Literature DB >> 32256960

Chidamide Inhibits Glioma Cells by Increasing Oxidative Stress via the miRNA-338-5p Regulation of Hedgehog Signaling.

Haixia Zhou1, Liang Han2, Han Wang3, Jun Wei4, Zhigang Guo5, Zhaohui Li5.   

Abstract

OBJECTIVE: Chidamide has a broad spectrum of antitumor activity but its function on glioma remains unknown. The increase of reactive oxygen species (ROS) and reactive nitrogen species (RNS) may control glioma risk by promoting its apoptosis and necrosis. Hedgehog pathway is crucial to glioma cell proliferation and controls ROS production. We aimed to explore the effects of chidamide on the levels of miR-338-5p (glioma cell inhibitor), which may regulate Hedgehog signaling, resulting in the changes of RNS. Materials and Methods. Migration and invasion activities of glioma cells were measured by using the Transwell chamber assay. The expression levels of Sonic Hedgehog (Shh), Indian Hedgehog (Ihh), Desert Hedgehog (Dhh), miR-338-5p, and related molecules were detected by using real-time PCR (RT-PCR) and or Western Blot in U87 and HS683 glioma cells. The effects of chidamide on these molecules were measured by using the miR-338-5p inhibitor or mimics in U87 and HS683 glioma cell lines. ROS and RNS were measured by DCF DA and DAF-FM DA fluorescence. Biomarkers of oxidative stress were measured by using a corresponding kit. Apoptosis and necrosis rates were measured by using flow cytometry.
RESULTS: Chidamide inhibited the growth rate, migration, and invasion of human malignant glioma cells and increased the level of miR-338-5p. miR-338-5p inhibitor or mimics increased or inhibited the growth rate of U87 and HS683 glioma cells. Chidamide inhibited the levels of Shh, Ihh, migration protein E-cadherin, and invading protein MMP-2. The increase in the level of Shh and Ihh led to the reduction in the ROS and RNS levels. miR-338-5p inhibitor or mimics also showed a promoting or inhibitory function for the levels of Shh and Ihh. Furthermore, miR-338-5p mimics and inhibitor inhibited or promoted the migration and invasion of the glioma cells (P < 0.05). Evaluated levels of miR-338-5p increased oxidative stress level and apoptosis and necrosis rate by regulating the levels of biomarkers of oxidative stress (P < 0.05). Evaluated levels of miR-338-5p increased oxidative stress level and apoptosis and necrosis rate by regulating the levels of biomarkers of oxidative stress (.
CONCLUSION: Chidamide inhibits glioma cells by increasing oxidative stress via the miRNA-338-5p regulation of Hedgehog signaling. Chidamide may be a potential drug in the prevention of glioma development.
Copyright © 2020 Haixia Zhou et al.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32256960      PMCID: PMC7086450          DOI: 10.1155/2020/7126976

Source DB:  PubMed          Journal:  Oxid Med Cell Longev        ISSN: 1942-0994            Impact factor:   6.543


1. Introduction

Gliomas are glial brain tumors derived from astrocytic, oligodendroglial, and ependymal cells. Malignant glioma accounts for 14,000 deaths annually and more than 20,000 new cases are found each year [1]. The specific pathogenesis of glioma remains unclear. Exploring drugs [2] and therapeutic targets [3, 4], improving survival [5], and reducing mortality is a hotspot in glioma research [6]. Histone deacetylase (HDAC) is often found to be upregulated in human malignancy. HDAC1 [7, 8], HDAC2 [9, 10], and HDAC3 [9, 11] have been reported to play an important role in the growth of glioma cells or the tumorigenesis of glioma. Thus, the inhibitor of HDAC may be beneficial in the prevention of glioma. Chidamide is a HDAC inhibitor which can inhibit HDAC1, HDAC2, HDAC3, and HDAC10 [12, 13] and can also inhibit the growth of cancer cells such as lung cancer [14] and pancreatic cancer cells [15] and promote their apoptosis [16]. Thus, chidamide may be a potential drug for controlling glioma cell proliferation. However, its effects on glioma growth and related molecular mechanisms remain unknown. Numerous growth factors play a regulatory role in glioma formation, and Hedgehog (Hh) gene-encoded protein or Hedgehog (Hh) gene function in glioma development has received much attention [17]. The Hedgehog signaling pathway is essential for glioma-initiating cell proliferation and maybe the pathogenesis of glioma [18]. Hedgehog signaling reduces apoptosis in cancer cells by controlling oxidative stress [19], and oxidative stress may control glioma development via the upregulation of apoptosis. There are at least three Hh genes in vertebrates, namely, Sonic Hedgehog (Shh), Indian Hedgehog (Ihh), and Desert Hedgehog (Dhh) [20]. The N-terminal structure of the Ihh protein is 93%, identical to Shh, and both have similar activities and receptor and signal transduction pathways. Whether chidamide affects Hedgehog signalling is not well understood. MicroRNAs (miR) are potential molecules for affecting cancer cell behavior [21]. MicroRNA-34a can promote apoptosis in glioma cells by enhancing the levels of reactive oxygen species (ROS) production and NOX2 expression [22]. The coding gene for the miR-338-5p subtype of miR-338 is located in the 8th intron of the gene encoding the apoptosis-associated tyrosine kinase. miR-338-5p may be a potential inhibitor in the prevention of glioma risk [23]. ROS and reactive nitrogen species (RNS) are associated with the changes of the redox system in a glioma angiogenic microenvironment [24]. Chidamide may affect miR-338-5p, which regulates Hedgehog signaling, resulting in the changes of ROS and RNS. ROS and RNS may promote the apoptosis of glioma and control its progression.

2. Materials and Methods

2.1. Cell Culture

U87 and HS683 cells are the most representative glioma cell lines [25, 26] and are very sensitive to chidamide; therefore, they have been chosen in the present work. U87 and HS683 glioma cell lines were purchased from Cell Bank (Shanghai, China). The cells were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C incubator, and grown to 80% confluency. The cells were digested by using 1 mL of 0.25% trypsin and 0.2% EDTA and passed to a new dish for further culture. The cell lines used in this experiment were with the best activity in culture for 4 passages.

