Coronaviruses (CoVs) traffic frequently between species resulting in novel disease outbreaks, most recently exemplified by the newly emerged SARS-CoV-2, the causative agent of COVID-19. Here, we show that the ribonucleoside analog β-d-N4-hydroxycytidine (NHC; EIDD-1931) has broad-spectrum antiviral activity against SARS-CoV-2, MERS-CoV, SARS-CoV, and related zoonotic group 2b or 2c bat-CoVs, as well as increased potency against a CoV bearing resistance mutations to the nucleoside analog inhibitor remdesivir. In mice infected with SARS-CoV or MERS-CoV, both prophylactic and therapeutic administration of EIDD-2801, an orally bioavailable NHC prodrug (β-d-N4-hydroxycytidine-5'-isopropyl ester), improved pulmonary function and reduced virus titer and body weight loss. Decreased MERS-CoV yields in vitro and in vivo were associated with increased transition mutation frequency in viral, but not host cell RNA, supporting a mechanism of lethal mutagenesis in CoV. The potency of NHC/EIDD-2801 against multiple CoVs and oral bioavailability highlights its potential utility as an effective antiviral against SARS-CoV-2 and other future zoonotic CoVs.
Coronaviruses (CoVs) traffic frequently between species resulting in novel disease outbreaks, most recently exemplified by the newly emerged SARS-CoV-2, the causative agent of COVID-19. Here, we show that the ribonucleoside analog β-d-N4-hydroxycytidine (NHC; EIDD-1931) has broad-spectrum antiviral activity against SARS-CoV-2, MERS-CoV, SARS-CoV, and related zoonotic group 2b or 2c bat-CoVs, as well as increased potency against a CoV bearing resistance mutations to the nucleoside analog inhibitor remdesivir. In miceinfected with SARS-CoV or MERS-CoV, both prophylactic and therapeutic administration of EIDD-2801, an orally bioavailable NHC prodrug (β-d-N4-hydroxycytidine-5'-isopropyl ester), improved pulmonary function and reduced virus titer and body weight loss. Decreased MERS-CoV yields in vitro and in vivo were associated with increased transition mutation frequency in viral, but not host cell RNA, supporting a mechanism of lethal mutagenesis in CoV. The potency of NHC/EIDD-2801 against multiple CoVs and oral bioavailability highlights its potential utility as an effective antiviral against SARS-CoV-2 and other future zoonotic CoVs.
The genetically diverse Orthocoronavirinae (coronavirus, CoV) family
circulates in many avian and mammalian species. Phylogenetically, CoVs are divided into 4
genera: alpha (group 1), beta (group 2), gamma (group 3) and delta (group 4). Three new
humanCoV have emerged in the past 20 years with severe acute respiratory syndrome CoV
(SARS-CoV) in 2002, Middle East respiratory syndrome CoV (MERS-CoV) in 2012, and now
SARS-CoV-2 in 2019 (-). In fact, all humanCoV are thought to have emerged
originally as zoonoses (-). The ongoing SARS-CoV-2 pandemic (referred to as COVID-19,
Coronavirus disease 2019) has caused over 500,000 infections and over 25,000 deaths in 199
countries. Like SARS- and MERS-CoV, the respiratory disease caused by SARS-CoV-2 can
progress to acute lung injury (ALI), an end stage lung disease with limited treatment
options and very poor prognoses(, , ). This emergence paradigm is not limited to humans. A novel
group 1 CoV called swine acute diarrhea syndromeCoV (SADS-CoV) recently emerged from bats
causing the loss of over 20,000 pigs in Guangdong Province, China (). More alarmingly, many group 2 SARS-like and MERS-like
coronaviruses are circulating in bat reservoir species that can use human receptors and
replicate efficiently in primary human lung cells without adaptation(-). The presence of these “pre-epidemic”
zoonotic strains foreshadow the emergence and epidemic potential of additional SARS-like and
MERS-like viruses in the future. Given the diversity of CoV strains in zoonotic reservoirs
and a penchant for emergence, broadly active antivirals are clearly needed for rapid
response to new CoV outbreaks in humans and domesticated animals.Currently, there are no approved therapies specific for any humanCoV.
β-D-N4-hydroxycytidine (NHC, EIDD-1931) is orally bioavailable ribonucleoside analog
with broad-spectrum antiviral activity against various unrelated RNA viruses including
influenza, Ebola, CoV, and Venezuelan equine encephalitis virus (VEEV)(-). For VEEV, the mechanism of action (MOA) for NHC has been
shown to be through lethal mutagenesis where deleterious transition mutations accumulate in
viral RNA(, ). Thus, we sought to determine
NHC’s breadth of antiviral activity against multiple emerging CoV, its mechanism of
action for CoV and its efficacy in mouse models of CoV pathogenesis.
Results
NHC potently inhibits MERS-CoV and newly emerging SARS-CoV-2 replication
To determine whether NHC blocks the replication of highly pathogenic humanCoV, we
performed antiviral assays in cell lines with MERS-CoV and the newly emerging SARS-CoV-2.
We first assessed the antiviral activity of NHC against MERS-CoV in the human lung
epithelial cell line Calu-3 2B4 (“Calu3” cells). Using a recombinant
MERS-CoV expressing nanoluciferase (MERS-nLUC)(), we measured virus replication in cultures exposed to a
dose range of drug for 48hr. NHC was potently antiviral with an average half-maximum
effective concentration (IC50) of 0.15 μM and no observed cytoxicity in
similarly treated uninfected cultures across the dose range (50% cytotoxic concentration,
CC50, >10 μM) (Fig. 1A). The
therapeutic index for NHC was >100. Using a clinical isolate of SARS-CoV2
(2019-nCoV/USA-WA1/2020), we performed antiviral assays in African green monkey kidney
(Vero) cells and found NHC was potently antiviral with an IC50 of 0.3 μM
and CC50 of >10 μM (Fig. 1B). We
then determined the antiviral activity of NHC against SARS-CoV-2 in the Calu-3 cells
through the measurement of infectious virus production and viral genomes. We observed a
dose-dependent reduction in virus titers (Fig. 1C)
with an IC50 of 0.08 μM. Viral genomic RNA was quantitated in clarified
supernatants by qRT-PCR (Fig. 1D). Like the effect on
infectious titers, we found a dose-dependent reduction in viral genomic RNA and a similar
calculated IC50 of 0.09 μM. Collectively, these data demonstrate that
NHC is potently antiviral against two genetically distinct emerging CoV.
Fig. 1
NHC potently inhibits MERS-CoV and newly emerging SARS-CoV-2 replication.
(A) Percent inhibition of MERS-CoV replication and NHC cytotoxicity in Calu-3
cells. Calu-3 cells were infected in triplicate with MERS-CoV nanoluciferase (nLUC) at
a multiplicity of infection (MOI) of 0.08 in the presence of a range of drug for 48
hours, after which replication was measured through quantitation of
MERS-CoV–expressed nLUC. Cytotoxicity was measured in similarly treated but
uninfected cultures via Cell-Titer-Glo assay. Data are combined from 3 independent
experiments. (B) NHC antiviral activity and cytotoxicity in Vero E6 cells
infected with SARS-CoV-2. Vero E6 cells were infected in duplicate with SARS-CoV-2
clinical isolate 2019-nCoV/USA-WA1/2020 virus at an MOI of 0.05 in the presence of a
range of drug for 48 hours, after which replication was measured through quantitation
of cell viability by Cell-Titer-Glo assay. Cytotoxicity was measured as in
A. Data are combined from 2 independent experiments. (C)
SARS-CoV-2 titer reduction (left) and percent inhibition (right) in Calu-3 cells.
Cells were infected with at an MOI of 0.1 for 30 min, washed and exposed to a dose
response of NHC in triplicate per condition. 72 hours post infection, virus production
was measured by plaque assay. (D) SARS-CoV-2 genomic RNA reduction (left)
and percent inhibition (right) in Calu-3 cells. Viral RNA was isolated from clarified
supernatants from the study in panel C. Genome copy numbers were
quantitated by qRT-PCR with primer/probes targeting the N gene. For A-D,
the symbol is at the mean and the error bars represent the standard deviation.
NHC potently inhibits MERS-CoV and newly emerging SARS-CoV-2 replication.
(A) Percent inhibition of MERS-CoV replication and NHC cytotoxicity in Calu-3
cells. Calu-3 cells were infected in triplicate with MERS-CoV nanoluciferase (nLUC) at
a multiplicity of infection (MOI) of 0.08 in the presence of a range of drug for 48
hours, after which replication was measured through quantitation of
MERS-CoV–expressed nLUC. Cytotoxicity was measured in similarly treated but
uninfected cultures via Cell-Titer-Glo assay. Data are combined from 3 independent
experiments. (B) NHC antiviral activity and cytotoxicity in Vero E6 cells
infected with SARS-CoV-2. Vero E6 cells were infected in duplicate with SARS-CoV-2
clinical isolate 2019-nCoV/USA-WA1/2020 virus at an MOI of 0.05 in the presence of a
range of drug for 48 hours, after which replication was measured through quantitation
of cell viability by Cell-Titer-Glo assay. Cytotoxicity was measured as in
A. Data are combined from 2 independent experiments. (C)
SARS-CoV-2 titer reduction (left) and percent inhibition (right) in Calu-3 cells.
