Literature DB >> 32308747

A COX-2/sEH dual inhibitor PTUPB alleviates lipopolysaccharide-induced acute lung injury in mice by inhibiting NLRP3 inflammasome activation.

Hui-Hui Yang1, Jia-Xi Duan2,3,4, Shao-Kun Liu2,3,4, Jian-Bing Xiong1, Xin-Xin Guan1, Wen-Jing Zhong1, Chen-Chen Sun1, Chen-Yu Zhang1, Xiao-Qin Luo1, Yan-Feng Zhang1, Ping Chen2,3,4, Bruce D Hammock5, Sung Hee Hwang5, Jian-Xin Jiang6, Yong Zhou1, Cha-Xiang Guan1.   

Abstract

Rationale: Dysregulation of arachidonic acid (ARA) metabolism results in inflammation; however, its role in acute lung injury (ALI) remains elusive. In this study, we addressed the role of dysregulated ARA metabolism in cytochromes P450 (CYPs) /cyclooxygenase-2 (COX-2) pathways in the pathogenesis of lipopolysaccharide (LPS)-induced ALI in mice.
Methods: The metabolism of CYPs/COX-2-derived ARA in the lungs of LPS-induced ALI was investigated in C57BL/6 mice. The COX-2/sEH dual inhibitor PTUPB was used to establish the function of CYPs/COX-2 dysregulation in ALI. Primary murine macrophages were used to evaluate the underlying mechanism of PTUPB involved in the activation of NLRP3 inflammasome in vitro.
Results: Dysregulation of CYPs/COX-2 metabolism of ARA occurred in the lungs and in primary macrophages under the LPS challenge. Decrease mRNA expression of Cyp2j9, Cyp2j6, and Cyp2j5 was observed, which metabolize ARA into epoxyeicosatrienoic acids (EETs). The expressions of COX-2 and soluble epoxide hydrolase (sEH), on the other hand, was significantly upregulated. Pre-treatment with the dual COX-2 and sEH inhibitor, PTUPB, attenuated the pathological injury of lung tissues and reduced the infiltration of inflammatory cells. Furthermore, PTUPB decreased the pro-inflammatory factors, oxidative stress, and activation of NACHT, LRR, and PYD domains-containing protein 3 (NLRP3) inflammasome in LPS-induced ALI mice. PTUPB pre-treatment remarkably reduced the activation of macrophages and NLRP3 inflammasome in vitro. Significantly, both preventive and therapeutic treatment with PTUPB improved the survival rate of mice receiving a lethal dose of LPS.
Conclusion: The dysregulation of CYPs/COX-2 metabolized ARA contributes to the uncontrolled inflammatory response in ALI. The dual COX-2 and sEH inhibitor PTUPB exerts anti-inflammatory effects in treating ALI by inhibiting the NLRP3 inflammasome activation. © The author(s).

Entities:  

Keywords:  COX-2/sEH dual inhibitor; NLRP3 inflammasome; acute lung injury; oxidative stress

Mesh:

Substances:

Year:  2020        PMID: 32308747      PMCID: PMC7163435          DOI: 10.7150/thno.43108

Source DB:  PubMed          Journal:  Theranostics        ISSN: 1838-7640            Impact factor:   11.556


Introduction

Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) are life-threatening diseases characterized by uncontrolled inflammatory responses, elevated penetrability of the alveolar- capillary barrier, and pulmonary edema 1, 2. Inflammatory response-activated macrophages, and neutrophils infiltrate into the lung. Cytokines are released by infiltrating cells activating local pro-inflammatory networks and reactive oxygen species (ROS) 3, 4. Also, NACHT, LRR and PYD domain-containing protein 3 (NLRP3) inflammasome plays a pivotal role in the pathogenesis of ALI 5, 6, and could cause irrevocable damage to lung epithelium and endothelial cells 7, 8. As a major constituent of the outer membrane of gram-negative bacteria, lipopolysaccharide (LPS) induces a diverse spectrum of infections, including life-threatening pneumonia and septicemia. The signaling also actives the downstream nuclear factor kappa-B (NF-κB) and augments inflammatory mediators 9. Hence, LPS has emerged as a clinically relevant model for ALI 10. The therapeutic approach to inflammatory diseases has mainly focused on targeting various fatty acids and lipids, such as arachidonic acid (ARA), which could be metabolized into eicosanoids. The cyclooxygenase (COX), lipoxygenase (LOX), and cytochrome p450 (CYP) are the three primary pathways for the production of eicosanoids 11. Collective evidence suggests that the epoxyeicosatrienoic acids (EETs) derived from the CYP pathway confer anti-inflammatory effects 12, 13. However, EETs are rapidly metabolized into the corresponding dihydroxyeicosatrienoic acids (DHETs) and diols mainly by the soluble epoxide hydrolase (sEH) 14. The sEH, a multifunctional protein encoded by the EPHX2 gene, is expressed in numerous tissues, including the lungs 15. Our laboratory as well as other researchers previously reported that inhibition of sEH or gene knockout exerts protective effects against ALI 16, 17 and pulmonary fibrosis 18. COX acts as the critical enzyme converting ARA to prostaglandins (PGs), which are generally very low in physiological conditions but increase in acute inflammation 19. COX-2 accounts for the increased production of PGs during inflammation and immune responses 20. The expression of COX-2 significantly increases during the development of ALI, and suppressing COX-2 attenuates LPS-induced ALI 21. Inhibition of a specific biosynthetic ARA pathway may alter the metabolic flux resulting in fatal side effects 22. sEH inhibitors and EETs can increase the expression of COX-2 23, 24. Therefore, it is imperative to develop novel anti-inflammatory strategies with a dual mechanism, which prevent the release of pro-inflammatory PGs and enhance the concentration of EETs. PTUPB (4-(5-phenyl-3-{3-[3-(4-trifluoromethylphenyl)-ureido]-propyl}-pyrazol-1-yl)-benzenesulfonamide), is a novel dual COX-2 and sEH inhibitor, which was developed in our previous study 25. It reduces the levels of COX-dependent PGs and increases the CYPs-dependent metabolites 26, indicating the suppression of both COX-2 and sEH pathways. Recently, we reported that PTUPB suppresses the growth of glioblastoma 27, reduces kidney injury and sepsis 28, 29, and attenuates pulmonary fibrosis 30. However, it is not clear whether dual inhibition of COX-2 and sEH exerts any protective effect against ALI. In the present study, we demonstrated dysregulation of CYPs /COX-2 during ALI and effective attenuation of ALI by dual inhibition of COX-2 and sEH with PTUPB.