2.2. Cell Transfection

Transfection reaction was carried out when the cells were grown to 80% confluency in a six-well plate. The miR-338-5p mimic and the miR-338-5p inhibitor were designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. (Guangzhou, China). The sequence for the negative mimic control was 5′-UCACAACCUCCUAGAAAGAGUAGA-3′, the sequence for the has-miR-338-5p mimic was 5′-AACAAUAUCCUGGUGCUGAGUG-3′, and the sequence for the miR-338-5p inhibitor was 5′-AACAAUAUCCUGGUGCUGAGUG-3′ [27]. Experiments were performed using the RNAiMAX Transfection Reagent from Thermo Fisher Scientific (MA, USA). The procedure of the cell transfection experiment was as follows: 100 nM miR-338-5p mimic, miR-338-5p inhibitor, and control were prepared using 250 μL of DMEM medium. 4 μL of RNAiMAX was added to 250 μL of DMEM medium, gently mixed, and allowed to stand at room temperature for 5 min. The mixture was sequentially added to the corresponding six wells. In each well of the plate, 1.5 mL of medium was added. After 6 hours of transfection, the solution in each well was replaced with 2 mL of medium and continued to culture for 24 h. All cells were assigned into the following groups: control group (CG, wild type without chidamide treatment), chidamide group (CHG, treated with 10 μM chidamide for 24 h), miR-338-5p mimic group (MG), miR-338-5p inhibitor group (IG), chidamide-treated miR-338-5p mimic group (CHMG), and chidamide-treated miR-338-5p inhibitor group (CHIG). After transfection, luciferase activity was measured using the Dual Luciferase Reporter Assay System (Promega Corporation, Madison, MA, USA). Firefly luciferase activity was normalized against miR-338-5p activity.

2.3. Measurement of HDAC Activity

A HDAC assay kit was purchased from BioVision, Inc. (Milpitas, CA, USA). HDAC activity was detected by an optical density method according to the kit instructions, and 6 wells were used in each group. HDAC activity was detected by hypoxia and reoxygenation, and the results were presented as the ratio of a positive control in the kit. The IC50 value was calculated according to time- and dose-response curves by using the SPSS probit model analysis (SPSS v20.0; SPSS, Inc., Chicago, IL, USA).

2.4. DNA Synthesis Assay of Tritiated Thymidine (3H-TdR) in Glioma Cells

Glioma cell lines U87 and HS683 were inoculated in 96-well plates at a density of 5 × 103. A 3H-TdR kit was purchased from China Isotope & Radiation Corporation (Beijing, China). Logarithmic cells were digested into single cells with 0.25% trypsin+0.02% EDTA-2Na. The DMEM medium containing 10% FBS was adjusted to a cell concentration of 5 × 103/mL. 100 μL of cell suspension was added to each well and cultured in a 37°C, 5% CO2, and saturated humidity incubator for 24 h until the cells were attached, and then cultured in DMEM containing 4% FBS. After 24 h, the plates were removed and chidamide was added at different concentrations (0-14 μM chidamide). Each group was given 5 replicate wells and cultured for 24 h. The plate was taken out and 100 μL of 3H-TdR was added to each well to a final concentration of 3.7 × 107 Bq/mL. The cells were continually cultured for 24 h, the liquid was discarded, and the cells were washed 3 times with PBS, and then 2 mL of precooled 10% TCA was added and treated for 10 min. 0.5 mL of 0.3 M NaOH was added to each well, treated at 60°C for 30 min, and then allowed to cool to room temperature. The lysate was collected, transferred to a scintillation vial, and 5 mL of scintillation fluid was added, and the radioactivity count (r/min) of each bottle was measured in a FJ-2107PFJ-2107P liquid scintillator (Xi'an, China). A long half-life of chidamide ranging between 16.8-18.3 h and 24 h may be a better period for evaluating its function [28]. Thus, 24 h was chosen in the subsequent experiment.

2.5. Cell Migration Ability Analysis

The malignant glioma cell lines U87 and HS683 were cultured in a 6-well Transwell plate. When the cell confluency was close to 100%, a 20 μL tip was used to scratch each well in a 6-well plate in one direction, and followed by PBS wash. Net floating cells were treated with a solvent group containing 0.1% DMSO (control group) and 10 μM chidamide for 24 h. Microscopy photographed the width of the scratched area at 0 and 24 h. Quantitative assessment was performed to measure the effect of chidamide on glioma cell migration. Relative migration distance was calculated as follows: the 0 h and 24 h invaded distances were recorded as D0 and D24. Relative migration distance rate = (D0 − D24)/D0 × 100%.

2.6. Cell Invasion Ability Analysis

Matrigel was thawed in a refrigerator at 4°C overnight. Matrigel and serum-free DMEM were placed in each cell at a ratio of 1 : 8 in 60 μL/cell. After incubation in a 37°C incubator for 3 h, culture medium was removed using a pipette, washed twice with PBS solution, and 1 mL of trypsin was used to treat the cells for 3 min at 37°C. 3 mL of serum-free DMEM medium was placed into a petri dish, and the cells were prepared as a uniform suspension using a pipette. 200 μL each of U87 and HS683 were divided into each sterile cell of a 24-cell Transwell plate. U87 and HS683 were incubated for 24 h in the incubator. A culture solution was poured, and the small chambers were wiped with a cotton swab. After washing the cells with a PBS solution for 2 times, crystal violet staining solution was added to each chamber. After 15 min staining, the solution was poured and washed with PBS solution for 2 times. Five fields were chosen to take photos, and the average distances of cells in each field of view to pass through the matrix were calculated.

2.7. Real-Time qPCR

Total RNA was extracted from the cells using the Trizol Reagent and its concentration and quality was measured using NanoDrop 2000. The total RNA was reversely transcripted into cDNA using the SuperScript III Reverse Transcriptase (Invitrogen). The primers (Shh, Ihh, Dhh, E-cadherin, MMP-2, and GAPDH) for reverse transcription and qPCR of miR-338-5p and U6 (Table 1) were synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. (Guangzhou, China). Invitrogen's Platinum SYBR Green qPCR SuperMix-UDG kit was used in this reaction. The specificity of SYBR Green qPCR was validated using melt curve analysis. qPCR was performed using the following: reagent used was 10 μL of Platinum® SYBR® Green qPCR (Invitrogen), 1 μL of forward primer, 1 μL of reverse primer, 2 μL of cDNA template, and 6 μL RNase free ddH20. U6 and GAPDH were used as controls. Real-time PCR reaction conditions were set as follows: Roche LighterCycler 480 denaturation was set to 95°C for 30 seconds and cycle amplification conditions were set to 95°C for 5 seconds and 60°C for 30 seconds for a total of 40 cycles. The 2− method was used to calculate the relative expression level of miR-338-5p, Shh, Ihh, Dhh, E-cadherin, and MMP-2 in glioma cells.
Table 1