Cells were infected with at an MOI of 0.1 for 30 min, washed and exposed to a dose
response of NHC in triplicate per condition. 72 hours post infection, virus production
was measured by plaque assay. (D) SARS-CoV-2 genomic RNA reduction (left)
and percent inhibition (right) in Calu-3 cells. Viral RNA was isolated from clarified
supernatants from the study in panel C. Genome copy numbers were
quantitated by qRT-PCR with primer/probes targeting the N gene. For A-D,
the symbol is at the mean and the error bars represent the standard deviation.
NHC is highly active against SARS-CoV-2, MERS-CoV, and SARS-CoV in primary human
airway epithelial cell cultures
To determine if NHC would be similarly antiviral in primary human cells, we performed a
series of studies in primary airway epithelial (HAE) cell cultures. HAE model the
architecture and cellular complexity of the conducting airway and are readily infected by
multiple human and zoonotic CoV, including SARS- and MERS-CoV (). We first assessed cytotoxicity of NHC in HAE
treated with an extended dose range for 48hr using quantitative PCR of cell death-related
gene transcripts as our metric. NHC treatment did not appreciably alter gene expression
even at doses up to 100 μM (fig. S1). We then sought to determine if NHC would
inhibit clinical isolate SARS-CoV-2 replication in HAE. We observed a dose dependent
reduction in SARS-CoV-2 infectious virus production (Fig.
2A). In MERS-CoV infected HAE, NHC substantially reduced virus production with
maximal titer reduction of > 5 logs at 10 μM (average IC50 = 0.024
μM), which correlated with reduced genomic (ORF1) and subgenomic (ORFN) RNA in
paired samples (Fig. 2B). We observed similar trends
in titer reduction (> 3 log at 10 μM, average IC50 = 0.14 μM)
and in copies of genomic and subgenomic RNA in SARS-CoV- infected HAE (Fig. 2C). Thus, NHC was potently antiviral against
SARS-CoV-2, MERS-CoV and SARS-CoV in primary human epithelial cell cultures without
cytotoxicity.
Fig. 2
NHC is highly active against SARS-CoV-2, MERS-CoV, and SARS-CoV in primary
human airway epithelial cell cultures. (A) HAE were infected at an MOI of 0.5
with clinical isolate SARS-CoV-2 for 2 hours in the presence of NHC in duplicate after
which virus was removed and cultures were washed in incubated in NHC for 48 hours when
apical washes were collected for virus titration by plaque assay. The line is at the
mean. Each symbol represents the titer from a single well. (B) HAE cells
were infected with MERS-CoV red fluorescent protein (RFP) at an MOI of 0.5 in
triplicate and treated similarly to A. qRT-PCR for MERS-CoV ORF1 and ORFN
mRNA. Total RNA was isolated from cultures in C for qRT-PCR analysis.
Representative data from three separate experiments with three different cell donors
are displayed. PFU, plaque-forming units. (C) Studies performed as in
A but with SARS-CoV green fluorescent protein (GFP). Representative
data from two separate experiments with two different cell donors are displayed. Each
symbol represents the data from one HAE culture, the line is at the mean and the error
bars represent the standard deviation.
NHC is highly active against SARS-CoV-2, MERS-CoV, and SARS-CoV in primary
human airway epithelial cell cultures. (A) HAE were infected at an MOI of 0.5
with clinical isolate SARS-CoV-2 for 2 hours in the presence of NHC in duplicate after
which virus was removed and cultures were washed in incubated in NHC for 48 hours when
apical washes were collected for virus titration by plaque assay. The line is at the
mean. Each symbol represents the titer from a single well. (B) HAE cells
were infected with MERS-CoV red fluorescent protein (RFP) at an MOI of 0.5 in
triplicate and treated similarly to A. qRT-PCR for MERS-CoVORF1 and ORFN
mRNA. Total RNA was isolated from cultures in C for qRT-PCR analysis.
Representative data from three separate experiments with three different cell donors
are displayed. PFU, plaque-forming units. (C) Studies performed as in
A but with SARS-CoV green fluorescent protein (GFP). Representative
data from two separate experiments with two different cell donors are displayed. Each
symbol represents the data from one HAE culture, the line is at the mean and the error
bars represent the standard deviation.
NHC is effective against remdesivir (RDV)-resistant virus and multiple distinct
zoonotic CoV
CoV are taxonomically divided into multiple genogroups (alpha, beta, gamma, delta) but
human-infecting CoV are found in only the alpha and beta subgroups thus far (Fig. 3A). There is high sequence conservation in the
RNA-dependent RNA polymerase (RdRp, nsp12) across CoV (Fig.
3A). For example, the RdRp of SARS-CoV-2 has 99.1% similarity and 96% amino acid
identity to that of SARS-CoV (Fig. 3A). To gain
insight into structural conservation of RdRp across the CoV family, we modeled the
variation reflected in the RdRp dendrogram in Fig. 3A
onto the structure of the SARS-CoVRdRp () (Fig. 3B). The core
of the RdRp molecule and main structural motifs that all RdRp harbor (Fig. 3B and fig. S2) are highly conserved among CoV including
SARS-CoV-2. We previously reported that CoV resistance to another broad spectrum
nucleoside analog, RDV, was mediated by RdRp residues F480L and V557L in a model
coronavirusmouse hepatitis virus (MHV) and in SARS-CoV, resulting in a 5-fold shift in
IC50 (Fig. 3C)(). Consequently, we tested whether RDV resistance
mutations in MHV conferred cross-resistance to NHC. In fact, the two RDV resistance
mutations, alone or together, conferred increased sensitivity to inhibition by NHC (Fig. 3D). As our previous studies have demonstrated a
high genetic barrier to NHC for VEEV, influenza and CoV (-), the lack of cross-resistance further suggests that NHC
and RDV may select for exclusive and mutually sensitizing resistance pathways.
Fig. 3
Remdesivir (RDV) resistance mutations in the highly conserved RNA-dependent RNA
polymerase increase susceptibility to NHC. (A) Neighbor-joining trees created
with representatives from all four CoV genogroups showing the genetic similarity of
CoV nsp12 (RdRp) and CoV spike glycoprotein, which mediates host tropism and entry
into cells. Text color of the virus strain label corresponds to virus host species on
the left. The heatmap adjacent to each neighbor-joining tree depicts percent amino
acid identity (% A.A. similarity) against mouse hepatitis virus (MHV), SARS-CoV, or
MERS-CoV. (B) The variation encompassed in panel A was
modeled onto the RdRp structure of the SARS-CoV RdRp. (C) Amino acid
sequence of CoV in panel A at known resistance alleles to antiviral drug
RDV. (D) Virus titer reduction assay in DBT cells across a range of NHC
with recombinant MHV bearing resistance mutations to RDV. Data shown are combined from
three independent experiments performed with biological duplicates or triplicates per
condition. Asterisks indicate statistically significant differences by Mann-Whitney
test as indicated on the graph.
Remdesivir (RDV) resistance mutations in the highly conserved RNA-dependent RNA
polymerase increase susceptibility to NHC. (A) Neighbor-joining trees created
with representatives from all four CoV genogroups showing the genetic similarity of
CoV nsp12 (RdRp) and CoV spike glycoprotein, which mediates host tropism and entry
into cells. Text color of the virus strain label corresponds to virus host species on
the left. The heatmap adjacent to each neighbor-joining tree depicts percent amino
acid identity (% A.A. similarity) against mouse hepatitis virus (MHV), SARS-CoV, or
MERS-CoV. (B) The variation encompassed in panel A was
modeled onto the RdRp structure of the SARS-CoVRdRp. (C) Amino acid
sequence of CoV in panel A at known resistance alleles to antiviral drug
RDV. (D) Virus titer reduction assay in DBT cells across a range of NHC
with recombinant MHV bearing resistance mutations to RDV. Data shown are combined from
three independent experiments performed with biological duplicates or triplicates per
condition. Asterisks indicate statistically significant differences by Mann-Whitney
test as indicated on the graph.To explore the breadth of antiviral efficacy against zoonotic CoV, we performed antiviral
assays in HAE with three zoonotic Bat-CoV: SHC014, HKU3, and HKU5. Closely related to the
beta 2b SARS-CoV, Bat-CoV SHC014 is capable of replicating in human cells without
adaptation(), suggesting its
potential for zoonotic emergence into humans. The more distantly related SARS-like beta 2b
CoV, recombinant Bat-CoVHKU3, has a modified receptor binding domain to facilitate growth
in cell culture (). Lastly,
Bat-CoVHKU5 is a MERS-like beta 2c CoV (). NHC diminished infectious virus production and the
levels of genomic/subgenomic viral RNA in HAE in a dose-dependent manner for all three
Bat-CoVs (Fig. 4). Therefore, the antiviral activity
of NHC was not limited by natural amino acid variation in the RdRp, which among the group
2b and group 2c CoV can vary by almost 20%. Moreover, these data suggest that if another
SARS- or MERS-like virus were to spillover into humans in the future, they would likely be
susceptible to the antiviral activity of NHC.
Fig. 4
NHC is effective against multiple genetically distinct Bat-CoV.
Top: Antiviral efficacy of NHC in HAE cells against SARS-like (HKU3, SHC014, group
2b) and MERS-like (HKU5, group 2c) bat-CoV. HAE cells were infected at an MOI of 0.5
in the presence of NHC in duplicate. After 48 hours, virus produced was titrated via
plaque assay. Each data point represents the titer per culture. Bottom: qRT-PCR for
CoV ORF1 and ORFN mRNA in total RNA from cultures in the top panel. Mock,
mock-treated. Representative data from two separate experiments with two different
cell donors are displayed.
NHC is effective against multiple genetically distinct Bat-CoV.