Materials and Methods

Animals

Adult (6-8 weeks, 18-20 g) male C57BL/6 mice were purchased from Hunan SJA Laboratory Animal Co., Ltd (Hunan, China). All mice were kept in a controlled environment with 24-26 °C, 50%-60% humidity, and 12 h cycle of night and day. Experimental use of mice in the present study was performed according to the guidelines of the National Institutes of Health for live animals.

Animal treatment

Mice were randomly divided into the control, PTUPB, ALI, and ALI + PTUPB groups. ALI was induced as described in our previous study 16. Briefly, ALI was induced by intratracheal injection of LPS (5 mg/kg, from Escherichia coli O111: B4, Sigma-Aldrich, USA) dissolved in 50 μL sterile saline. Mice in the control and PTUPB groups received 50 μL sterile saline intratracheally. Mice in the PTUPB and PTUPB+ALI group were subcutaneously injected with PTUPB (5 mg/kg) dissolved in PEG400 1 h prior to the intratracheal injection. PEG400 was subcutaneously injected for the control and ALI groups. Mice were sacrificed 12 h after the LPS injection. A lethal dose of LPS (25 mg/kg) was injected into the trachea for survival study. PTUPB (5 mg/kg, subcutaneous) or PEG400 was administered to mice 1 h before or 6 h after the LPS injection. After the LPS injection, the survival rate was tracked every 6 h. All surgical procedures were performed under anesthesia.

Pulmonary function measurement

The testing system of the Buxco pulmonary function (Buxco, Sharon, Connecticut, CT, USA) was employed to detect the pulmonary function of mice, including airway resistance, lung compliance, and pulmonary ventilation, which was described in our previous study 31. The pulmonary function measurement was carried out in anesthetized mice.

Hematoxylin-Eosin (H&E) staining and inflammatory injury score analysis

Paraffin-embedded left lungs were sliced in 3-μm thickness and then stained with H&E to observe morphologic changes. Lung injury was measured as previously described 32. Briefly, the severity of the injury was graded from 0 to 4, according to five independent variables: hemorrhage, neutrophils in the alveolar space, hyaline membranes, pertinacious debris filling the airspaces, and septal thickening. The score of 0 means no damage; l, <25% damage; 2, 25 to 50% damage; 3, 50 to 75% damage and 4, > 75% damage. The inflammation score was measured independently by three pathologists blinded to the experiment. The scores from all three were averaged to give a final score.

Bronchoalveolar lavage fluid (BALF) collection and cell counts

BALF was collected as previously described 33. Briefly, the lungs were lavaged with 0.8 mL ice-cold PBS (pH = 7.4) three times. The recovered fluid was centrifuged at 1500 rpm for 5 min at 4 ℃, and then the supernatant was collected and stored at -80 ℃ for subsequent experiments. The sedimented cell pellets were re-suspended in 0.5 mL PBS, then cells, including macrophages and neutrophils, were counted with a hemocytometer and Wright-Giemsa staining using a light microscope as described in our previous study 16.

Evaluation of oxidative stress

The up-right lung lobes of mice were homogenized in PBS at a ratio of 1:10 (weight: volume). Total activity of superoxide dismutase (SOD), the level of malondialdehyde (MDA), and reactive oxygen species (ROS) in the lungs were assessed by corresponding kits following manufacturer's instructions (Cat# SOD: A001-3; MDA: A003-1; ROS: E004, Jiancheng Bioengineering Institute, Nanjing, China).

Isolation and treatment of primary murine peritoneal macrophages

Primary murine peritoneal macrophages were isolated and cultured as outlined in our previous study 34. Cells were plated into 12-well plates (1×106 cells/well) for gene and protein detection, 24-well plates (0.5×106 cells/well) for immunofluorescence staining, 6-well plates (2×106 cells/well) for ROS evaluation, and 100 mm culture dishes (1×107 cells/dish) for immunoprecipitation (IP). To estimate the effect of PTUPB on LPS (100 ng/mL)-challenged murine macrophages, a series of concentrations of PTUPB (10, 100, 1000, and 10000 nM) were added 1 h before LPS (100 ng/mL) stimulation; cells in the control group were treated with DMSO. Six hours later, macrophages were harvested for gene detection. Twelve hours later, macrophages were harvested for protein and immunofluorescence staining detection. To evaluate the effect of PTUPB on the NLRP3 inflammasome activation, PTUPB (1000 nM) was added to the cultures 1 h ahead of the LPS treatment (100 ng/mL) for 135 min and adenosine triphosphate (ATP, 2.5 mM) treatment for another 45 min.

Detection of lactate dehydrogenase (LDH) activity

The activity of LDH in serum, BALF, and the supernatant was detected by using the LDH Cytotoxicity Assay Kit (Cat# A020-2, Jiancheng Bioengineering Institute, Nanjing, China).