The primers used in the present study.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
miR-338-5pGGGAACAATATCCTGGTGCGTGCAGGGTCCGAGGT
ShhAGCTGGAGAAGTTTAGGGTGCAAGCCAGGGCAGAGGTAG
IhhCCGCAATAAGTATGGACTGCTTGGCTGCGGCCGAGTGCT
DhhAGGAGCGGGTGAACGCTTTGGCGCCAGCAACCCATACTTG
E-cadherinCCTCGACACCCGATTCAAAGCCACTGTATTCAGCGTGAC
MMP-2TGCACTGATACCGGCCGCAGAACTTGCAGGGCTGTCCTTC
GAPDHGTCTCCTCTGACTTCAAACCACCCTGTTGCTGTA

Note: Shh—Sonic Hedgehog; Ihh—Indian Hedgehog; Dhh—Desert Hedgehog; MMP-2—matrix metalloproteinase-2.

2.8. Western Blot

Acetyl-histone H3 (Lys14) (D4B9) Rabbit mAb, anti-HDAC1 (cat. no. 5356), anti-HDAC2 (cat. no. 2540), and anti-HDAC3 (cat. no. 3949) antibodies were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). Anti-Sonic Hedgehog antibody (ab53281), anti-India Hedgehog antibody (ab52919), anti-Desert Hedgehog antibody (ab97287), anti-E-Cadherin antibody (ab15148), anti-MPP-2 antibody (ab97292), anti-GAPDH antibody (ab37168), and HRP Goat Anti-Rabbit (IgG) secondary antibody (ab205718) were purchased from Abcam (Chicago, IL, USA). Malignant glioma lines U87 and HS683 were adhered to a 6-well plate and treated with 10 μM of chidamide for 24 h. The medium in each well was discarded and washed with ice-cold PBS. The cells were mixed with 100 μL of RIPA lysate with 100 mM PMSF and 5 mM DTT for a total of 200 μL per well. The lysate in each tube was vortexed on a vortex shaker for 5 min. The protein in the EP tube was centrifuged at 12,000 × g for 15 min at 4°C. Proteins were separated by using SDS-PAGE and then transferred to a PVDF membrane. The PVDF membrane was blocked using 5% skim milk and washed 3 times with TBST solution for 5 min/time. The membrane was placed in the matched primary antibody at 1 : 2000 to 1 : 5000 dilution and incubated in a horizontal shaker at 4°C. The secondary antibody at 1 : 5000 dilution was incubated with the abovementioned washed membrane at room temperature for 1 h. ECL chemiluminescence reagents A and B were mixed at a ratio of 1 : 1 and were carefully dripped onto the PVDF membrane. The recorded gel image was taken up by an ECL chemiluminometer. Western Blots were quantified using GAPDH as internal standard control, and relative expression levels were calculated via the comparison with the quantitative value.

2.9. Biomarkers of Oxidative Stress

The levels of reduced glutathione (GSH), superoxide dismutase (SOD), catalase (CAT), and malondialdehyde (MDA) were measured by using a Glutathione Assay Kit (ab156681), a SOD Assay Kit (ab65354), a Catalase Assay Kit (ab118184), and a Malondialdehyde Assay Kit (ab238537). All assays were performed on a Beckman Coulter UniCel DxC 800 automatic biochemistry analyzer (Brea, CA, USA).

2.10. Oxidative Stress Measurement

The oxidative stress was evaluated by ROS and RNS, which was measured by DCF DA and or DAF-FM DA fluorescence. In brief, glioma cells (1 × 106) were incubated with DCF DA with DAF-FM DA and incubated for 15 min at 37°C avoiding light. The cells were washed twice with fresh medium and finally resuspended in PBS buffer (20 mM, pH 7.0). The fluorescence was measured using a Synergy H1 Hybrid Multimode Microplate Reader (BioTek Instruments, Vermont, USA).

2.11. Flow Cytometry Detection of Cell Apoptosis, Necrosis, and Cycle

Glioma cells were reprecipitated (4°C) in 10 mM PBS and adjusted to 1 × 105/mL, then 100 μL of Annexin V-FITC was added and placed into a flow test tube. Five μL of Annexin V-FITC and 15 μL of propidium iodide were added and mixed by avoiding light. The samples were measured by using flow cytometry (Beckman Coulter FC500 Flow Cytometer, IL, USA). The apoptosis and necrosis rates were calculated by using flow FlowJo 7.5 (TreeStar Inc., Ashland, USA). For the assay of cell cycle, the cells were washed with icy PBS after the treatment with different concentrations of chidamide for 48 h. Icy 75% ethanol was used to fix cells. Subsequently, the cells were treated with PI/RNase solution for a quarter after being washed with PBS and detected by using flow cytometry instrument.

2.12. Statistical Analysis

Experimental data results were analyzed using GraphPad Prism 5 software. The results of all analyses were expressed as mean ± SD, and a one-tailed, paired sample t-test or one-way ANOVA with post hoc Tukey's test was used to compare variables between two groups. P < 0.05 was considered statistically significant.

3. Results

3.1. Chidamide Inhibited Cell Growth of U87 and HS683 Cells

A long half-life of chidamide ranging between 16.8-18.3 h and 24 h may be a better period for evaluating its function. [28] Thus, the 24 h culture was chosen in the experiment. U87 and HS683 cells were treated with different concentrations of chidamide (0-14 μM) for 24 h, and the proliferation inhibition of chidamide on U87 and HS683 cell lines was detected by a 3H-TdR assay. The results showed that chidamide inhibited the relative cell activity of U87 (Figure 1(a)) and HS683 (Figure 1(b)) cells in a time-dependent and dose-dependent way when the concentration was more than 8 μM for a 24-hour culture in all glioma cells (P < 0.05). The IC50 values at 24 h were different from each other in U87 and HS683 cells; the IC50 value in U87 cells was 11.09 ± 1.58 μM, whereas the IC50 value for HS683 cells was 12.16 ± 2.51 μM. 10 μM of chidamide was chosen so that inhibition caused by high-concentration toxicity may be avoided.
Figure 1

3H-TdR incorporation analysis of the growth rate of U87 and HS683 glioma cells. (a) The effects of chidamide on the growth rate of U87 glioma cells. (b) The effects of chidamide on the growth rate of HS683 glioma cells. (c) The growth rate of U87 glioma cells among different groups. (d) The growth rate of HS683 glioma cells among different groups. CG: control group; CHG: chidamide group; MG: miR-338-5p mimic group; IG: miR-338-5p inhibitor group; CHMG: chidamide-treated miR-338-5p mimic group; CHIG: chidamide-treated miR-338-5p inhibitor group. N = 5 for each group and ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001 vs. the CG group.