Top: Antiviral efficacy of NHC in HAE cells against SARS-like (HKU3, SHC014, group
2b) and MERS-like (HKU5, group 2c) bat-CoV. HAE cells were infected at an MOI of 0.5
in the presence of NHC in duplicate. After 48 hours, virus produced was titrated via
plaque assay. Each data point represents the titer per culture. Bottom: qRT-PCR for
CoVORF1 and ORFN mRNA in total RNA from cultures in the top panel. Mock,
mock-treated. Representative data from two separate experiments with two different
cell donors are displayed.
NHC antiviral activity is associated with increased viral mutation rates
It has recently been shown that NHC treatment increases the mutation rate in viral
genomic RNA of RSV (), VEEV
(), influenza (), and our previous study used RNA
seq to show that overall transition mutation frequency is increased during NHC treatment
of MHV and MERS-CoV during infection in continuous cell lines(). We sought to determine if NHC would increase the
mutation frequency during MERS-CoV infection in human primary HAE. Using MERS-CoV-infected
HAE treated with either vehicle or a dose range of NHC or RDV, we show that both drugs
reduced virus titers in a dose-dependent manner (Fig.
5A). We then used a highly-sensitive high-fidelity deep sequencing approach
(Primer ID NGS), which uses barcoded degenerate primers and Illumina indexed libraries to
determine accurate mutation rates on viral RNA production (). Using this approach, we analyzed a 538 bp region of
viral genomic RNA in nonstructural protein 15 (nsp15). The error rates (#mutations/10,000
bases) in vehicle- (0.01) or RDV- (0.01) treated cultures were very low. RDV is reported
to act via chain termination of nascent viral RNA, and thus the low error rates in
RDV-treated cultures are in line with the proposed MOA (). In contrast, the error rate was significantly increased
in NHC-treated MERS-CoV RNA in a dose-dependent manner (Two-way ANOVA with
Dunnett’s multiple comparison test; 10-fold increase at 10 μM, P < 0.0001
at 24 and 48 hpi; 5-fold increase at 1μM, P < 0.0001 at 24 hpi and P = 0.0015 at
48 hpi) (Fig. 5C). The magnitude of the error rate in
NHC-treated cultures correlated with virus titer reduction. At 48 hpi the respective error
rate and virus titer was 0.015 and 3.96E+06 pfu/mL for vehicle treatment, 0.045 and
2.86E+04 pfu/mL with 1 μM NHC; and 0.090 and 1.5E+02 pfu/mL 10 μM NHC. Thus,
with 1 μM NHC a 3-fold increase in error rate resulted in a 138-fold decrease in
virus titer, while with 10 μM NHC a 6-fold increase in error rate resulted in a
26,000-fold decrease in virus titer.
Fig. 5
NHC antiviral activity is associated with increased viral mutation
rates. (A) HAE cultures were infected with MERS-CoV red
fluorescent protein (RFP) at an MOI of 0.5 in duplicate in the presence of vehicle,
RDV, or NHC for 48 hours, after which apical washes were collected for virus
titration. Data are combined from two independent studies. The boxes encompass the
25th to 75th percentile, the line is at the median, while the whiskers represent the
range. (B) Schematic of Primer ID deep sequencing for single RNA genomes
of MERS-CoV. (C) The total error rate for MERS-CoV RNA isolated from
cultures in panel A as determined by Primer ID. Error rate values are #
mutations per 10,000 bases. Asterisks indicate significant differences as compared to
untreated group by two-way ANOVA with a Dunnett’s multiple comparison test.
(D) Description of potential NHC mutational spectra on both positive
and negative sense viral RNA. (E) Nucleotide transitions in cDNA derived
from MERS-CoV genomic RNA.
NHC antiviral activity is associated with increased viral mutation
rates. (A) HAE cultures were infected with MERS-CoV red
fluorescent protein (RFP) at an MOI of 0.5 in duplicate in the presence of vehicle,
RDV, or NHC for 48 hours, after which apical washes were collected for virus
titration. Data are combined from two independent studies. The boxes encompass the
25th to 75th percentile, the line is at the median, while the whiskers represent the
range. (B) Schematic of Primer ID deep sequencing for single RNA genomes
of MERS-CoV. (C) The total error rate for MERS-CoV RNA isolated from
cultures in panel A as determined by Primer ID. Error rate values are #
mutations per 10,000 bases. Asterisks indicate significant differences as compared to
untreated group by two-way ANOVA with a Dunnett’s multiple comparison test.
(D) Description of potential NHC mutational spectra on both positive
and negative sense viral RNA. (E) Nucleotide transitions in cDNA derived
from MERS-CoV genomic RNA.We then examined the mutational spectra induced by NHC, which can be incorporated into
viral RNA as a substitution for either cytosine (C) or uracil (U). RNA-mutagenic
antivirals may incorporate in both nascent negative and positive sense RNA during genome
replication (Fig. 5D). Adenine-to-guanine (A-to-G)
and uracil-to-cytosine (U-to-C) transitions were enriched in MERS-CoV genomic RNA in an
NHC dose-dependent manner (Fig. 5E). Collectively,
these data used high-fidelity sequence analysis to demonstrate a specific enrichment for
A:G and C:U transitions in MERS-CoV RNA after NHC treatment of primary HAE cell
cultures.
Therapeutic EIDD-2801 reduces SARS-CoV replication and pathogenesis
Given the promising antiviral activity of NHC in vitro, we next evaluated its in vivo
efficacy using EIDD-2801, an orally bioavailable prodrug of NHC
(β-D-N4-hydroxycytidine-5′-isopropyl ester), designed for
improved in vivo pharmacokinetics and oral bioavailability in humans and non-human
primates (). Importantly, the
plasma profiles of NHC and EIDD-2801 are similar in mice following oral delivery (). We first performed a prophylactic
dose escalation study in C57BL/6 mice where we orally administered vehicle (10% PEG, 2.5%
Cremophor RH40 in water) or 50, 150, or 500 mg/kg EIDD-2801 2hr prior to intranasal
infection with 5E+04 PFU of mouse-adapted SARS-CoV (SARS-MA15), and then vehicle or drug
every 12 hours thereafter. Beginning on 3 days post-infection (dpi) and through the end of
the study, body weight loss compared to vehicle treatment was significantly diminished (50
mg/kg) or prevented (150, 500 mg/kg) with EIDD-2801 prophylaxis (Two-way ANOVA with
Dunnett’s multiple comparison test, P < 0.0001) (fig. S3A). Lung hemorrhage was
also significantly reduced 5 dpi with 500 mg/kg EIDD-2801 treatment (Kruskal-Wallis Test,
P = 0.010, fig. S3B). Interestingly, there was a dose-dependent reduction in SARS-CoV lung
titer (median titers: 50 mg/kg = 7E+03 pfu/mL, 150 mg/kg = 2.5E+03 pfu/mL, 500 mg/kg = 50
pfu/mL, vehicle = 6.5E+04 pfu/mL) with significant differences (Kruskal-Wallis with
Dunn’s multiple comparisons test) among the vehicle, 150 mg/kg (P = 0.03) and 500
mg/kg (P = 0.006) groups. Thus, prophylactic orally administered EIDD-2801 was robustly
antiviral and able to prevent SARS-CoV replication and disease.Since only the 500 mg/kg group significantly diminished weight loss, hemorrhage and
reduced lung titer to near undetectable levels, we tested this dose under therapeutic
treatment conditions to determine if EIDD-2801 could improve the outcomes of an ongoing
CoV infection. As a control, we initiated oral vehicle or EIDD-2801 2 hours prior to
infection with 1E+04 pfu SARS-MA15. For therapeutic conditions, we initiated EIDD-2801
treatment 12, 24, or 48 hours after infection. After initiating treatment, dosing for all
groups was performed every 12 hours for the duration of the study. Both prophylactic
treatment initiated 2 hours prior to infection and therapeutic treatment initiated 12
hours after infection significantly (Two-way ANOVA with Tukey’s multiple comparison
test) prevented body weight loss following SARS-CoV infection on 2 dpi and thereafter (-2
hours: P = 0.0002 to <0.0001; +12 hours: P = 0.0289 to <0.0001) as compared to
vehicle treated animals (Fig. 6A). Treatment
initiated 24 hpi also significantly reduced body weight loss (3-5 dpi, P = 0.01 to
<0.0001) although not to the same degree as the earlier treatment initiation groups.
When initiated 48 hpi, body weight loss was only different from vehicle on 4 dpi (P =
0.037, Fig. 6A). Therapeutic EIDD-2801 significantly
(Kruskal-Wallis with Dunnett’s multiple comparison test) reduced lung hemorrhage
when initiated up to 24 hours after infection (-2, +12, and +24 hours P < 0.0001)
mirroring the body weight loss phenotypes (Fig. 6B).
Interestingly, all EIDD-2801 treated mice had significantly (Kruskal-Wallis with
Dunnett’s multiple comparison test) reduced viral loads in the lungs even in the
+48 hours group (All P < 0.0001, Fig. 6C), which
experienced the least protection from body weight loss and lung hemorrhage. We also
measured pulmonary function via whole body plethysmography (WBP). In Fig. 6D, we show the WBP enhanced pause (PenH) metric, which is a
surrogate marker for bronchoconstriction or pulmonary obstruction (), was significantly (Two-way ANOVA with
Dunnett’s multiple comparison test) improved throughout the course of the study if
treatment was initiated up to 12 hours after infection (-2 hours: 2d pi to 5 dpi, P <
0.0001 to 0.019, +12 hours: 2 dpi to 5 dpi, P < 0.0001 to 0.0192) although the +24
hours group showed sporadic improvement as well (3 dpi P = 0.002) (Fig. 6D). Lastly, we blindly evaluated hematoxylin and eosin-stained
lung tissue sections for histological features of ALI using two different and
complementary scoring tools (),
which show that treatment initiated up to +12 hours significantly reduced ALI
(Kruskal-Wallis with Dunn’s multiple comparison test) (American Thoracic Society
(ATS) Lung Injury Score: -2 hours P = 0.0004, +12 hours P = 0.0053, Diffuse alveolar
damage (DAD) Score: -2 hours P = 0.0015, +12 hours P = 0.0004, Fig. 6E). Altogether, therapeutic EIDD-2801 was potently antiviral
against SARS-CoV in vivo but the degree of clinical benefit was dependent on the time of
initiation post-infection.