Real-time quantitative polymerase chain reaction (RT-qPCR)

The extraction of total RNA, generation of cDNA, and RT-qPCR were achieved as described in our previous study 33. Gene expression was measured by 2-ΔCt, and the relative gene expression was assayed by 2-ΔΔCt according to the previous study 35, 36. Primers used in this study were synthesized by Sangon Biotech (Shanghai, China) as our previous studies 30, 33, and the sequences are shown in Table 1.
Table 1

Sequences of the primers used to quantitate gene expression.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
Cyp2j9AGTCAGTCACCGCCTTTGTGGTCTCATTGCACGCACTCTC
Cyp2j6GGTGCCCTTGTTGTTAGCACGGCTAACAAGGAGCCGGTAG
Cyp2j5TGATGGGTTCATCAGCAGGCCTTGGCTCATCTGGGTTCCAAT
Cyp2c29 CCATGGTTGCAGGTAAACCACATTCTGTCCCTGCACCAAAGAG
Cyp2c44CAAGGTACCCCGAGTGAAGAACACGGCATCTGTATAGGGCA
Cox-2CATCCCCTTCCTGCGAAGTTCATGGGAGTTGGGCAGTCAT
Nox-2GACTGCGGAGAGTTTGGAAGGGTGATGACCACCTTTTGCT
Tnf-αAGCCCCCAGTCTGTATCCTTCTCCCTTTGCAGAACTCAGG
Mcp-1GTCCCTGTCATGCTTCTGGGCGTTAACTGCATCTGGCT
Trem-1CTGTGCGTGTTCTTTGTCCTTCCCGTCTGGTAGTCT
Nlrp3TACGGCCGTCTACGTCTTCTCGCAGATCACACTCCTCAAA
pro-caspase-1CACAGCTCTGGAGATGGTGACTTTCAAGCTTGGGCACTTC
AscGACAGTACCAGGCAGTTCGTAGTCCTTGCAGGTCAGGTTC
pro-Il-1βCAGGCAGGCAGTATCACTCAAGCTCATATGGGTCCGACAG
Nf-κb/p65GGAGGCATGTTCGGTAGTGGCCCTGCGTTGGATTTCGTG
β-actinTTCCAGCCTTCCTTCTTGGGAGCCAGAGCA GTAATC

Cytokine detection

The contents of tumor necrosis factor-alpha (TNF-α), monocyte chemotactic protein 1 (MCP-1), and interleukin-1 beta (IL-1β) in BALF, serum, cell culture supernatant, or the lung tissue were measured using ELISA kits (Cat# TNF-α: 88-7324; MCP-1: 88-7391; IL-1β: 88-7013; Invitrogen, Thermo Fisher Scientific, USA). The contents were assayed by comparison of the optical density (450 nm and 570 nm) with the standard curve.

Western blotting

Proteins from the lung tissue or macrophages were extracted and analyzed using Western blotting as described in our previous study 37. Frozen lung tissue was homogenized and lysed in RIPA buffer (Solarbio, Beijing, China) containing a protease inhibitor (Roche, Mannheim, Germany). The protein concentrations were measured with Pierce™ BCA Protein Assay Kit (Cat# 23225, Thermo Fisher Scientific, Grand Island, NY, USA). Samples mixed with the loading buffer were separated on an SDS-PAGE gel. After transferring to polyvinylidene fluoride membranes (Millipore, Bedford, MA) by electrotransfer, the membranes were blocked with 5% BSA or non-fat milk at room temperature for 1.5 h, incubated with primary antibodies at 4 °C overnight, and then incubated with peroxidase-conjugated secondary antibodies at room temperature for 1 h. The image of protein brands was captured by a gel imaging system. The relative band intensity was measured using the Image Lab Analyzer software (Bio-Rad, Hercules, CA, USA). The antibodies used in the study are shown in Table 2.
Table 2

Antibody sources and dilutions.

AntibodiesSourceCatalogDilution ratio
Primary antibodies for Western blotting
Anti-sEH monoclonal antibodyAbcamab1552801: 1000
Anti-COX-2 polyclonal antibodyProteintech12375-1-AP1: 2000
Anti-Nrf2 monoclonal antibodyCST#127211: 1000
Anti-TREM-1 polyclonal antibodyProteintech11791-1-Ap1: 1000
Anti-NLRP3 monoclonal antibodyCST#151011: 2000
Anti-IL-1β polyclonal antibodyR&DAF-401-NA1: 2000
Anti-pro-caspase-1/p10/p20 monoclonal antibodyAbcamAb1795151: 1000
Anti-I-κBα monoclonal antibodyAbcamAb325181:2500
Secondary antibodies for Western blotting
Anti-β-actin polyclonal antibodySAB#213381: 7500
Anti-β-tubulin monoclonal antibodyServicebio#488851: 2000
Antibodies for IP assay
Anti-NLRP3 monoclonal antibodyAdipoGenAG-20B-0014-C1001:1000
Anti-ASC monoclonal antibodyCST67824S1:1000

IP assay

For the detection of the interaction between NLRP3 and ASC (apoptosis-associated speck-like protein containing a CARD), primary murine peritoneal macrophages were washed with PBS (pH = 7.4) three times, collected and lysed with lysis buffer including complete protease inhibitor PMSF (Solarbio, P0100) and Protease Inhibitor Cocktail (MCE, HY-K0010) on ice for 35 min, then centrifuged at 12,000 rpm for 10 min at 4 °C. The supernatant (100 μL) was transferred to another cold tube and incubated with 55 μL Dynabeads™ Protein G (Invitrogen, 10004D) at 4 °C for 3 h, centrifuged at 500 g for 10 min at 4 °C. Subsequently, the Dynabeads were separated with The DynaMag™-2 (Invitrogen, 12321D). The supernatant (80 μL) was collected and anti-ASC (1:100; CST, 67824S) antibody was added at 4 °C overnight. Then, 30 μL Dynabeads™ Protein G was added to the supernatant and soaked for another 3 h on ice. The beads were washed with the lysis buffer three times and the Dynabeads were separated with The DynaMag™-2. The immunoprecipitated proteins were analyzed by Western blotting.

Statistical analysis

All experiments were independently repeated three times. Results were shown as the mean ± SD values. All data were analyzed with SPSS 22.0 (IBM, Chicago, IL) or GraphPad Prism 7 software (San Diego, CA, USA). A P-value of < 0.05 was regarded as statistically significant. Statistical comparisons between two groups were determined by unpaired t-test. Differences among multiple groups were determined by ANOVA, followed by Bonferroni correction for multiple comparison testing. The data that were not normally distributed were analyzed using nonparametric statistical analysis. The survival rate was assayed by the log-rank test.