3.2. Chidamide Inhibited the Growth Rate of U87 and HS683 Glioma Cells via miR-338-5p

Chidamide and the miR-338-5p inhibitor inhibited the growth rate of U87 (Figure 1(c)) and HS683 cells (Figure 1(d)). However, chidamide could not inhibit the growth rates of two kinds of cells when the miR-338-5p inhibitor was used and the statistical difference for the growth was insignificant between the IG and CHIG groups (P > 0.05). The miR-338-5p mimic promoted the growth of U87 (Figure 1(c)) and HS683 cells (Figure 1(d)). Further chidamide treatment still could inhibit the growth of two kinds of cells, and the statistical difference for the growth was significant between the MG and CHMG groups (P < 0.05). The results suggested that chidamide inhibited the growth rate of U87 and HS683 glioma cells via miR-338-5p.

3.3. Chidamide Inhibited HDAC Activity of U87 and HS683 Cells

The HDAC activities of U87 (Figure 2(a)) and HS683 (Figure 2(b)) cells were reduced with the increase in the concentration of chidamide (P < 0.05). Chidamide inhibited the HDAC activities of U87 and HS683 cells in a time-dependent and dose-dependent way. Western Blot analysis showed that chidamide inhibited the expression of HDAC1, HDAC2, and HDAC3 in a dose-dependent manner in U87 and HS683 cells. Additionally, the acetylation of H3 histones was significantly increased following exposure to chidamide U87 and HS683 cells. These results demonstrated that chidamide decreased the expression of HDACs and increased the acetylation levels of histone.
Figure 2

The effects of chidamide on the activity of HDAC in U87 and HS683 glioma cells. (a) Relative activity of HDAC in U87 glioma cells. (b) Relative activity of HDAC in HS683 glioma cells.

3.4. Chidamide Blocked Glioma Cells at G0/G1 Phase due to Cell Necrosis and Apoptosis

Figures 3(a)–3(b) showed that the number of chidamide-blocked U87 glioma cells was increased at the G0/G1 phase with the increase in the concentration of chidamide. In similar cases, Figures 3(e)–3(f) showed that the number of chidamide-blocked HS683 glioma cells was increased at the G0/G1 phase with the increase in the concentration of chidamide. The number of blocked HS683 glioma cells after being treated with 4 and 8 μM chidamide was significantly higher than those being treated with 0 μM chidamide (Figure 3(g), P < 0.05). The number of blocked U87 glioma cells after being treated with 8 μM chidamide was significantly higher than those being treated with 0 and 4 μM chidamide (Figure 3(h), P < 0.05). The number of blocked HS683 glioma cells after being treated with 8 μM chidamide was significantly higher than those being treated with 0 and 4 μM chidamide (Figure 3(i), P < 0.05). Figures 3(j)–3(l) showed that the proportion of U87 glioma cells with apoptosis and necrosis was increased with the increase in the concentration of chidamide. In similar cases, Figures 3(m)–3(o) showed that the proportion of HS683 glioma cells with apoptosis and necrosis was increased with the increase in the concentration of chidamide. The proportion of U87 glioma cells with apoptosis and necrosis after being treated with 8 μM chidamide was significantly higher than those being treated with 0 and 4 μM chidamide (Figure 3(p), P < 0.05). The total apoptosis and necrosis rates of HS683 glioma cells after being treated with 8 μM chidamide were significantly higher than those being treated with 0 and 4 μM chidamide (Figure 3(q), P < 0.05). The results suggest that chidamide blocks glioma cells at the G0/G1 phase probably through cell necrosis and apoptosis.
Figure 3

Flow cytometry analysis of the cell cycle, necrosis, and apoptosis. (a) The proportions of the U87 cells blocked at the G0/G1 phase after being treated with 0 μM chidamide. (b) The proportions of the U87 cells blocked at the G0/G1 phase after being treated with 4 μM chidamide. (c) The proportions of the U87 cells blocked at the G0/G1 phase after being treated with 8 μM chidamide. (d) The proportions of the HS683 cells blocked at the G0/G1 phase after being treated with 0 μM chidamide. (e) The proportions of the HS683 cells blocked at the G0/G1 phase after being treated with 4 μM chidamide. (f) The proportions of the HS683 cells blocked at the G0/G1 phase after being treated with 8 μM chidamide. (g) Phase fraction in HS683 cells after being treated with different concentrations of chidamide. (h) G1 phase fraction in U87 cells after being treated with different concentrations of chidamide. (i) G1 phase fraction in HS683 cells after being treated with different concentrations of chidamide. (j) The proportions of the U87 cells with apoptosis and necrosis after being treated with 0 μM chidamide. (k) The proportions of the U87 cells with apoptosis and necrosis after being treated with 4 μM chidamide. (l) The proportions of the U87 cells with apoptosis and necrosis after being treated with 8 μM chidamide. (m) The proportions of the HS683 cells with apoptosis and necrosis after being treated with 0 μM chidamide. (n) The proportions of the HS683 cells with apoptosis and necrosis after being treated with 4 μM chidamide. (o) The proportions of the HS683 cells with apoptosis and necrosis after being treated with 8 μM chidamide. (p) The total apoptosis and necrosis rates in U87 cells after being treated with different concentrations of chidamide. (q) The total apoptosis and necrosis rates in HS683 cells after being treated with different concentrations of chidamide. All data are expressed as mean ± SD (N = 6) and ∗P < 0.05 and ∗∗P < 0.01 vs. the 0 μM chidamide group.