Fig. 6
Prophylactic and therapeutic EIDD-2801 reduces SARS-CoV replication and
pathogenesis. Equivalent numbers of 25-29 week old male and female C57BL/6
mice were administered vehicle (10% PEG, 2.5% Cremophor RH40 in water) or NHC prodrug
EIDD-2801 beginning at -2 hours, +12, +24 or +48 hours post infection and every 12
hours thereafter by oral gavage (n = 10/group). Mice were intranasally infected with
1E+04 PFU mouse-adapted SARS-CoV MA15 strain. (A) Percent starting
weight. Asterisks indicate differences from vehicle treated by two-way ANOVA with
Tukey’s multiple comparison test. (B) Lung hemorrhage in mice from
panel A scored on a scale of 0-4 where 0 is a normal pink healthy lung
and 4 is a diffusely discolored dark red lung. (C) Virus lung titer in
mice from panel A as determined by plaque assay. Asterisks in both panel
B and C indicate differences from vehicle by one-way ANOVA
with a Dunnett’s multiple comparison test. (D) Pulmonary function
by whole body plethysmography was performed daily on five animals per group. Asterisks
indicate differences from vehicle by two-way ANOVA with a Dunnett’s multiple
comparison test. (E) The histological features of acute lung injury (ALI)
were blindly scored using the American Thoracic Society Lung Injury Scoring system and
a Diffuse Alveolar Damage Scoring System. Three randomly chosen high power (60X)
fields of diseased lung were assessed per mouse. The numbers of mice scored per group:
Vehicle N = 7, -2 hours N = 9, +12 hours N = 9, +24 hours N = 10, +48 hours N = 9.
Asterisks indicate statistical significance compared to vehicle by Kruskal-Wallis with
a Dunn’s multiple comparison test. For all panels, the boxes encompass the 25th
to 75th percentile, the line is at the median, while the whiskers represent the range.
*, -2 hours and +12 hours compared to vehicle; **, +24 hours compared to vehicle; ***,
+48 hours compared to vehicle.
Prophylactic and therapeutic EIDD-2801 reduces SARS-CoV replication and
pathogenesis. Equivalent numbers of 25-29 week old male and female C57BL/6
mice were administered vehicle (10% PEG, 2.5% Cremophor RH40 in water) or NHC prodrug
EIDD-2801 beginning at -2 hours, +12, +24 or +48 hours post infection and every 12
hours thereafter by oral gavage (n = 10/group). Mice were intranasally infected with
1E+04 PFUmouse-adapted SARS-CoVMA15 strain. (A) Percent starting
weight. Asterisks indicate differences from vehicle treated by two-way ANOVA with
Tukey’s multiple comparison test. (B) Lung hemorrhage in mice from
panel A scored on a scale of 0-4 where 0 is a normal pink healthy lung
and 4 is a diffusely discolored dark red lung. (C) Virus lung titer in
mice from panel A as determined by plaque assay. Asterisks in both panel
B and C indicate differences from vehicle by one-way ANOVA
with a Dunnett’s multiple comparison test. (D) Pulmonary function
by whole body plethysmography was performed daily on five animals per group. Asterisks
indicate differences from vehicle by two-way ANOVA with a Dunnett’s multiple
comparison test. (E) The histological features of acute lung injury (ALI)
were blindly scored using the American Thoracic Society Lung Injury Scoring system and
a Diffuse Alveolar Damage Scoring System. Three randomly chosen high power (60X)
fields of diseased lung were assessed per mouse. The numbers of mice scored per group:
Vehicle N = 7, -2 hours N = 9, +12 hours N = 9, +24 hours N = 10, +48 hours N = 9.
Asterisks indicate statistical significance compared to vehicle by Kruskal-Wallis with
a Dunn’s multiple comparison test. For all panels, the boxes encompass the 25th
to 75th percentile, the line is at the median, while the whiskers represent the range.
*, -2 hours and +12 hours compared to vehicle; **, +24 hours compared to vehicle; ***,
+48 hours compared to vehicle.
EIDD-2801 prophylactic and therapeutic efficacy correlates with increased MERS-CoV
mutation rate
After obtaining promising in vivo efficacy data with SARS-CoV, we investigated whether
EIDD-2801 would be effective against MERS-CoV. As the murine ortholog of the MERS-CoV
receptor, dipeptidyl peptidase 4 (DPP4), does not support viral binding and entry, all in
vivo studies were performed in genetically modified mice encoding a murineDPP4 receptor
encoding two human residues at positions 288 and 330 (hDPP4 288/330 mice)(, ). Similar to our SARS-CoV data, all
doses of prophylactic EIDD-2801 (50, 150 and 500 mg/kg) protected hDPP4 288/330 mice (fig.
S4) from significant body weight loss (Two-way ANOVA with Dunnett’s multiple
comparison test, P = 0.03 to < 0.0001), lung hemorrhage (Kruskal-Wallis with
Dunn’s multiple comparison test, P = 0.01 to <0.0001), and virus replication
which was undetectable (Kruskal-Wallis with Dunn’s multiple comparison test, P <
0.0001) regardless of drug dose following intranasal infection with 5E+04 PFUmouse-adapted MERS-CoV (fig. S4).We then evaluated the therapeutic efficacy EIDD-2801 following the promising results of
our prophylactic studies. Similar to our SARS-CoV study, EIDD-2801 treatment administered
before or 12 hours after intranasal mouse-adapted MERS-CoV infection (5E+04 PFU) prevented
body weight loss from 2 through 6 dpi (Two-way ANOVA with Tukey’s multiple
comparison test, Fig. 7A, P = 0.02 to <0.0001) and
lung hemorrhage on 6 dpi (Kruskal-Wallis with Dunn’s multiple comparison test, P =
0.0004 to < 0.0001, Fig. 7B), but treatment
initiated 24 or 48 hours did not offer similar protection. Unlike body weight loss and
lung hemorrhage data which varied by treatment initiation time, virus lung titer on 6 dpi
was significantly reduced to the limit of detection in all treatment groups
(Kruskal-Wallis with Dunn’s multiple comparison test, Fig. 7C, P < 0.0001). Interestingly, when viral genomic RNA was quantified in
paired samples of lung tissue, EIDD-2801 significantly reduced quantities of viral RNA
(One-way ANOVA with Dunnett’s multiple comparison test, P <0.0001 to 0.017) in
an initiation time-dependent manner for all groups except for +48 hours (Fig. 7D). The discrepancy among infectious titers and
viral RNA suggests that accumulated mutations render the particles non-infectious and
undetectable by plaque assay, consistent with the MOA. To gauge the effect of EIDD-2801
treatment on lung function, we assessed pulmonary function by WBP. Mirroring the body
weight loss data, normal pulmonary function was only observed in groups where treatment
was initiated prior to or 12 hours after infection (Two-way ANOVA with Tukey’s
multiple comparison test, -2hr: P < 0.0001 3 dpi, P = 0.0002 4 dpi, +12hr: P <
0.0001 3 dpi, P = 0.0008 4 dpi, Fig. 7E).
Collectively, these data demonstrate that NHC prodrug, EIDD-2801, robustly reduces
MERS-CoV infectious titers, viral RNA, and pathogenesis under both prophylactic and early
therapeutic conditions.
Fig. 7
Prophylactic and therapeutic EIDD-2801 reduces MERS-CoV replication and
pathogenesis coincident with increased viral mutation rates. Equivalent
numbers of 10-14 week old male and female C57BL/6 hDPP4 mice were administered vehicle
(10% PEG, 2.5% Cremophor RH40 in water) or NHC prodrug EIDD-2801 beginning at -2
hours, +12, +24 or +48 hours post infection and every 12 hours thereafter by oral
gavage (n = 10/group). Mice were intranasally infected with 5E+04 PFU mouse-adapted
MERS-CoV M35C4 strain. (A) Percent starting weight. Asterisks indicate
differences between -2 hours and +12 hours group from vehicle by two-way ANOVA with
Tukey’s multiple comparison test. (B) Lung hemorrhage in mice from
panel A scored on a scale of 0-4 where 0 is a normal pink healthy lung
and 4 is a diffusely discolored dark red lung. (C) Virus lung titer in
mice from panel A as determined by plaque assay. Asterisks in both panel
B and C indicate differences from vehicle by
Kruskal-Wallis with Dunn’s multiple comparison test. (D) MERS-CoV
genomic RNA in lung tissue by qRT-PCR. Asterisks indicate differences by one-way ANOVA
with a Dunnett’s multiple comparison test. (E) Pulmonary function
by whole body plethysmography was performed daily on four animals per group. Asterisks
indicate differences from vehicle by two-way ANOVA with Tukey’s multiple
comparison test. (F) Workflow to measure mutation rate in MERS-CoV RNA
and host transcript ISG15 by Primer ID in mouse lung tissue. (G) Number
of template consensus sequences (TCS) for MERS-CoV nsp10 and ISG15. (H)
Total error rate in MERS-CoV nsp10 and ISG15. (I) The cytosine to uridine
transition rate in MERS-CoV nsp10 and ISG15. In panels G-I, asterisks
indicate differences from vehicle by two-way ANOVA with Tukey’s multiple
comparison test. (J) Codon change frequency in MERS-CoV nsp10. Asterisks
indicate differences from vehicle by Kruskal-Wallis with Dunn’s multiple
comparison test. For all panels, the boxes encompass the 25th to 75th percentile, the
line is at the median, while the whiskers represent the range.