Results

Dysregulation of CYPs /COX-2 metabolism of ARA occurs in the lungs and macrophages under the LPS challenge

We first investigated whether the CYPs/COX-2 metabolism-derived ARA was altered during ALI. We analyzed the expression of Cyp2j9, Cyp2j6, Cyp2j5, Cyp2c29, and Cyp2c44 in the lungs of mice and found that Cyp2j9 and Cyp2j6 were expressed in the lungs, whereas Cyp2c29 and Cyp2c44 mRNAs were undetectable (Figure 1A). Under LPS stimulation, the expression of Cyp2j9, Cyp2j6, and Cyp2j5 mRNAs in the lungs was significantly abated (Figure 1B), while the expression of sEH and COX-2 was considerably increased (Figure 1C-F). Since macrophages have pivotal roles in the initiation of innate immune response at the early stage of ALI, we used primary murine macrophages to evaluate the expression pattern of CYPs/COX-2 metabolism of ARA in vitro. The results were consistent with those of the lungs in vivo (Figure 1G-L). Collectively, these data indicate that the dysregulation of CYPs/COX-2 metabolism of ARA occurs in the lungs and macrophages under the LPS challenge.
Figure 1

Dysregulation of CYPs/COX-2 metabolism of ARA occurs in the lungs and macrophages under the LPS challenge. Cyp2j9 was the most abundant CYP isoform expressed in the lungs, whereas Cyp2c29 and Cyp2c44 mRNA were undetectable (A, n = 6). Cyp2j9, Cyp2j6, and Cyp2j5 mRNAs were robustly decreased at 12 h after LPS administration (5 mg/kg, i.t.) in the lungs (B, n = 6). Western blotting and RT-qPCR results showing increased sEH and COX-2 proteins, and Cox-2 mRNA at 12 h after LPS administration. (C-F, n = 4-8). Cyp2j6 was the most abundant CYP isoform expressed in primary murine macrophages after treatment with LPS (100 ng/mL), whereas Cyp2c29 and Cyp2c44 mRNA were undetectable (G, n = 3). Cyp2j6 and Cyp2j9 mRNA were remarkably decreased at 6 h after LPS administration (H, n = 3). Expression of sEH and COX-2 protein and Cox-2 mRNA were detected by Western blotting and RT-qPCR (I-L, n = 3). Data are expressed as the mean ± SD. * P < 0.05, ** P < 0.01, and *** P < 0.001.

PTUPB attenuates the pathological lung injury and rescues the respiratory function of mice treated with LPS

We used PTUPB for the dual inhibition of COX-2 and sEH to establish the function of CYPs/COX-2 dysregulation in ALI. PTUPB reduced the expression of sEH and COX-2 (Figure S1A-C), but had no effect on the expression of Cyp2j9 and Cyp2j6 (Figure S1D- E), as well as Alox5/12/15 (encoding 5/12/15-LOX, Figure S1F-H). Following LPS stimulation, there was an increase in the thickness of the alveolar wall, interstitial infiltrated inflammatory cells, and the collapse of the alveoli in the lungs of mice (Figure 2A). Remarkably, PTUPB pre-treatment alleviated these pathological changes (Figure 2A-B) and pronounced reduced the LDH activity in the serum (Figure 2C). Additionally, we evaluated the effects of PTUPB on the respiratory function of ALI mice. The results showed that PTUPB pre-treatment significantly reduced airway resistance (Figure 2D), and increased lung compliance and pulmonary ventilation of mice with ALI induced by LPS (Figure 2E-F). These results demonstrate that PTUPB attenuates pathological injury of the lung tissue and enhances the respiratory function of LPS-treated ALI mice.
Figure 2

PTUPB attenuates the pathological lung injury and rescues the respiratory function of ALI mice. C57BL/6 mice were subcutaneously injected with PTUPB 1 h before the LPS administration. Twelve hours after LPS injection (5 mg/kg, i.t.), lung histopathology was performed with H&E staining (A). Inflammation score was measured independently by three pathologists blinded to the experiment (B, n = 6). Activity of LDH in the serum was assayed (C, n = 7-8). Respiratory function was detected by Buxco, including airway resistance (D, n = 5-8), lung compliance (E, n = 5-8), and pulmonary ventilation (F, n = 5-8). Data are mean ± SD. * P < 0.05, ** P < 0.01, and *** P < 0.001.

PTUPB reverses the infiltration of inflammatory cells and oxidative stress in ALI mice treated with LPS

Next, we found that pre-treatment PTUPB remarkably reduced the number of total cells (Figure 3A), macrophages (Figure 3B), and neutrophils (Figure 3C) in the BALF, as well as MPO activity in the lungs of ALI mice (Figure 3D). Immunofluorescence results confirmed the inhibitory effects of PTUPB on the accumulation of neutrophil and macrophages (Figure S2). One of the characteristic features of ALI is oxidative stress. Pre-treatment with PTUPB reduced the MDA content and total ROS in the lungs of ALI mice (Figure 3E-F). Furthermore, NADPH oxidases (NOXs) are important sources for the regulated generation of ROS 38 and our results demonstrated that PTUPB suppressed the expression of Nox2 mRNA (Figure 3G). PTUPB pre-treatment also restored the activity of the anti-oxidative enzyme SOD (Figure 3H) in serum, and partially restored the protein expression of nuclear factor-erythroid-2- related-factor-2 (Nrf2) in the lungs, which were both reduced in ALI mice (Figure 3I-J). Collectively, these data reveal that the dual inhibition of COX-2/sEH reverses the accumulation of the inflammatory cells and oxidative stress.
Figure 3

PTUPB reverses the infiltration of inflammatory cells and oxidative stress in ALI mice. C57BL/6 mice received LPS injection (5 mg/kg, i.t.) with or without PTUPB pre-treatment (5 mg/kg) for 1 h. Twelve hours after the LPS injection, the total cells (A), macrophages (B), and neutrophils (C) in the BALF were counted (n = 6-10). MPO activity was detected to quantify the infiltration of neutrophils in the lungs (D, n = 7-10). MDA and total ROS in the lungs were detected 12 h after the LPS administration (E-F, n = 6-9). mRNA expression of Nox2 in the lungs was detected by RT-qPCR (G, n = 5-8). Total SOD activity in serum was detected 12 h after the LPS administration (H, n = 6-10). Protein expression of Nrf2 in the lungs was assayed by Western blotting (I-J, n = 4-8). Data are mean ± SD. * P < 0.05, ** P < 0.01, and *** P < 0.001.