3.5. Chidamide Increased Relative Level of miR-338-5p

U87 and HS683 cells were treated with different concentrations of chidamide (0-14 μM) for 24 h, and the related levels of miR-338-5p in U87 and HS683 cell lines were detected by real-time qPCR. The results showed that chidamide increased the relative level of miR-338-5p in U87 (Figure 4(a)) and HS683 (Figure 4(b)) cells in a time-dependent and dose-dependent way (P < 0.05).
Figure 4

Relative mRNA levels of miR-338-5p. (a) The effects of chidamide on the level of miR-338-5p in U87 cells. (b) The effects of chidamide on the level of miR-338-5p in HS683 cells. (c) Relative mRNA levels of miR-338-5p in U87 glioma cells. (d) Relative mRNA levels of miR-338-5p in HS683 glioma cells. CG: control group; CHG: chidamide group; MG: miR-338-5p mimic group; IG: miR-338-5p inhibitor group; CHMG: chidamide-treated miR-338-5p mimic group; CHIG: chidamide-treated miR-338-5p inhibitor group. N = 5 for each group and ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001 vs. the CG group.

miR-338-5p plays an important role in promoting solid tumors. Therefore, we investigated whether chidamide inhibited glioma cells via miR-338-5p. We detected the level of miR-338-5p in human malignant glioma cell lines U87 and HS683 by real-time PCR. The results showed that the relative level of miR-338-5p increased in the mimic group and the chidamide-treated group in U87 (Figure 4(c)) and HS683 (Figure 4(d)) cells and decreased in the inhibitor group (P < 0.05). Further chidamide treatment still reduced the growth rate of the cells after the miR-338-5p mimic was used, and the statistical difference for miR-338-5p was significant between the MG and CHMG groups (P < 0.05). Chidamide may inhibit glioma cells via miR-338-5p.

3.6. Chidamide Inhibited the Activity of Glioma Cells via miR-338-5p

To investigate the effect of chidamide on the migration of human malignant glioma cell lines U87 and HS683, the cells were treated with 10 μM of chidamide for 24 h. The scratch test showed the migration of the two cells before and after treatment. Chidamide inhibited the invasion of glioma cells U87 (Figure 5(a)) and HS683 (Figure 5(b)) (P < 0.05). Furthermore, the miR-338-5p mimic inhibited the invasion ability, whereas the inhibitor promoted the invasion ability (P < 0.05). Further chidamide treatment still reduced the invaded cells after the miR-338-5p mimic was used, and the statistical difference for the invaded cells was significant between the MG and CHMG groups (P < 0.05). The results suggested that chidamide inhibited the migration ability of malignant glioma cells via miR-338-5p.
Figure 5

The effects of miR-338-5p on the function of chidamide (10 μM) for controlling cell invasion per field. CG: control group; CHG: chidamide group; MG: miR-338-5p mimic group; IG: miR-338-5p inhibitor group; CHMG: chidamide-treated miR-338-5p mimic group; CHIG: chidamide-treated miR-338-5p inhibitor group. (a) The invasion of U78 glioma cells. (b) The invasion of HS683 cells. Values are mean ± SD (N = 5) and ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001 vs. the CG group.

To investigate the effect of chidamide on the relative migration distance of human malignant glioma cell lines U87 and HS683, the cells were treated with 10 μM of chidamide for 24 h. Chidamide inhibited the relative migration distance of human malignant glioma cells U87 (Figure 6(a)) and HS683 (Figure 6(b)) (P < 0.05). Furthermore, the miR-338-5p mimic inhibited the relative migration distance of glioma cells, whereas the inhibitor of miR-338-5p increased the relative migration distance of glioma cells. Further chidamide treatment still reduced the invading ability of the cells after the miR-338-5p mimic was used, and the statistical difference for the migration ability was significant between the MG and CHMG groups (P < 0.05). The results suggested that chidamide inhibited the invading ability of malignant glioma cells via miR-338-5p.
Figure 6

The effects of miR-338-5p on the function of chidamide (10 μM) for controlling cell immigration. CG: control group; CHG: chidamide group; MG: miR-338-5p mimic group; IG: miR-338-5p inhibitor group; CHMG: chidamide-treated miR-338-5p mimic group; CHIG: chidamide-treated miR-338-5p inhibitor group. (a) The migration of U87 glioma cells. (b) The migration of HS683 glioma cells. Values are mean ± SD (N = 5) and ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001 vs. the CG group.

3.7. Chidamide Reduced Relative mRNA Levels of Hedgehog Signaling, Migration, and Invading Proteins via miR-338-5p

Real-time qPCR analysis showed that chidamide treatment reduced relative mRNA levels of Shh, Ihh, migration marker E-cadherin, and invading marker MMP-2 in U87 (Figure 7(a), P < 0.05). Comparatively, chidamide treatment reduced relative mRNA levels of Shh, Ihh, Dhh, E-cadherin, and MMP-2 in HS683 glioma cells (Figure 7(b), P < 0.05). In similar cases, miR-338-5p mimics and inhibitor reduced or increased the relative mRNA levels of these molecules. However, chidamide could not inhibit these molecules anymore when the miR-338-5p inhibitor was used and the statistical difference for these molecules was insignificant between the IG and CHIG groups (P < 0.05). Further chidamide treatment still reduced the levels of these molecules after miR-338-5p mimic was used, and the statistical difference for the levels of these molecules was significant between the MG and CHMG groups (P < 0.05). The result suggested that chidamide reduced the relative mRNA levels of Hedgehog signaling, migration, and invading proteins via miR-338-5p.
Figure 7

Real-time qPCR analysis of the effects of chidamide (10 μM) on relative mRNA Hedgehog signaling and migration proteins. (a) U87 glioma cells. (b) HS683 glioma cells. CG: control group; CHG: chidamide group; MG: miR-338-5p mimic group; IG: miR-338-5p inhibitor group; CHMG: chidamide-treated miR-338-5p mimic group; CHIG: chidamide-treated miR-338-5p inhibitor group; Shh: Sonic Hedgehog; Ihh: Indian Hedgehog; Dhh: Desert Hedgehog; MMP-2: matrix metalloproteinase-2. N = 5 for each group and ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001 vs. the CG group.

3.8. Chidamide Reduced Relative Protein Levels of Hedgehog Signaling, Migration, and Invading Proteins via miR-338-5p

Western Blot analysis showed that chidamide treatment reduced the relative protein levels of Shh, Ihh, migration marker E-cadherin, and invading marker MMP-2 in U87 (Figure 8(a), P < 0.05). Comparatively, chidamide treatment reduced relative protein levels of Shh, Ihh, Dhh, E-cadherin, and MMP-2 in HS683 (Figure 8(b), P < 0.05). In similar cases, miR-338-5p mimics and inhibitor reduced or increased the relative protein levels of these molecules. Further chidamide treatment still reduced the levels of these molecules after miR-338-5p mimic was used, and the statistical difference for the levels of these molecules was significant between the MG and CHMG groups (P < 0.05). The result suggested that chidamide reduced the relative protein levels of Hedgehog signaling, migration, and invading proteins via miR-338-5p.
Figure 8

Western Blot analysis of the effects of chidamide (10 μM) on the relative protein level of the Hedgehog signaling and migration protein. (a) U87 glioma cells. (b) HS683 glioma cells. CG: control group; CHG: chidamide group; MG: miR-338-5p mimic group; IG: miR-338-5p inhibitor group; CHMG: chidamide-treated miR-338-5p mimic group; CHIG: chidamide-treated miR-338-5p inhibitor group; Shh: Sonic Hedgehog; Ihh: Indian Hedgehog; Dhh: Desert Hedgehog; MMP-2: matrix metalloproteinase-2. N = 5 for each group and ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001 vs. the CG group.