Prophylactic and therapeutic EIDD-2801 reduces MERS-CoV replication and
pathogenesis coincident with increased viral mutation rates. Equivalent
numbers of 10-14 week old male and female C57BL/6 hDPP4mice were administered vehicle
(10% PEG, 2.5% Cremophor RH40 in water) or NHC prodrug EIDD-2801 beginning at -2
hours, +12, +24 or +48 hours post infection and every 12 hours thereafter by oral
gavage (n = 10/group). Mice were intranasally infected with 5E+04 PFUmouse-adapted
MERS-CoV M35C4 strain. (A) Percent starting weight. Asterisks indicate
differences between -2 hours and +12 hours group from vehicle by two-way ANOVA with
Tukey’s multiple comparison test. (B) Lung hemorrhage in mice from
panel A scored on a scale of 0-4 where 0 is a normal pink healthy lung
and 4 is a diffusely discolored dark red lung. (C) Virus lung titer in
mice from panel A as determined by plaque assay. Asterisks in both panel
B and C indicate differences from vehicle by
Kruskal-Wallis with Dunn’s multiple comparison test. (D) MERS-CoV
genomic RNA in lung tissue by qRT-PCR. Asterisks indicate differences by one-way ANOVA
with a Dunnett’s multiple comparison test. (E) Pulmonary function
by whole body plethysmography was performed daily on four animals per group. Asterisks
indicate differences from vehicle by two-way ANOVA with Tukey’s multiple
comparison test. (F) Workflow to measure mutation rate in MERS-CoV RNA
and host transcript ISG15 by Primer ID in mouse lung tissue. (G) Number
of template consensus sequences (TCS) for MERS-CoV nsp10 and ISG15. (H)
Total error rate in MERS-CoV nsp10 and ISG15. (I) The cytosine to uridine
transition rate in MERS-CoV nsp10 and ISG15. In panels G-I, asterisks
indicate differences from vehicle by two-way ANOVA with Tukey’s multiple
comparison test. (J) Codon change frequency in MERS-CoV nsp10. Asterisks
indicate differences from vehicle by Kruskal-Wallis with Dunn’s multiple
comparison test. For all panels, the boxes encompass the 25th to 75th percentile, the
line is at the median, while the whiskers represent the range.To study the molecular mechanisms associated with drug performance in vivo, we
investigated the correlation between infectious virus production and EIDD-2801-mediated
mutagenesis of MERS-CoV RNA under therapeutic treatment conditions. Using Primer ID NGS,
we measured the mutation rates of both viral genomic RNA (non-structural protein 10,
nsp10) and host interferon stimulated gene 15 (ISG15) mRNA, a highly
up-regulated innate immune-related gene after MERS-CoV infection (Fig. 7F). Primer ID NGS measures the mutational frequency in single RNA
molecules, each of which are represented by a single template consensus sequence (TCS)
(). Viral TCS were
significantly reduced (Two-way ANOVA with Tukey’s multiple comparison test, -2
hours P <0.0001, +12 hours P = 0.0001, +24 hours P = 0.02) in a treatment initiation
time-dependent manner (Fig. 7G) similar to viral
genomic RNA measured by qRT-PCR. In contrast, the numbers of ISG15TCS were similar (P =
0.2 to 0.8) for all groups indicating that neither vehicle nor drug treatment
significantly affected the levels of or mutated ISG15 mRNA transcripts (Fig. 7G). Similar to our TCS data in Fig. 6G, the total error rate in viral nsp10 was significantly increased
(Two-way ANOVA with Tukey’s multiple comparison test) in groups where treatment was
initiated prior to (-2 hours, median error rate = 10.5 errors/10,000 bases, P < 0.0001)
and up to 24 hours post infection (12 hours, median error rate = 8.2 errors/10,000 bases,
P < 0.0001 ; +24 hours, median error rate = 5.4 errors/10,000 bases, P = 0.0003) but
the error rates in ISG15 remained at baseline for all groups (Fig. 7H). In addition, nucleotide transitions observed in MERS-CoV
genomes in vitro, were also observed in vivo in groups where treatment was initiated prior
to and up to 12 hours post infection (Two-way ANOVA with Tukey’s multiple
comparison test, P = 0.0003 to < 0.0001) (Fig.
7I). Importantly, these transitions were not observed in host ISG15 mRNA (Fig. 7I). Lastly, the EIDD-2801 dose-dependent
mutagenesis of viral RNA correlated with an increase in codon change frequency, including
stop codons, in mice where treatment was initiated 12 hours or before (Two-way ANOVA with
Tukey’s multiple comparison test, vehicle median = 3.4; -2hr median = 22.8, P =
0.0035; +12 hours median = 20.0, P = 0.0004, Fig.
7J). Thus, approximately 20% of the mutations observed in the -2 hours and +12
hours groups resulted in a codon change and alteration of the nsp10 protein sequence. When
extrapolating our results from nsp10 to the entirety of the 30kb MERS-CoV genome,
EIDD-2801 likely causes between 15 (+24 hours treatment) and 30 (-2 hours treatment)
mutations per genome, 10-20% of which result in amino acid coding changes. Altogether, our
data demonstrates that EIDD-2801-driven mutagenesis correlates well with the reductions in
viral load, strongly suggestive of an error catastrophe-driven mechanism of action under
therapeutic conditions.
Discussion
In the past 20 years, three novel humancoronaviruses have emerged (, ). The group 2b SARS-like CoV represent an existential and
future threat to global health as evidenced by the emergence of SARS-CoV and SARS-CoV-2.
Zoonotic SARS-like bat CoV strains can use humanangiotensin-converting enzyme 2 (ACE2)
receptors, grow well in primary human airway cells, and vary by as much as 25% in key
therapeutic and vaccine gene targets (, ). Thus, to address the current public health emergency of
COVID-19 and to maximize pandemic preparedness in the future, broad-based vaccines and
therapeutics, which are active against the higher risk RNA virus families prone to
emergence, are desperately needed.Small molecule antivirals can exert their antiviral effect through multiple mechanisms
including blocking viral entry, inhibiting a virally encoded enzyme, blocking virus particle
formation, or targeting a host factor required for replication (). Multiple direct acting antivirals are currently
under evaluation in randomized control trials to treat COVID-19 including
hydroxychloroquine, remdesivir, lopinavir/ritonavir(-). Here, we report the broad-spectrum antiviral activity of
NHC and its orally bioavailable prodrug EIDD-2801, against SARS-CoV, MERS-CoV, and the
current pandemic strain SARS-CoV-2 in primary human airway epithelial cells. In addition to
CoV, NHC is broadly active against multiple genetically distinct viruses including VEE,
influenza A and B, Ebola, and Chikungunya viruses (-, , , , -). Here, we show that prophylactic and therapeutic EIDD-2801
significantly reduced lung viral loads and improved pulmonary function in mouse models of
both SARS- and MERS-CoV pathogenesis. Although the improvement in both SARS- and MERS-CoV
outcomes diminished with the delay of treatment initiation time, it is important to note
that the kinetics of disease in mice are compressed as compared to that in humans. Whereas
SARS- and MERS-CoV lung titers peak on 1-2 dpi in mice concurrent with the onset of clinical
signs and notable damage to the lung epithelium, in humans this occurs 7-10 days after the
onset of symptoms (,
,
,
). Thus, in mice, the
window within which to treat emerging CoV infection prior to peak replication is compressed
(e.g., 24-48 hours). As with oseltamivir treatment for influenza which fails to provide a
protective effect if administered >5 days after the onset of symptoms, the window in
which to treat COVID-19patients prior to peak virus replication is likely during the first
week of symptoms when pharyngeal shedding is at its highest(, ). However, virus replication and shedding may continue for
several weeks in the most severe COVID-19patients(). Thus, early intervention with an antiviral like EIDD-2801
is likely to provide the most clinical benefit although there may opportunities in severe
patients where the duration of virus replication may be extended. Our current study is
clearly limited by the lack of in vivo efficacy testing with SARS-CoV-2. Currently, robust
mouse models that recapitulate the SARS-CoV-2 pathogenesis observed in humans do not yet
exist due to a noted virus spike glycoprotein and mouseACE2 receptor incompatibility
complicating the evaluation of medical countermeasures(, ). In addition, SARS-CoV and MERS-CoV, SARS-CoV-2 disease
severity increases with increasing age. Our studies are limited by the lack of drug efficacy
testing in CoV aged mouse models that recapitulate the age-related increase in pathogenesis
observed in humans(). The data
provided in this manuscript suggest that EIDD-2801 should be quickly evaluated in primate
models of human disease, using immediate models for MERS-CoV and SARS-CoV pathogenesis or
newly described cynomolgus and rhesus macaque models for SARS-CoV-2 (-).For VEE and influenza, NHC/EIDD-2801 exerts its antiviral activity on the RNA-dependent RNA
polymerase leading to error catastrophe by inducing an error rate of replication that
surpasses the error threshold allowed to sustain a virus population (, ). This process occurs when NHC is incorporated during RNA
synthesis then subsequently misread thus increasing mutation rates. Therefore, for CoV, the
NHC MOA would appear less likely to be affected by the RNA proofreading activity encoded by
the nsp14 exonuclease function that otherwise limits misincorperation (). Here, we present data using Primer ID NGS to
quantitate the frequency and identity of the mutational spectra in the MERS-CoV genome in
both drug-treated primary human airway cells and in mice at single genome resolution. As CoV
are positive sense RNA viruses that replicate through a negative sense RNA intermediate, NHC
incorporation as a C or a U can occur in both polarities of RNA. We found increased
nucleotide transitions (A to G, G to A, C to U, U to C) consistent with those reported after
influenza and VEE infections (, ). Under identical conditions, RDV did not alter the mutation
rate in MERS-CoV genomic RNA, supporting its reported mechanism of action as a chain
terminator of viral RNA synthesis (). In primary human lung cell cultures and miceinfected with
MERS-CoV, the NHC mutation rates inversely correlated with a reduction in infectious virus.