PTUPB reverses the augment of pro-inflammatory factors in the lungs of ALI mice

“Cytokine storms” is well characterized in ALI. TNF-α-targeting aptamer with antagonistic effect on TNF-α attenuates the severity of acute lung injury 39. We found that the expression of TNF-α and MCP-1 was profoundly up-regulated in the lungs of mice 12 h post LPS treatment (Figure 4A-F). PTUPB pre-treatment remarkably suppressed the increase in TNF-α and MCP-1 expression in the lungs, serum, or BALF of ALI mice (Figure 4A-F). Our pervious study indicated that the triggering receptor expressed on myeloid cells (TREM-1) acted as a pivotal inflammatory amplifier receptor in ALI 37. Here, we found that PTUPB pre-treatment also down-regulated the mRNA and protein expression of TREM-1 in the lungs of ALI mice (Figure 4G-I). Altogether, our data indicate that blockade of COX-2/sEH reduces the pro- inflammatory factors in ALI mice induced by LPS.
Figure 4

PTUPB attenuates the production of pro-inflammatory factors in the lungs of ALI mice. C57BL/6 mice received LPS injection (5 mg/kg, i.t.) with or without PTUPB pre-treatment (5 mg/kg) for 1 h. Twelve hours after the LPS administration, mRNA expression of Tnf-α (A, n = 6-7), Mcp-1 (D, n = 6-7), and Trem-1 (G, n = 5-7) in the lungs was detected by RT-qPCR. Protein content of TNF-α in lung tissue (B, n = 6-8) and BALF (C, n = 6-8), MCP-1 in serum (E, n = 5-8) and BALF (F, n = 6-8) was assayed by ELISA. Expression of TREM-1 in lung tissue was assayed by Western blotting (H-I, n = 4). Data are expressed as the mean ± SD. * P < 0.05, ** P < 0.01, and *** P < 0.001.

PTUPB inhibits activation of NLRP3 inflammasome in the lungs of ALI mice

A growing body of literature has shown that the NLRP3 inflammasome plays a pivotal role in the pathogenesis of ALI 5, 6. Here, we found that blockade of COX-2/sEH by PTUPB reversed the up- regulation of components of the NLRP3 inflammasome, including Nlrp3, pro-caspase-1, Asc, and pro-Il-1β mRNAs in the lungs of ALI mice (Figure 5A-D). Besides, PTUPB pre-treatment also strongly reduced the expression of NLRP3 and pro-IL-1β proteins (Figure 5E-G) and NF-κB is known to be involved in the expression of these proteins. We found that PTUPB also reduced the mRNA expression of Nf-κb/ p65 (Figure 5H). Also, caspase-1 p10 is a biomarker for the activation of NLRP3 inflammasome, which cleaves pro-IL-1β into IL-1β p17 40, 41. We found that PTUPB pre-treatment markedly blocked LPS-induced expression of caspase-1 p10 and release of IL-1β p17 (Figure 5I-L). Altogether, these data indicate that PTUPB inhibits the activation of NLRP3 inflammasome in the lungs of ALI mice.
Figure 5

PTUPB inhibits the activation of NLRP3 inflammasome in the lung of ALI mice. C57BL/6 mice received LPS injection (5 mg/kg, i.t.) with or without PTUPB pre-treatment (5 mg/kg) for 1 h. mRNA expression of Nlrp3 (A, n = 6-7), pro-caspase-1 (B, n = 6-7), Asc (C, n = 6-7), and pro-Il-1β (D, n = 6-7) in the lungs was detected by RT-qPCR 12 h after the LPS injection. Protein expression of NLRP3 and pro-IL-1β (E-G, n = 4) in the lungs was detected by Western blotting. mRNA expression of Nf-κb/p65 (H, n = 6-9) in the lungs was detected by RT-qPCR 12 h after the LPS injection. Protein expression of caspase-1p10 and IL-1βp17 in the lungs was detected by Western blotting (I-K, n = 4). Concentration of IL-1β in lung tissue was detected by ELISA (L, n = 5-8). Data are expressed as the mean ± SD. * P < 0.05, ** P < 0.01, and *** P < 0.001.

Prophylactic and therapeutic treatments of PTUPB significantly prevent the death of LPS-treated mice

Pre-treatment with PTUPB (5 mg/kg) 1 h before LPS administration significantly prevented the death of mice receiving 25 mg/kg LPS (Figure 6A). We further examined the potential of therapeutic benefits of PTUPB treatment (5 mg/kg) 6 h post LPS administration. Post-treatment with PTUPB significantly prevented the death of LPS-treated mice (Figure 6B). These results indicate that blockade of COX-2/sEH by PTUPB shows prophylactic and therapeutic protection against LPS-induced ALI in mice.
Figure 6

Prophylactic and therapeutic treatment of PTUPB prevents death from LPS administration in mice. PTUPB (5 mg/kg, s.c.) was administered to mice 1 h before (A) or 6 h after (B) induction of ALI by a lethal dose of LPS (25 mg/kg, i.t.). The mortality of the mice was monitored every 6 h, and the percent survival rate was expressed as a Kaplan-Meier survival curve (n = 20 per group). *** P < 0.001.