3.9. miR-338-5p Increased Oxidative Stress of Glioma Cells

The serum levels of MDA were significantly increased, while the levels of GSH, CAT, and SOD were significantly reduced in the CHMG and MG groups and the reverse results were found in the IG group in both cells (Table 2, P < 0.05). Thus, miR-338-5p mimics or inhibitor increased or reduced the biomarker levels of oxidative stress in both glioma cells.
Table 2

The levels of oxidative stress biomarkers.

ParametersCGCHGMGCHMGIGCHIG
U87
GSH (mg/L)11.9 ± 1.510.1 ± 1.78.5±0.9∗∗7.8±0.9∗∗15.6±2.0∗∗∗14.3±2.2∗∗
CAT (mg/L)16.4 ± 3.114.8 ± 5.47.2±2.7∗∗∗6.8±1.4∗∗∗17.5 ± 3.216.1 ± 3.4
MDA (mmol/L)4.9 ± 1.37.8±2.2∗∗8.4±2.4∗∗8.5±1.3∗∗3.7±1.2∗∗3.9 ± 2.0
SOD (U/L)371.4 ± 62.3221.5±60.7∗∗202.3±80.5∗∗∗200.8±34.3∗∗∗491.2±69.6∗∗470.5±60.1∗∗
HS683
GSH (mg/L)14.1 ± 2.311.5±1.9∗∗7.5±1.4∗∗∗7.9±1.2∗∗∗16.3 ± 2.016.0 ± 2.5
CAT (mg/L)15.8 ± 3.412.0 ± 3.87.9±3.7∗∗∗6.8±1.0∗∗∗18.8 ± 3.618.0 ± 3.1
MDA (mmol/L)4.2 ± 1.48.6±2.5∗∗11.7±2.1∗∗∗10.6±2.3∗∗∗3.5±1.1∗∗3.2±1.3∗∗
SOD (U/L)345.5 ± 59.1303.7 ± 63.4281.3±49.6∗∗257.9±36.8∗∗396.1 ± 69.3390.2 ± 60.7

Note: CG—control group; CHG—chidamide group; MG—miR-338-5p mimic group; IG—miR-338-5p inhibitor group; CHMG—chidamide-treated miR-338-5p mimic group; CHIG—chidamide-treated miR-338-5p inhibitor group. N = 5 for each group and ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001 vs. the CG group.

miR-338-5p mimics or inhibitor increased or reduced the oxidative stress of glioma cells in U87 by increasing or reducing the levels of ROS and RNS (Figures 9(a) and 9(b), P < 0.05). Comparatively, miR-338-5p mimics or inhibitor also increased or reduced the oxidative stress of glioma cells in HS683 by increasing or reducing the levels of ROS and RNS (Figures 9(c) and 9(d), P < 0.05). Further chidamide treatment increased the levels of oxidative stress by increasing the level of miR-338-5p. The result suggested that chidamide prevents glioma by increasing the level of miR-338-5p, which inactivates Hedgehog signaling, resulting in the increase of oxidative stress and inhibition of glioma growth.
Figure 9

The oxidative levels among different groups. Glioma cells were labeled with (a) DCF DA and/or DAF-FM DA, and intracellular fluorescence was measured using a plate reader to estimate ROS and RNS. (a) ROS levels in U87 glioma cells. (b) RNS levels in U87 glioma cells. (c) ROS levels in HS683 glioma cells. (d) RNS levels in HS683 cells. CG: control group; CHG: chidamide group; MG: miR-338-5p mimic group; IG: miR-338-5p inhibitor group; CHMG: chidamide-treated miR-338-5p mimic group; CHIG: chidamide-treated miR-338-5p inhibitor group. N = 5 for each group and ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001 vs. the CG group.

3.10. Oxidative Stress Increased Apoptosis and Necrosis of Glioma Cells

Flow cytometry analysis showed that the apoptosis and necrosis rates were highest in the CHMG group (Figure 10(a)) with highest level of oxidative stress (Figures 9(a) and 9(b)) and lowest in the IG group (Figure 10(a)) with the lowest oxidative stress in U87 cells (Figures 9(a) and 9(b)). In similar cases, the apoptosis and necrosis rates were highest in the CHMG group (Figure 10(b)) with highest level of oxidative stress (Figures 9(c) and 9(d)) and lowest in IG group (Figure 10(b)) with the lowest oxidative stress in HS683 cells (Figures 9(c) and 9(d)).
Figure 10

Flow cytometry detection of apoptosis rate. (a) Apoptosis rate in U87 glioma cells. (b) Apoptosis rate in HS683 glioma cells. N = 5 for each group and ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001 vs. the CG group.