In addition, we found a positive correlation between increased mutation rates and the
frequency of nonsynonymous mutations and the degree of therapeutic efficacy in mice. To
explore the potential off-target effect in host mRNA which may contribute to drug toxicity,
we also examined the impact of NHC treatment on ISG15 transcripts, a gene
highly induced following MERS-CoV infection. Although ISG15 transcripts are present in great
abundance, an accumulation of mutations was not observed in ISG15 in this
model even at 500 mg/kg dosing. These data also support previous studies using RNAseq to
demonstrate that the model coronavirusMHV displayed increased mutation frequencies
following NHC treatment in vitro (). With regard to nucleic acid specificity, ribonucleotides are
efficiently removed from eukaryotic cell DNA; therefore, treating a viral infection with a
mutagenic ribonucleoside analog should show a selectivity for incorporation into the viral
genome and not be efficient at being incorporated into and inducing mutations into host cell
DNA (). All together, these data
strongly support the notion that EIDD-2801 and its active nucleoside analog NHC exert their
antiviral effect through the induction of error catastrophe in the targeted virus. While our
data suggest that the MERS-CoV nsp14 proofreading activity appeared ineffective against NHC
in vitro and EIDD-2801 in vivo, future studies should investigate the antiviral activity of
NHC in the presence or absence of the nsp14 proofreading activity, as loss of this activity
increased the sensitivity of MHV and SARS-CoV replication to RDV treatment ().Together, our data support the continued development of EIDD-2801 as a potent broad
spectrum antiviral that could be useful in treating contemporary, newly emerged and emerging
coronavirus infections of the future.
Materials and Methods
Study Design
The primary goal of this study was to determine the antiviral activity of the nucleoside
analog NHC (EIDD-1931) against multiple emerging CoV in vitro and antiviral efficacy of
its prodrug, EIDD-2801, in mouse models of CoV pathogenesis. Coupling cell lines and
primary HAE cell cultures, we evaluated the antiviral activity of NHC against the three
most recently emerged humanCoV: SARS-CoV, MERS-CoV, and SARS-CoV-2. For both SARS-CoV and
MERS-CoV, the data presented for HAE studies are representative of those from 2-3 separate
human donors. For SARS-CoV-2, the HAE were from a single human donor. We evaluated drug
cytotoxicity in both Calu-3 2B4 and HAE cell cultures. Calu-3 and the SARS-CoV and
MERS-CoV HAE studies were performed in biological triplicate. HAE studies with SARS-CoV-2
and the SARS- and MERS-like bat CoV were performed with two wells per condition. Drug
effects were measured relative to vehicle controls in vitro and comparisons in vivo were
performed to vehicle controls. We also aimed to determine the antiviral efficacy of
EIDD-2801 in mouse models of CoV pathogenesis. These studies were intended to provide the
preclinical data to justify nonhuman primate studies and human clinical trials. Mice were
age- and sex-matched and randomly assigned into groups before infection and treatment.
Pathology was scored blinded by a board-certified veterinary pathologist. Primary data for
all studies are provided in data file S1.
Ethics regulation of laboratory animals
Efficacy studies were performed in animal biosafety level 3 facilities at UNC Chapel
Hill. All work was conducted under protocols approved by the Institutional Animal Care and
Use Committee at UNC Chapel Hill (IACUC protocol #16-284) according to guidelines set by
the Association for the Assessment and Accreditation of Laboratory Animal Care and the
U.S. Department of Agriculture.
Compounds
The parental compound β−D−N4-hydroxycytidine (NHC, all in
vitro studies) and its prodrug EIDD-2801 (all in vivo studies) was supplied by Emory
University Institute for Drug Discovery (EIDD). NHC was supplied as a 10 mM stock in DMSO
and EIDD-2801 as a solid and solubilized in vehicle containing 10% PEG400, 2.5% Cremophor
RH40 in water (10/2.5/87.5%, all v/v) prior to use. RDV was solubilized in 100% DMSO and
provided by Gilead Sciences, Inc as previously described (, ).
Cell cultures
At UNC, the human lung epithelial cell line Calu-3 2B4 cells was maintained in
Dulbecco’s modified Eagle’s medium (DMEM, Gibco), 20% fetal bovine serum
(Hyclone) and 1x antibiotic/antimycotic (Gibco). At Vanderbilt University Medical Center
(VUMC), Calu-3 2B4 were propagated in DMEM supplemented with 20% FBS (Gibco), 100 U/ml
penicillin and streptomycin (Gibco), and 0.25 μM amphotericin B (Corning). At VUMC,
VeroE6 cells were cultured in DMEM supplemented with 10% FBS (Gibco), 100 U/ml penicillin
and streptomycin (Gibco), and 0.25 μM amphotericin B (Corning). At UNC, VeroE6
cells were cultured in DMEM supplemented with 10% Fetal Clone II (Hyclone) and 1x
antibiotic/antimycotic (Gibco). Murine delayed brain tumor (DBT) cells were maintained in
DMEM supplemented with 10% FBS (Gibco), 100 U/ml penicillin and streptomycin (Gibco), and
0.25 μM amphotericin B (Corning). Primary human airway epithelial (HAE) cell
cultures were obtained from the Tissue Procurement and Cell Culture Core Laboratory in the
Marsico Lung Institute/Cystic Fibrosis Research Center at UNC and are described more
thoroughly below ().
Virus strains
Except for SARS-CoV-2, all viruses used for these studies were derived from infectious
clones and isolated as previously described (). SARS-CoV-2 clinical isolate was obtained at VUMC and UNC
from the CDC (2019-nCoV/USA-WA1/2020 strain, GenBank accession no. MN985325.1) and
passaged twice in Vero E6 cells at each respective institution to create a passage 5
working stock (). Virus strains
for in vitro experiments include SARS-CoV expressing the green fluorescent protein (GFP)
in place of open reading frames 7a/b (ORF7a/b, SARS-GFP)(), bat-spike receptor binding domain (Bat-SRBD)(), a chimeric CoV strain derived
from the HKU3 SARS-like bat coronavirus genomic sequence that has the wild type (Urbani
SARS-CoV strain) RBD in the HKU3 spike gene to allow for virus replication in non-human
primate cell lines and HAE cultures, SHC014 SARS-like bat coronavirus (), MERS-CoV expressing
nanoluciferase in the place of ORF3 (MERS-nLUC)(), and MERS-CoV expressing the red fluorescent protein gene
in the place of ORF 5 (RFP, MERS-RFP)(). The virus stock utilized for MERS-CoV in vivo studies was
derived from a plaque-purified isolate of the mouse-adapted MERS-CoV p35C4 strain (). The virus stock utilized for
SARS-CoV in vivo studies was derived from the infectious clone of the mouse-adapted
SARS-CoVMA15 (MA15) strain ().
All work with MHV was performed using the recombinant WT strain MHV-A59 (GenBank accession
no. AY910861)().