PTUPB reduces priming of NLRP3 inflammasome in primary murine macrophages

Treatment with clodronate-loaded liposomes that deplete macrophages significantly attenuated the lung tissue pathological injury (Figure S3A-C), and reduced the activation of NLRP3 inflammasome (Figure S3D-F). We evaluated the effects of PTUPB on the inflammatory response of primary murine macrophages and found that low-dose PTUPB (≤1000 nM) had no detectable influence on LDH release from macrophages (Figure 7A). However, PTUPB pre-treatment at 10, 100, and 1000 nM concentrations remarkably reduced the LDH activity induced by LPS (100 ng/mL) (Figure 7B). PTUPB also restored the protein expressions of COX-2 and sEH induced by LPS in macrophages (Figure S4). Furthermore, PTUPB (1000 nM) significantly reversed the expression of pro-inflammatory factors induced by LPS, including TNF-α (Figure 7C-D) and MCP-1 (Figure 7E-F). Importantly, PTUPB pre-treatment remarkably suppressed priming of NLRP3 inflammasome characterized by the inhibition of Nlrp3 and pro-caspase-1 mRNAs, and NLRP3 protein (Figure 7G-J). NF-κB plays a vital role in priming of NLRP3 inflammasomes 40. PTUPB pre-treatment inhibited the expression of Nf-κb/p65 mRNA (Figure 7K), restored the expression of I-κBα protein in the lungs (Figure 7L-M), and inhibited its translocation into the cell nucleus (Figure S5). These results imply that blockade of COX-2/sEH reverses the priming of NLRP3 inflammasome in macrophages in vitro.
Figure 7

PTUPB reduces the inflammation and priming of NLRP3 inflammasome in primary murine macrophages. Primary murine macrophages were treated with serial concentrations of PTUPB (10, 100, 1000, and 10000 nM) for 6 h and the LDH activity in the supernatant of cell culture was detected (A). Macrophages were treated with LPS (100 ng/mL) for 6 h with or without PTUPB pre-treatment (10, 100, and 1000 nM) for 1 h and activity of LDH in the supernatant was detected (B). Expression of Tnf-α (C), Mcp-1 (E), Nlrp3 (G), pro-caspase-1 (H), and Nf-κb/p65 (K) mRNAs in macrophages was detected by RT-qPCR. Concentration of TNF-α (D) and MCP-1 (F) in the supernatant of cell culture was detected by ELISA (n = 3). Protein expression of NLRP3 and IκBα in macrophages was detected by Western blotting (I-J, n = 4; L-M, n = 3). Data are expressed as the mean ± SD. ** P < 0.01, and *** P < 0.001.

PTUPB inhibits the activation of NLRP3 inflammasome in primary murine macrophages

Lastly, we treated macrophages with LPS plus ATP to activate the NLRP3 inflammasome. We found that PTUPB reduced the protein expression of caspase-1 p10 and IL-1β p17 in macrophages (Figure 8A-C). NLRP3 complex formation is the key step for the activation of NLRP3 inflammasome 42. IP results showed that PTUPB inhibited the interaction of endogenous NLRP3 and ASC in macrophages (Figure 8D). ROS is one of the most important factors regulating the activation of NLRP3 inflammasome and PTUPB reversed the elevated ROS (Figure 8E-F). These results imply that blockade of COX-2/sEH reverses the activation of NLRP3 inflammasome in macrophages by suppressing ROS generation.
Figure 8

PTUPB inhibits the activation of NLRP3 inflammasome in primary murine macrophages. To evaluate the effects of PTUPB on the activation of NLRP3 inflammasome, PTUPB (1000 nM) was added 1 h before LPS-priming (100 ng/mL) for 135 min. Subsequently, cells were stimulated with ATP (2.5 mM) for 45 min. Protein expression of caspase-1 p10 and IL-1β p17 in macrophages was detected by Western blotting (A-C, n = 3). Interaction between endogenous NLRP3 and ASC was analyzed by IP (D). The ROS was analyzed by a ROS kit (E-F). Data are expressed as the mean ± SD. * P < 0.05, ** P < 0.01, and *** P < 0.001.

