamaki; Mieko Goto; Takashi Takahashi
Journal:  J Am Geriatr Soc       Date:  2016-06       Impact factor: 5.562

5.  PHYLOViZ 2.0: providing scalable data integration and visualization for multiple phylogenetic inference methods.

Authors:  Marta Nascimento; Adriano Sousa; Mário Ramirez; Alexandre P Francisco; João A Carriço; Cátia Vaz
Journal:  Bioinformatics       Date:  2016-09-06       Impact factor: 6.937

Review 6.  Surface proteins of Streptococcus agalactiae and related proteins in other bacterial pathogens.

Authors:  Gunnar Lindahl; Margaretha Stålhammar-Carlemalm; Thomas Areschoug
Journal:  Clin Microbiol Rev       Date:  2005-01       Impact factor: 26.132

7.  Changing molecular epidemiology of group B streptococcus in Korea.

Authors:  Yong Soo Seo; Usha Srinivasan; Kwan-Young Oh; Jung-Hwan Shin; Jeong Don Chae; Moon Young Kim; Jae Hyug Yang; Hye-Ryung Yoon; Brady Miller; Joan DeBusscher; Betsy Foxman; Moran Ki
Journal:  J Korean Med Sci       Date:  2010-05-24       Impact factor: 2.153

8.  Capsular type and antibiotic resistance in Streptococcus agalactiae isolates from patients, ranging from newborns to the elderly, with invasive infections.

Authors:  Somay Yamagata Murayama; Chizuko Seki; Hiroshi Sakata; Katsuhiko Sunaoshi; Eiichi Nakayama; Satoshi Iwata; Keisuke Sunakawa; Kimiko Ubukata
Journal:  Antimicrob Agents Chemother       Date:  2009-03-30       Impact factor: 5.191

9.  Lmb, a protein with similarities to the LraI adhesin family, mediates attachment of Streptococcus agalactiae to human laminin.

Authors:  B Spellerberg; E Rozdzinski; S Martin; J Weber-Heynemann; N Schnitzler; R Lütticken; A Podbielski
Journal:  Infect Immun       Date:  1999-02       Impact factor: 3.441

10.  Identification of acquired antimicrobial resistance genes.

Authors:  Ea Zankari; Henrik Hasman; Salvatore Cosentino; Martin Vestergaard; Simon Rasmussen; Ole Lund; Frank M Aarestrup; Mette Voldby Larsen
Journal:  J Antimicrob Chemother       Date:  2012-07-10       Impact factor: 5.790

View more
  4 in total

1.  Recent Epidemiological Changes in Group B Streptococcus Among Pregnant Korean Women.

Authors:  Seong Jin Choi; Jieun Kang; Young Uh
Journal:  Ann Lab Med       Date:  2021-07-01       Impact factor: 3.464

2.  Prevalence, population structure, distribution of serotypes, pilus islands and resistance genes among erythromycin-resistant colonizing and invasive Streptococcus agalactiae isolates recovered from pregnant and non-pregnant women in Isfahan, Iran.

Authors:  Tahereh Motallebirad; Hossein Fazeli; Ataollah Ghahiri; Dariush Shokri; Saba Jalalifar; Sharareh Moghim; Bahram Nasr Esfahani
Journal:  BMC Microbiol       Date:  2021-05-04       Impact factor: 3.605

3.  Performance of BD MAX Group B Streptococcus (GBS) Assay without Enrichment for the Detection of GBS.

Authors:  Sewhan Um; Jaeyoung Her; Si Hyun Kim; Sae Am Song; Young Nam Kim; Jeong Hwan Shin
Journal:  Ann Lab Med       Date:  2022-07-01       Impact factor: 4.941

4.  Comparing Genomic Characteristics of Streptococcus pyogenes Associated with Invasiveness over a 20-year Period in Korea.

Authors:  Hyoshim Shin; Takashi Takahashi; Seungjun Lee; Eun Hwa Choi; Takahiro Maeda; Yasuto Fukushima; Sunjoo Kim
Journal:  Ann Lab Med       Date:  2022-07-01       Impact factor: 4.941

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.