In vitro antiviral activity experiments
MERS-CoVnLUC in Calu-3: At 48 hours prior to infection,
Calu-3 2B4 cells were plated in a 96-well black-walled clear bottom plate at
5x104 cells/well. A 10 mM stock of NHC was serially diluted in 100% DMSO in
3-fold increments to obtain a ten-point dilution series. MERS-nLUC was diluted in DMEM
supplemented with 10% FBS, and 1% Antibiotic-Antimycotic to achieve a multiplicity of
infection (MOI) of 0.08. Cells were infected and concurrently treated with NHC in
triplicate per drug dilution for 1hr, after which viral inoculum was aspirated, cultures
were rinsed once and fresh medium containing drug or vehicle was added. At 48 hours post
infection, nanoluciferase expression as a surrogate for virus replication was quantitated
on a Spectramax plate reader (Molecular Devices) according to the manufacturer’s
instructions (Promega, NanoGlo). For the 100% inhibition control, diluted MERS-nLUC was
exposed to short-wave UV light (UVP, LLC) for 6 min to inhibit the ability of the virus to
replicate. For the 0% inhibition control, cells were infected in the presence of vehicle
only. DMSO was kept constant in all conditions at 0.05%. Values from triplicate wells per
condition were averaged and compared to controls to generate a percent inhibition value
for each drug dilution. The IC50 value was defined as the concentration at
which there was a 50% decrease in luciferase expression. Data were analyzed using GraphPad
Prism 8.0. The IC50 values were calculated by non-linear regression analysis
using the dose-response (variable slope) equation (four parameter logistic equation): Y =
Bottom + (Top-Bottom)/(1+10^((LogIC50-X)*HillSlope)). To measure cell viability to
determine if there was any NHC-induced cytotoxicity, Calu-3 2B4 cells were plated and
treated with NHC only as described above. Cells were exposed to the same ten-point
dilution series created for the in vitro efficacy studies. As above, 0.05% DMSO-treated
cells served as the 0% cytotoxicity control. Wells without cells served as the 100%
cytotoxic positive control. After 48 hours, cell viability was measured on a Spectramax
(Molecular Devices) via Cell-Titer Glo Assay (Promega) according to the
manufacturer’s protocol. Similar data were obtained in three independent
experiments.SARS-CoV-2 in Calu-3:Calu-3 2B4 cells were
adsorbed with MOI 0.1 PFU/cell of SARS-CoV-2 (2019-nCoV/USA-WA1/2020 strain) at
37°C. Plates were manually rocked every 10 min to redistribute the inoculum. After
30 min, virus inoculum was removed, cells were washed with Phosphate buffered saline (PBS)
once to remove unbound virus, medium containing NHC or vehicle control (DMSO) was added
back onto the cells, and cells were incubated for 72 hours at 37°C.SARS-CoV-2 in Vero E6: Vero E6 cells were plated at 20,000 cells/well in
a 96-well plate. 24hr later, medium containing a dose response of NHC was added concurrent
with SARS-CoV-2 (2019-nCoV/USA-WA1/2020 strain) at an MOI of 0.05. 48 hours post
infection, cell viability was measured by CellTiter Glo assay.SARS-CoV, MERS-CoV, and SARS-CoV-2 in HAE: Human tracheobronchial
epithelial cells provided by Dr. Scott Randell were obtained from airway specimens
resected from patientsundergoing surgery under University of North Carolina Institutional
Review Board-approved protocols (#03-1396) by the Cystic Fibrosis Center Tissue Culture
Core. Primary cells were expanded to generate passage 1 cells and passage 2 cells were
plated at a density of 250,000 cells per well on Transwell-COL (12mm diameter) supports
(Corning). Human airway epithelium cultures (HAE) were generated by provision of an
air-liquid interface for 6 to 8 weeks to form well-differentiated, polarized cultures that
resembled in vivo pseudostratified mucociliary epithelium ().· At 48 hours prior to infection the apical
surface of the culture was washed with 500 μL PBS for 1.5 hours at 37°C and
the cultures moved into fresh air liquid interface (ALI) media. Immediately prior to
infection, apical surfaces were washed twice to remove accumulated mucus with 500
μL of PBS with each wash lasting 30 min at 37°C and HAE cultures were moved
into ALI media containing various concentrations of NHC ranging from 10 μM to
0.0016 μM as indicated for each experiment (final % DMSO < 0.05%). Upon removing
the second PBS wash, 200 μL of viral inoculum (SARS-GFP, MERS-RFP or
2019-nCoV/USA-WA1/2020 strain) at an MOI of 0.5 was added to the apical surface and HAE
cultures were incubated for 2 hours at 37°C. Viral inoculum was then removed, and
the apical surface of the cultures were washed three times with 500μL PBS and then
incubated at 37°C until 48 hours post infection (hpi). For all HAE cultures,
infectious virus produced was collected by washing the apical surface of the culture with
100 μL PBS. Apical washes were stored at -80°C until analysis and titered by
plaque assay as previously described ().
qRT-PCR approach to assess cytotoxicity
Total RNA was isolated using the Zymo Direct-zol RNA MiniPrep Kit (Zymo Research Corp.)
according to the manufacturer’s directions. Cells were treated with 1μM
staurosporine (Sigma-Aldrich) as a positive control. First-strand cDNA was generated using
Superscript III reverse transcriptase (Life Technologies). For quantification of cellular
markers of toxicity/apoptosis, real-time PCR was performed using commercially validated
TaqMan-based primer-probe sets (table S1) and TaqMan Universal PCR Mix (Life
Technologies). Results were then normalized as described above.
MERS-CoV genomic RNA qRT-PCR
Mouse lungs were stored in RNAlater (ThermoFisher) at -80°C until processed via
homogenization in TRIzol (Invitrogen). Total RNA was isolated using Direct-zol RNA
MiniPrep kit (Zymo Research). Previously published TaqMan primers were synthesized by
Integrated DNA Technologies (IDT) to quantify MERS genomic RNA (targeting orf1a: Forward:
5′- GCACATCTGTGGTTCTCCTCTCT-3′, Probe (6-FAM/ZEN/IBFQ): 5′-
TGCTCCAACAGTTACAC-3′, Reverse: 5′-AAGCCCAGGCCCTACTATTAGC)(). qRT-PCR was performed using 100ng
total RNA compared to an RNA standard curve using TaqMan Fast Virus 1-Step Master Mix
(ThermoFisher) on a Quant Studio 3 (Applied Biosystems).
Quantification of SARS-CoV-2 viral RNA genome copy number by qRT-PCR
Cell supernatants were harvested inTRIzol LS reagent (Invitrogen), and RNA was purified
following phase separation by chloroform as recommended by the manufacturer. The RNA in
the aqueous phase was collected and further purified using PureLink RNA Mini Kits
(Invitrogen) according to the manufacturer’s protocol. Viral RNA was quantified
using one-step quantitative reverse transcription PCR (qRT-PCR) on a StepOnePlus Real-Time
PCR system (Applied Biosystems) by TaqMan Fast Virus 1-Step Master Mix chemistry (Applied
Biosystems). SARS-CoV-2N gene RNA was amplified using forward
(5′-GACCCCAAAATCAGCGAAAT) and reverse (5′-TCTGGTTACTGCCAGTTGAATCTG) primers
and probe (5′- FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1) designed by the United States
Centers for Disease Control and Prevention (oligonucleotides produced by IDT, cat#
10006606). Copy numbers were interpolated from a standard curve produced with dilutions of
N gene RNA. Briefly, SARS-CoV-2-N positive control plasmid DNA (IDT, cat# 10006625) was
amplified using forward (5′-TAATACGACTCACTATAGGGATGTCTGATAATGGACCCCA) and reverse
(5′- TTAGGCCTGAGTTGAGTCAG) primers, resulting in a 1280 nucleotide fragment
containing a T7 promoter. The PCR product was purified by column (Promega) and in vitro
transcribed using the mMESSAGE mMACHINE T7 Transcription Kit (Invitrogen) according to the
manufacturer’s protocol. Transcribed RNA was purified using RNeasy mini kit
(Qiagen) according to the manufacturer’s protocol, and serial 10-fold dilutions
were quantified as described above.
Primer ID and deep sequencing
Primer ID NGS is designed to specifically identify and remove RT-PCR mutations, while
facilitating highly accurate sequence determination of single RNA molecules, because each
cDNA is created with a barcoded degenerate primer (N10, 410 combinations) from
which Illumina indexed libraries are made. We used a multiplexed Primer ID library prep
approach and MiSeq sequencing to investigate the presence of mutations in the viral
genomes and murine mRNA. We designed cDNA primers targeting multiple regions on the viral
genome and murine mRNA, each with a block of random nucleotides (11 bp long) as the Primer
ID (, ) (table S2). Viral RNA
was extracted using QIAamp viral RNA kit. A pre-amplification titration of templates was
performed to estimate the amount of template to use. We used SuperScript III to make cDNA
with multiplexed cDNA primers based on the regions to be sequenced. We used 41R_PID11 for
the pilot sequencing and titration determination. For the MERS-CoV sequencing, we
multiplexed nsp10_PID11, nsp12_PID11 and nsp14_PID11 for the cDNA reaction; for the murine
mRNA sequencing, we used mixed primers of nsp10_PID11, ifit3_PID11, isg15_PID11. After
bead purification, we amplified the cDNA with a mixture of forward primers (based on the
described schemes) and a universal reverse primer, followed by another round of PCR to
incorporate Illumina sequencing adaptors and barcodes in the amplicons. After
gel-purification and quantification, we pooled 24 libraries for MiSeq 300 base paired-end
sequencing. The TCS pipeline version 1.38 (https://github.com/SwanstromLab/PID) was used to process the Primer ID
sequencing data and construct template consensus sequences (TCSs) to represent each
individual input templates, and the sequences of each region in the pool was
de-multiplexed. The RUBY package viral_seq version 1.0.6 (https://rubygems.org/gems/viral_seq) was used to calculate the mutation rate
at each position. NCBI SRA Accession numbers for sequence data are as follows: PRJNA613261
(Fig. 5) and PRJNA613454 (Fig. 7).
In vivo experiments
We performed 4 mouse studies to evaluate the in vivo efficacy of the NHC prodrug
(EIDD-2801). First, we performed prophylactic dose escalation studies for both SARS- and
MERS-CoV to determine the most efficacious dose of EIDD-2801 per virus. For SARS-CoV, in
cohorts of equivalent numbers of male and female 20-29 week old SPF C57BL/6J (Stock 000664
Jackson Labs) mice (n = 10/dose group), we administered vehicle (10% PEG, 2.5% Cremophor
RH40 in water) or 50, 150 or 500 mg/kg EIDD-2801 by oral gavage 2 hours prior to
intranasal infection with 1E+04 PFUmouse-adapted SARS-CoV strain MA15 in 50μl.
Mice were anaesthetized with a mixture of ketamine/xylazine prior to intranasal infection.