4. Discussion

As an epigenetic modification regulator, chidamide regulates gene expression mainly by increasing the acetylation of histone lysine residues. An MTT assay showed that chidamide inhibited the proliferation of U87 and HS683 cells in a time-dependent manner and dose-dependent way (Figure 1). The present results suggest that chidamide blocks glioma cells at the G0/G1 phase probably through cell necrosis and apoptosis. The results were consistent with previous reports that the HDAC inhibitor induced cellular necrosis [29] and chidamide promoted cellular apoptosis [30]. On the other hand, HDAC inhibitors have been reported to increase the expression of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) receptors and result in apoptosis [31, 32]. miRNAs play an important role in gliomagenesis as dominant predictors of outcome and determinants for the resistance to radio- and chemotherapy [33]. miR-338-5p is one of the members of the miR-338 family whose brain-specific microRNA precursors are found in humans [34]. Evaluated levels of miR-338-5p have been reported to prevent cell proliferation, migration, and invasion and promote cell apoptosis in glioblastoma cells [23]. Thus, the effects of miR-338-5p on glioma cells were explored in the present work. Chidamide treatment often increased the relative level of miR-338-5p (Figures 4(a) and 4(b)). Thus, chidamide may inhibit glioma cells via miR-338-5p since chidamide could not show the inhibitory function when miR-338-5p was inhibited. Chidamide has a direct inhibitory effect on tumor cells. The Hedgehog signaling pathway is highly activated not only in solid tumors such as gastrointestinal tumors [35, 36], lung cancer [37, 38], and breast cancer [39, 40] but also in leukemia [41, 42], lymphoma [43, 44], myeloma [45, 46], and brain tumor [47, 48]. According to a previous report, the inhibition of Hedgehog signaling also inhibited the growth of glioma cells [17]. The development of tumors involves the involvement of the Hedgehog pathway, and the formation of resistance to chemotherapeutic drugs is also involved in the Hedgehog pathway [49, 50]. Studies on the Hedgehog pathway and hematological malignancies have found that when the pathway is overexpressed, cells can show strong resistance to drug therapy [51, 52], so the inhibition of Hedgehog signaling can be improved to increase drug sensitivity and antitumor effects. In this study, qPCR and Western Blot were used to determine the related molecules in the Hedgehog pathway and glioma cell migration and invasion. Chidamide inhibited the levels of Shh and Ihh and N-Cadherin and MMP-2 in U87 and HS683 glioma cells. Hedgehog signaling pathways play an important role in the growth of glioma cells [17]. We mainly studied the effects of chidamide on the proliferation and growth of glioma cells. The strong migration and invasion of tumor cells are the main processes associated with glioma [53, 54]. We investigated the effects of chidamide on the migration and invasion of malignant glioma cells by a scratch test and cell invasion assay. Chidamide had an inhibitory effect on the migration and invasion of glioma cells. Subsequently, we used real-time qPCR and Western Blot to examine the effect of chidamide on the expression of related proteins during the migration and invasion of malignant glioma cells. It was found that chidamide can significantly reduce E-cadherin and MMP-2. A study found that the cell adhesion factor E-cadherin and the invading protein MMP-2 could be reduced by chidamide in two kinds of glioma cells (Figures 7–8). The inhibition of the cell adhesion factor E-cadherin [55, 56] and the invading protein MMP-2 is a potential way to control tumor cell migration and invasion [57, 58]. It has been found that the abnormal activation of the Hedgehog signaling pathway is involved in the occurrence, invasion, and metastasis of malignant tumors. The significance of the Hedgehog signaling pathway was proved in the invasion and metastasis of malignant tumors by affecting cadherin [59]. miR-338-5p has been reported to be a potential biomarker of cancers [60]. Hedgehog signaling is a well-known pathway for the pathogenesis of cancers [61]. NCBI Blast showed that SHH signaling genes had the two target sequences (P1, 5′-AAGGCCCCCAGCTCTACCCTG-3′ and P2, 5′-ATACCCGAGGTCCCAGAGCCAGA-3′) of miR-338-5p. Thus, we considered the relationship between miR-338-5p and Hedgehog signaling. The present work showed that miR-338-5p promoted Hedgehog signaling, and its function was contrary with miR-338-3p, which downregulated Hedgehog signaling [62]. miR-338-5p upregulated E-cadherin expression in glioma [63]. MiR-338-5p has been found to promote glioma cell invasion by affecting MMP-2 [64]. The results suggested that chidamide controlled Hedgehog signaling and inhibited glioma cell migration and invasion via miR-338-5p. The increase of reactive oxygen species (ROS) and reactive nitrogen species (RNS) may control glioma risk by promoting its apoptosis. The Hedgehog pathway is crucial to glioma cell proliferation and controls reactive species production. The present findings demonstrated that chidamide treatment increased the levels of miR-338-5p (glioma cell inhibitor), which inhibited the activity of Hedgehog signaling, while Hedgehog signaling can inhibit oxidative stress by reducing the levels of ROS and RNS and preventing the apoptosis induced by oxidative stress. Thus, chidamide prevents glioma risk by increasing oxidative stress via miR-338-5p regulation of Hedgehog signaling. There was some limitation in the present work. The present work was limited by the absence of in vivo testing. Moreover, primary human glioblastoma can be obtained from patient tumors and this could have approximated an actual situation but was not performed in the present paper. The glioma-associated oncogene homolog 1 (GLI1) of a zinc finger transcription factor regulates the Hedgehog signaling and was not analyzed in the present work. Further work is highly needed to be performed to address these important issues in the future.

5. Conclusions

Chidamide has a significant inhibitory effect on the proliferation of U87 and HS683 glioma cells via miR-338-5p. Proliferation inhibition has a time-dose dual dependence. Chidamide is involved in cell proliferation inhibition in U87 and HS683 glioma cells and is involved in the Hedgehog signaling pathway. Chidamide can inhibit the tumorigenic ability of malignant glioma cells in vitro and has long-term inhibitory effects on proliferation and growth. Chidamide inhibits the migration and invasion of glioma cells by inhibiting the expression of the stromal cell marker E-cadherin and the matrix metalloproteinase MMP-2, which is closely related to invasion. More importantly, chidamide treatment increased the levels of miR-338-5p, which reduced the activity of Hedgehog signaling, while Hedgehog signaling inhibited oxidative stress by reducing the levels of ROS and RNS and preventing the apoptosis induced by oxidative stress. Thus, chidamide prevents glioma risk by increasing oxidative stress via miR-338-5p regulation of Hedgehog signaling. Further work is highly demanded to confirm the relationship between the Hedgehog pathway and oxidative stress.
  62 in total

1.  M2 macrophage-derived IL6 mediates resistance of breast cancer cells to hedgehog inhibition.

Authors:  Xiaojun Xu; Jiabao Ye; Cheng Huang; Yunwen Yan; Jun Li
Journal:  Toxicol Appl Pharmacol       Date:  2018-12-19       Impact factor: 4.219

2.  NFAT2-HDAC1 signaling contributes to the malignant phenotype of glioblastoma.

Authors:  Yifu Song; Yang Jiang; Dongxia Tao; Zixun Wang; Run Wang; Minghao Wang; Sheng Han
Journal:  Neuro Oncol       Date:  2020-01-11       Impact factor: 12.300

3.  Vismodegib Exerts Targeted Efficacy Against Recurrent Sonic Hedgehog-Subgroup Medulloblastoma: Results From Phase II Pediatric Brain Tumor Consortium Studies PBTC-025B and PBTC-032.