Discussion

Our study demonstrated that CYPs/COX-2 dysregulation occurred during the inflammation induced by LPS both in mice and in cultured macrophages, which was evidenced by lower CYPs expression and higher COX-2 expression. Restoring the homeostasis of ARA metabolism by CYPs/COX-2 with PTUPB could alleviate lung tissue pathological injury, reduce oxidative stress and decrease the secretion of pro-inflammatory factors, and inhibit the activation of NLRP3 inflammasome in the lungs of ALI mice. We report here for the first time that dysregulated metabolism of CYPs/COX-2-derived ARA plays a vital role in LPS-induced ALI mice, and the dual inhibition of COX-2 and sEH may be an effective anti-inflammatory strategy in treating ALI. Proper regulation of the biosynthesis of eicosanoids is critical for homeostasis. Detrimental consequences of the overproduction of COX and LOX pathways have been described in many inflammatory diseases in human beings 43, 44. For example, COX-2 is expressed in different cell types in the lungs, and its increased expression was observed in the lungs of LPS-induced ALI mice 21. Similarly, EETs exhibit anti-inflammatory actions in many diseases, such as central nervous system diseases 12, insulin resistance 45, and pulmonary diseases 16, 18, 34. However, litter is known about the dysregulated metabolism of CYPs/COX-2-derived ARA in LPS-induced ALI. This is the first report showing a decrease of CYP2J/2C and an increase of COX-2, and demonstrating the dysregulation of CYPs/COX-2 in the lungs of LPS-induced ALI mice. A growing body of studies focuses on designing multiple ligands (DMLs) to augment drug efficacy, improve drug safety, and reduce side effects. Compared with combination drugs or therapies, DMLs have several advantages 22, 46, 47. We had previously designed PTUPB, which is a novel COX-2 and sEH dual inhibitor 25. We demonstrated that PTUPB could suppress the growth of glioblastoma, abate kidney injury, and exert a synergistic effect with cisplatin 26-28. Importantly, we did not observe any acute toxicity in vivo or in vitro 25. We also found that PTUPB had no effect on the expression of LOXs but significantly reduced the expression of COX-2 and sEH. In this study, we found that dual inhibition of COX-2 and sEH exhibited a powerful therapeutic potential for ALI. One critical pathophysiological process in ALI/ARDS is manifested by extensive inflammation 48. Our laboratory as well as other investigators have shown that NLRP3 inflammasome plays a central role in the immense inflammation of ALI 6, 37. Recently, one study described that monounsaturated and polyunsaturated fatty acids could impede the NLRP3 inflammasome activation in metabolic diseases 49, but it was not clear whether CYPs/COX-2 were involved in the activation of NLRP3 inflammasome. In this study, our findings demonstrated that the dysregulated metabolism of CYPs/COX-2 was associated with the activation of NLRP3 inflammasome in the lungs of ALI mice. It has been reported that COX-2-mediated PGE2 positively regulates the activation of the NLRP3 inflammasome, and inhibition of COX-2 reduces NLRP3 inflammasome-derived IL-1β secretion and pyroptosis in macrophages 50, 51. We have found that inhibition of sEH suppressed the secretion of IL-1β in LPS-induced ALI mice 16, indicating that EETs could inhibit the activation of NLRP3 inflammasome. In hyperoxia-induced ALI mice, Ephx2-/- mice showed decreased activation of NLRP3 inflammasome 52. These reports support our findings that dual inhibition of COX-2 and sEH with PTUPB suppresses the activation of NLRP3 inflammasome. Oxidative stress is another indispensable characteristic of ALI. Our studies show that PTUPB attenuates the oxidative stress in the lungs of ALI mice, and enhances the antioxidative mechanism involving Nrf2 and SOD. It has been well documented that ROS is one of the most important factors regulating the activation of NLRP3 inflammasome 40. Although one study proposed that Nrf2 was necessary for the NLRP3 inflammasome activation 53, another one indicated that Nrf2 limited the NLRP3 inflammasome activation by down-regulating ROS production 54. Our findings demonstrated that PTUPB restored the expression of Nrf2 and reduced the oxidative stress in the lungs of LPS-induced ALI mice. Given these results, we infer that PTUPB inhibits the NLRP3 inflammasome activation by restoring the balance of oxidative and anti-oxidative mechanisms during ALI. There are limitations to the present study. First, we evaluated the gene expression of specific critical enzymes, including Cyp2j/2c. It is possible that whether their mediators contribute to the mechanism of action of PTUPB in LPS-induced mice. Our previous study detected the ARA metabolites of the CYP, COX, and LOX pathways in the serum of LPS-treated mice by LC-MS/MS 55. Especially, the pro-inflammatory mediator PGE2 had the most significant alteration (~30 fold), and 12,13-DHOME, 9,10-DHOME in the sEH pathway were increased 55. We also found that PTUPB reduced the level of PGE2 derived from the COX-2 pathway and 12,13-DiHOME derived from the sEH pathway in PDX BL0269 tumor tissues 26. Thus, it appears that PTUPB treatment affects the profiles of ARA metabolites. And second, the reduction in the expression of sEH and COX-2 by PTUPB might be an indirect effect caused by inflammation, which up-regulates the expressions of sEH and COX-2 19, 56. PTUPB blocks the enzyme activities of sEH and COX-2, resulting in low inflammation. So, we propose that PTUPB not only blocks the enzyme activity but also indirectly reduces the enzyme expression. In conclusion, this is the first report revealing that dysregulation of CYPs/COX-2-derived ARA metabolism contributes to lung injury in LPS-induced ALI mice. PTUPB, a dual COX-2 and sEH inhibitor, exerts an anti-inflammatory response and protects mice against LPS-induced ALI. Therefore, CYPs/ COX-2 dysregulation represents a novel potential target for treating ALI/ARDS. Supplementary materials and methods, figures, and tables. Click here for additional data file.
  56 in total

Review 1.  Cyclooxygenase isozymes: the biology of prostaglandin synthesis and inhibition.

Authors:  Daniel L Simmons; Regina M Botting; Timothy Hla
Journal:  Pharmacol Rev       Date:  2004-09       Impact factor: 25.468

2.  Soluble epoxide hydrolase inhibitor 1-trifluoromethoxyphenyl-3- (1-propionylpiperidin-4-yl) urea attenuates bleomycin-induced pulmonary fibrosis in mice.

Authors:  Yong Zhou; Jun Yang; Guo-Ying Sun; Tian Liu; Jia-Xi Duan; Hui-Fang Zhou; Kin Sing Lee; Bruce D Hammock; Xiang Fang; Jian-Xin Jiang; Cha-Xiang Guan
Journal:  Cell Tissue Res       Date:  2015-08-28       Impact factor: 5.249

3.  Cyclooxygenase-2 regulates NLRP3 inflammasome-derived IL-1β production.

Authors:  Kuo-Feng Hua; Ju-Ching Chou; Shuk-Man Ka; Yu-Ling Tasi; Ann Chen; Shih-Hsiung Wu; Hsiao-Wen Chiu; Wei-Ting Wong; Yih-Fuh Wang; Change-Ling Tsai; Chen-Lung Ho; Cheng-Hsiu Lin
Journal:  J Cell Physiol       Date:  2015-04       Impact factor: 6.384

Review 4.  Prostaglandins and chronic inflammation.

Authors:  Tomohiro Aoki; Shuh Narumiya
Journal:  Trends Pharmacol Sci       Date:  2012-03-28       Impact factor: 14.819

5.  LFG-500, a newly synthesized flavonoid, attenuates lipopolysaccharide-induced acute lung injury and inflammation in mice.

Authors:  Chenglin Li; Dan Yang; Xin Cao; Fan Wang; Haijing Jiang; Hao Guo; Lei Du; Qinglong Guo; Xiaoxing Yin
Journal:  Biochem Pharmacol       Date:  2016-05-17       Impact factor: 5.858

6.  Activation of MTOR in pulmonary epithelium promotes LPS-induced acute lung injury.

Authors:  Yue Hu; Jian Lou; Yuan-Yuan Mao; Tian-Wen Lai; Li-Yao Liu; Chen Zhu; Chao Zhang; Juan Liu; Yu-Yan Li; Fan Zhang; Wen Li; Song-Min Ying; Zhi-Hua Chen; Hua-Hao Shen
Journal:  Autophagy       Date:  2016-09-22       Impact factor: 16.016

7.  Inhibition of glycolysis alleviates lipopolysaccharide-induced acute lung injury in a mouse model.

Authors:  Wen-Jing Zhong; Hui-Hui Yang; Xin-Xin Guan; Jian-Bing Xiong; Chen-Chen Sun; Chen-Yu Zhang; Xiao-Qin Luo; Yan-Feng Zhang; Jun Zhang; Jia-Xi Duan; Yong Zhou; Cha-Xiang Guan
Journal:  J Cell Physiol       Date:  2018-09-07       Impact factor: 6.384

Review 8.  The role of lipoxygenases in pathophysiology; new insights and future perspectives.