Vehicle or drug was administered every 12hr for the remainder of the study. Body weight
and pulmonary function by whole body plethysmography were measured daily. On 5 dpi,
animals were sacrificed by isofluraneoverdose, lungs were scored for lung hemorrhage, and
the inferior right lobe was frozen at −80°C for viral titration via plaque
assay. Briefly, 500,000 Vero E6 cells/well were seeded in 6-well plates. The following
day, medium was removed and serial dilutions of clarified lung homogenate were added per
plate (10−1 to 10−6 dilutions) and incubated at
37°C for 1hr after which wells were overlaid with 1X DMEM, 5% Fetal Clone 2 serum,
1X antibiotic/antimycotic, 0.8% agarose. Two days after, plaques were enumerated to
generate a plaque/ml value. Lung hemorrhage is a gross pathological phenotype readily
observed by the naked eye driven by the degree of virus replication where the coloration
of the lung changes from pink to dark red (, ). The large left lobe was placed in 10% buffered formalin
and stored at 4°C for 1-3 weeks until histological sectioning and analysis. For
MERS-CoV, the prophylactic dose escalation studies we performed similarly as done for
SARS-CoV with our recently developed a mouse model for MERS-CoV, which has a humanized
DPP4 receptor (hDPP4) (). We
performed all in vivo studies with EIDD-2801 in equivalent numbers of 10-14 week old
female and male C57BL/6J hDPP4mice. Second, we intranasally infectedmice with 5E+04 PFUmouse-adapted MERS-CoV strain M35C4 in 50μl. Third, to titer lungs by plaque assay,
Vero CCL81 cells were used and plaques were enumerated 3 dpi.To determine the time at which therapeutic administration of EIDD-2801 would fail to
improve outcomes with SARS-CoV or MERS-CoV infection, we performed therapeutic efficacy
studies in mice where we initiated treatment 2 hours prior to infection or 12, 24 or 48
hours after infection. As 500 mg/kg provided the most complete protection from disease in
prophylactic SARS-CoV studies, this dose was used for both therapeutic efficacy studies.
Vehicle or EIDD-2801 was given via oral gavage twice daily following initiation of
treatment. For both SARS-CoV and MERS-CoV, the infectious dose for the therapeutic studies
and the mouse strains were the same as that used in the prophylactic studies. The numbers
of mice per group for the SARS-CoV studies were as follows: Vehicle (n = 10), -2 hours (n
= 10), +12 hours (n = 10), +24 hours (n = 10), +48 hours (n = 10). The numbers of mice per
group for the MERS-CoV therapeutic studies were as follows: Vehicle (n = 9), -2 hours (n =
9), +12 hours (n = 9), +24 hours (n = 7), +48 hours (n = 10). As described above, each day
mouse body weight and pulmonary function were quantitated. On 5 dpi for SARS-CoV and 6 dpi
for MERS-CoV, animals were humanely sacrificed and tissues were harvested and analyzed as
described above. In addition, for the MERS-CoV study, lung tissue was harvested and stored
in RNAlater (Thermo Fisher) at -80°C and then thawed, homogenized in Trizol reagent
(Invitrogen) and total RNA was isolated using a Direct-zol RNA MiniPrep kit (Zymo
Research). This total RNA was then used for Primer ID and qRT-PCR.
Whole body plethysmography
Pulmonary function was monitored once daily via whole-body plethysmography (Buxco
Respiratory Solutions, DSI Inc.). Mice intended for this analysis were randomly chosen
prior to the initiation of the study. Briefly, after a 30-min acclimation time in the
plethysmograph, data for 11 parameters was recorded every 2 s for 5 min.
Acute lung injury histological assessment tools
Two different and complementary quantitative histologic tools were used to determine if
antiviral treatments diminished the histopathologic features associated with lung injury.
Both analyses and scoring were performed by a Board Certified Veterinary Pathologist who
was blinded to the treatment groups.American Thoracic Society lung injury scoring tool. In order to help
quantitate histological features of ALI observed in mouse models and increase their
translation to the human condition, we used the ATS scoring tool (). In a blinded manner, we chose three random
diseased fields of lung tissue at high power (60 ×), which were scored for the
following: (A) neutrophils in the alveolar space (none = 0, 1–5 cells = 1, > 5
cells = 2), (B) neutrophils in the interstitial space/ septae (none = 0, 1–5 cells
= 1, > 5 cells = 2), (C) hyaline membranes (none = 0, one membrane = 1, > 1 membrane
= 2), (D) Proteinaceous debris in air spaces (none = 0, one instance = 1, > 1 instance
= 2), (E) alveolar septal thickening (< 2× mock thickness = 0,
2–4× mock thickness = 1, > 4× mock thickness = 2). To obtain a
lung injury score per field, the scores for A–E were then put into the following
formula, which contains multipliers that assign varying levels of importance for each
phenotype of the disease state.: score = [(20x A) + (14 x B) + (7 x C) + (7 x D) + (2 x
E)]/100. The scores for the three fields per mouse were averaged to obtain a final score
ranging from 0 to and including 1.Diffuse Alveolar Damage (DAD) tool. The second histological tool to
quantitate lung injury was reported by Schmidt et al.(). DAD is the pathological hallmark
of ALI (, ). Three random diseased fields of
lung tissue were scored at high power (60 ×) for the following in a blinded manner:
1 = absence of cellular sloughing and necrosis, 2 = Uncommon solitary cell sloughing and
necrosis (1–2 foci/field), 3 = multifocal (3 + foci) cellular sloughing and
necrosis with uncommon septal wall hyalinization, or 4 = multifocal (>75% of field)
cellular sloughing and necrosis with common and/or prominent hyaline membranes. The scores
for the three fields per mouse were averaged to get a final DAD score per mouse.
nsp12 phylogenetic analysis and conservation modeling
CoronavirusRdRp (nsp12) protein sequence alignments and phylogenetic trees were
generated using Geneious Tree Builder in Geneious Prime (version 2020.0.5) and visualized
using Evolview (https://www.evolgenius.info/evolview/). Protein similarity scores were
calculated using Blosom62 matrix. The accession numbers used were: PDCoV (KR265858), AIBV
(NC_001451), HCoV-229E (JX503060), PEDV (NC_003436), MHV (AY700211), HCoV-HKU1 (DQ415904),
HCoV-NL63 (JX504050), HCOV-OC43 (AY903460), HKU5-1 (NC_009020), MERS-CoV (JX869059),
HKU9-4 (EF065516), 2019-nCoV (MN996528), HKU3-1 (DQ022305), SHC014 (KC881005), WIV1
(KF367457), SARS-CoV (AY278741). Amino acid conservation scores of coronavirusRdRp were
generated using ConSurf Server (https://consurf.tau.ac.il/) using the
protein alignment described above and visualized on the SARS-CoVRdRp structure (PDB:
6NUR) in PyMol (version 1.8.6.0)(, ).
Statistical analysis
All statistical data analyses were performed in Graphpad Prism 8. Statistical
significance for each endpoint was determined with specific statistical tests. In general,
for metrics with multiple treatment groups with longitudinal data (e.g., mouseweight loss
or pulmonary function over time), two-way ANOVA was performed with the suggested multiple
comparison test as advised by Prism. For comparative data with for a single timepoint
(e.g., lung titer) Kruskal-Wallis or one-way ANOVA was performed with the suggested
multiple comparison test. For each test, a p-value <0.05 was considered significant.
Specific tests are noted in each figure legend.
Authors: Jeong-Joong Yoon; Mart Toots; Sujin Lee; Myung-Eun Lee; Barbara Ludeke; Jasmina M Luczo; Ketaki Ganti; Robert M Cox; Zachary M Sticher; Vindya Edpuganti; Deborah G Mitchell; Mark A Lockwood; Alexander A Kolykhalov; Alexander L Greninger; Martin L Moore; George R Painter; Anice C Lowen; Stephen M Tompkins; Rachel Fearns; Michael G Natchus; Richard K Plemper Journal: Antimicrob Agents Chemother Date: 2018-07-27 Impact factor: 5.191
Authors: Roman Wölfel; Victor M Corman; Wolfgang Guggemos; Michael Seilmaier; Sabine Zange; Marcel A Müller; Daniela Niemeyer; Terry C Jones; Patrick Vollmar; Camilla Rothe; Michael Hoelscher; Tobias Bleicker; Sebastian Brünink; Julia Schneider; Rosina Ehmann; Katrin Zwirglmaier; Christian Drosten; Clemens Wendtner Journal: Nature Date: 2020-04-01 Impact factor: 49.962
Authors: Adam S Cockrell; Boyd L Yount; Trevor Scobey; Kara Jensen; Madeline Douglas; Anne Beall; Xian-Chun Tang; Wayne A Marasco; Mark T Heise; Ralph S Baric Journal: Nat Microbiol Date: 2016-11-28 Impact factor: 17.745
Authors: Michael K Lo; Robert Jordan; Aaron Arvey; Jawahar Sudhamsu; Punya Shrivastava-Ranjan; Anne L Hotard; Mike Flint; Laura K McMullan; Dustin Siegel; Michael O Clarke; Richard L Mackman; Hon C Hui; Michel Perron; Adrian S Ray; Tomas Cihlar; Stuart T Nichol; Christina F Spiropoulou Journal: Sci Rep Date: 2017-03-06 Impact factor: 4.379
Authors: Lewis J Kaplan; Thomas P Bleck; Timothy G Buchman; R Phillip Dellinger; Clifford S Deutschman; John C Marshall; David M Maslove; Henry Masur; Margaret M Parker; Donald S Prough; Aarti Sarwal; Jonathan E Sevransky; Jean-Louis Vincent; Jerry J Zimmerman Journal: Crit Care Med Date: 2020-06-11 Impact factor: 7.598