Authors:  Giles W Robinson; Brent A Orr; Gang Wu; Sridharan Gururangan; Tong Lin; Ibrahim Qaddoumi; Roger J Packer; Stewart Goldman; Michael D Prados; Annick Desjardins; Murali Chintagumpala; Naoko Takebe; Sue C Kaste; Michael Rusch; Sariah J Allen; Arzu Onar-Thomas; Clinton F Stewart; Maryam Fouladi; James M Boyett; Richard J Gilbertson; Tom Curran; David W Ellison; Amar Gajjar
Journal:  J Clin Oncol       Date:  2015-07-13       Impact factor: 44.544

4.  The histone deacetylase inhibitor LBH589 is a potent antimyeloma agent that overcomes drug resistance.

Authors:  Patricia Maiso; Xonia Carvajal-Vergara; Enrique M Ocio; Ricardo López-Pérez; Gema Mateo; Norma Gutiérrez; Peter Atadja; Atanasio Pandiella; Jesús F San Miguel
Journal:  Cancer Res       Date:  2006-06-01       Impact factor: 12.701

5.  An in vivo comparative study of sonic, desert and Indian hedgehog reveals that hedgehog pathway activity regulates epidermal stem cell homeostasis.

Authors:  Christelle Adolphe; Monica Narang; Tammy Ellis; Carol Wicking; Pritinder Kaur; Brandon Wainwright
Journal:  Development       Date:  2004-09-15       Impact factor: 6.868

6.  Molecular, biological characterization and drug sensitivity of chidamide-resistant non-small cell lung cancer cells.

Authors:  Song'e Luo; Kai Ma; Hongxia Zhu; Shuren Wang; Mei Liu; Weina Zhang; Shufang Liang; Ningzhi Xu
Journal:  Oncol Lett       Date:  2017-09-26       Impact factor: 2.967

7.  MiR-338-3p inhibits epithelial-mesenchymal transition in gastric cancer cells by targeting ZEB2 and MACC1/Met/Akt signaling.

Authors:  Na Huang; Zhenzhen Wu; Li Lin; Minyu Zhou; Lin Wang; Huanrong Ma; Jianling Xia; Jianping Bin; Yulin Liao; Wangjun Liao
Journal:  Oncotarget       Date:  2015-06-20

Review 8.  MicroRNA expression signatures determine prognosis and survival in glioblastoma multiforme--a systematic overview.

Authors:  Michael Henriksen; Kasper Bendix Johnsen; Hjalte Holm Andersen; Linda Pilgaard; Meg Duroux
Journal:  Mol Neurobiol       Date:  2014-03-12       Impact factor: 5.590

9.  Anti-apoptotic effects of Sonic hedgehog signalling through oxidative stress reduction in astrocytes co-cultured with excretory-secretory products of larval Angiostrongylus cantonensis.

Authors:  Kuang-Yao Chen; Cheng-Hsun Chiu; Lian-Chen Wang
Journal:  Sci Rep       Date:  2017-02-07       Impact factor: 4.379

10.  MiR-520b promotes the progression of non-small cell lung cancer through activating Hedgehog pathway.

Authors:  Xiaoming Liu; Jichun Liu; Xuekang Zhang; Yuben Tong; Xin Gan
Journal:  J Cell Mol Med       Date:  2018-11-08       Impact factor: 5.310

View more
  8 in total

1.  Cytotoxic and Antiproliferative Effects of β-Mangostin on Rat C6 Glioma Cells Depend on Oxidative Stress Induction via PI3K/AKT/mTOR Pathway Inhibition.

Authors:  Kaiqiang Li; Lingling Wu; Yili Chen; Yuanyuan Li; Qianni Wang; Min Li; Ke Hao; Wei Zhang; Shanshan Jiang; Zhen Wang
Journal:  Drug Des Devel Ther       Date:  2020-12-01       Impact factor: 4.162

2.  Non-coding RNAs and related molecules associated with form-deprivation myopia in mice.

Authors:  Shanshan Liu; Huijie Chen; Wenbei Ma; Yanyan Zhong; Yingying Liang; Lishan Gu; Xiaohe Lu; Jiali Li
Journal:  J Cell Mol Med       Date:  2021-11-28       Impact factor: 5.310

3.  hsa_circ_0072389, hsa_circ_0072386, hsa_circ_0008621, hsa_circ_0072387, and hsa_circ_0072391 aggravate glioma via miR-338-5p/IKBIP.

Authors:  Jian Liang; Xing Li; Jian Xu; Guang-Mou Cai; Jian-Xuan Cao; Bo Zhang
Journal:  Aging (Albany NY)       Date:  2021-12-12       Impact factor: 5.682

4.  Chidamide Suppresses the Growth of Cholangiocarcinoma by Inhibiting HDAC3 and Promoting FOXO1 Acetylation.

Authors:  Yongpan Li; Jujia Zheng; Qiang Huo; Zhongchao Chen; Jun Chen; Xiangwei Xu
Journal:  Stem Cells Int       Date:  2022-01-28       Impact factor: 5.443

Review 5.  Emerging role of non-coding RNAs in the regulation of Sonic Hedgehog signaling pathway.

Authors:  Soudeh Ghafouri-Fard; Tayyebeh Khoshbakht; Bashdar Mahmud Hussen; Mohammad Taheri; Majid Samsami
Journal:  Cancer Cell Int       Date:  2022-09-13       Impact factor: 6.429

Review 6.  Potential targets and treatments affect oxidative stress in gliomas: An overview of molecular mechanisms.

Authors:  Shiyu Liu; Lihua Dong; Weiyan Shi; Zhuangzhuang Zheng; Zijing Liu; Lingbin Meng; Ying Xin; Xin Jiang
Journal:  Front Pharmacol       Date:  2022-07-22       Impact factor: 5.988

7.  PCBP2 Reduced Oxidative Stress-Induced Apoptosis in Glioma through cGAS/STING Pathway by METTL3-Mediated m6A Modification.

Authors:  Xiang Chen; Mingchuan Yu; Wei Xu; Peng Kun; Wenbing Wan; Xiao Yuhong; Jing Ye; Yu Liu; Jun Luo
Journal:  Oxid Med Cell Longev       Date:  2022-10-11       Impact factor: 7.310

Review 8.  Nanoparticle-Based RNAi Therapeutics Targeting Cancer Stem Cells: Update and Prospective.

Authors:  Yongquan Tang; Yan Chen; Zhe Zhang; Bo Tang; Zongguang Zhou; Haining Chen
Journal:  Pharmaceutics       Date:  2021-12-08       Impact factor: 6.321

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.