Authors:  Ryuichi Mashima; Torayuki Okuyama
Journal:  Redox Biol       Date:  2015-08-07       Impact factor: 11.799

9.  Knockdown of NEAT1 induces tolerogenic phenotype in dendritic cells by inhibiting activation of NLRP3 inflammasome.

Authors:  Maomao Zhang; Yang Zheng; Yong Sun; Shuang Li; Liangqi Chen; Xiangyuan Jin; Xinyu Hou; Xianglan Liu; Qi Chen; Jing Li; Mingyang Liu; Xianghui Zheng; Yongxiang Zhang; Jian Wu; Bo Yu
Journal:  Theranostics       Date:  2019-05-24       Impact factor: 11.556

10.  The NLRP3 inflammasome pathway is activated in sarcoidosis and involved in granuloma formation.

Authors:  Christine Huppertz; Benedikt Jäger; Grazyna Wieczorek; Peggy Engelhard; Stephen J Oliver; Franz-Georg Bauernfeind; Amanda Littlewood-Evans; Tobias Welte; Veit Hornung; Antje Prasse
Journal:  Eur Respir J       Date:  2020-03-26       Impact factor: 16.671

View more
  28 in total

1.  Systematic analysis using a bioinformatics strategy identifies SFTA1P and LINC00519 as potential prognostic biomarkers for lung squamous cell carcinoma.

Authors:  Yu-Zhen Yin; Shi-Hua Yao; Chun-Guang Li; Yu-Shui Ma; Zhou-Jun Kang; Jia-Jia Zhang; Cheng-You Jia; Li-Kun Hou; Shan-Shan Qin; Xin Fan; Han Zhang; Meng-Die Yang; Dan-Dan Zhang; Gai-Xia Lu; Hui-Min Wang; Li-Peng Gu; Lin-Lin Tian; Pei-Yao Wang; Ping-Sheng Cao; Wei Wu; Zi-Yang Cao; Zhong-Wei Lv; Bo-Wen Shi; Chun-Yan Wu; Geng-Xi Jiang; Da Fu; Fei Yu
Journal:  Am J Transl Res       Date:  2021-01-15       Impact factor: 4.060

2.  Multi-Target Drugs for Kidney Diseases.

Authors:  John D Imig; Daniel Merk; Eugen Proschak
Journal:  Kidney360       Date:  2021-08-02

3.  Cardiomyocyte-specific disruption of soluble epoxide hydrolase limits inflammation to preserve cardiac function.

Authors:  Deanna K Sosnowski; K Lockhart Jamieson; Artiom Gruzdev; Yingxi Li; Robert Valencia; Ala Yousef; Zamaneh Kassiri; Darryl C Zeldin; John M Seubert
Journal:  Am J Physiol Heart Circ Physiol       Date:  2022-08-19       Impact factor: 5.125

Review 4.  Inhibitors of soluble epoxide hydrolase on acute lung injury: a meta-analysis of preclinical studies.

Authors:  Wei Tao; Gang Xu; Yi Luo; Ping-Song Li
Journal:  Inflammopharmacology       Date:  2022-09-10       Impact factor: 5.093

5.  ROS-responsive polymer nanoparticles with enhanced loading of dexamethasone effectively modulate the lung injury microenvironment.

Authors:  Wali Muhammad; Jiaqi Zhu; Zihe Zhai; Jieqi Xie; Jiahang Zhou; Xudong Feng; Bing Feng; Qiaoling Pan; Shifen Li; Rajiu Venkatesan; Pan Li; Hongcui Cao; Changyou Gao
Journal:  Acta Biomater       Date:  2022-06-18       Impact factor: 10.633

6.  Dietary Fatty Acid Regulation of the NLRP3 Inflammasome via the TLR4/NF-κB Signaling Pathway Affects Chondrocyte Pyroptosis.

Authors:  Xin Jin; Xin Dong; Yingxu Sun; Ziyu Liu; Li Liu; Hailun Gu
Journal:  Oxid Med Cell Longev       Date:  2022-05-04       Impact factor: 7.310

7.  Inhibition of soluble epoxide hydrolase alleviates insulin resistance and hypertension via downregulation of SGLT2 in the mouse kidney.

Authors:  Jinlan Luo; Shuiqing Hu; Menglu Fu; Liman Luo; Yuanyuan Li; Wenhua Li; Yueting Cai; Ruolan Dong; Yan Yang; Ling Tu; Xizhen Xu
Journal:  J Biol Chem       Date:  2021-04-14       Impact factor: 5.157

8.  NLRP3 inflammasome inhibitor MCC950 attenuates primary dysmenorrhea in mice via the NF-κB/COX-2/PG pathway.

Authors:  Biao Tang; Dan Liu; Lingyu Chen; Yu Liu
Journal:  J Inflamm (Lond)       Date:  2020-06-24       Impact factor: 4.981

9.  Epigallocatechin-3-Gallate (EGCG), an Active Compound of Green Tea Attenuates Acute Lung Injury Regulating Macrophage Polarization and Krüpple-Like-Factor 4 (KLF4) Expression.

Authors:  Saleh A Almatroodi; Ahmad Almatroudi; Mohammed A Alsahli; Mohammad A Aljasir; Mansoor Ali Syed; Arshad Husain Rahmani
Journal:  Molecules       Date:  2020-06-20       Impact factor: 4.411

10.  Multitarget molecule, PTUPB, to treat diabetic nephropathy in rats.

Authors:  Md Abdul Hye Khan; Sung Hee Hwang; Scott D Barnett; Anna Stavniichuk; Wojciech K Jankiewicz; Bruce D Hammock; John D Imig
Journal:  Br J Pharmacol       Date:  2021-08-12       Impact factor: 8.739

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.