| Literature DB >> 32244524 |
Ricardo Soares1,2, Jesús Trejo1, Maria J Lorite3, Etelvina Figueira4, Juan Sanjuán3, Isabel Videira E Castro1.
Abstract
Lotus spp. are widely used as a forage to improve pastures, and inoculation with elite rhizobial strains is a common practice in many countries. However, only a few Lotus species have been studied in the context of plant-rhizobia interactions. In this study, forty highly diverse bacterial strains were isolated from root nodules of wild Lotus parviflorus plants growing in two field locations in Portugal. However, only 10% of these isolates could nodulate one or more legume hosts tested, whereas 90% were thought to be opportunistic nodule associated bacteria. Phylogenetic studies place the nodulating isolates within theEntities:
Keywords: Bradyrhizobium; Lotus parviflorus; diversity; endophytes; plant growth promoting rhizobacteria (PGPR); rhizobia
Year: 2020 PMID: 32244524 PMCID: PMC7232477 DOI: 10.3390/microorganisms8040499
Source DB: PubMed Journal: Microorganisms ISSN: 2076-2607
Figure 1Map location of the sampling sites (A and B).
Newly designed primers for PCR and sequencing.
| Primer | Gene | Position * | Direction | Length | Sequence (5′–3′) |
|---|---|---|---|---|---|
| recA107 | 107 | Forward | 23 bp | TTAGGTGATACTGCCRTBGARCC | |
| recA593 | 593 | Reverse | 24 bp | GGGTTWCCGAACATTACRCCRATT | |
| atpD183 | 183 | Forward | 24 bp | CGTGTTCGTRCHATTGCBATGGAY | |
| atpD872 | 872 | Reverse | 20 bp | GGCATACGGCCCAGCAGTGC | |
| atpD133 | 133 | Forward | 23 bp | GACCCTGGAAGTTCAGCAGCAGC | |
| atpD762 | 762 | Reverse | 20 bp | GGCATACGGCCCAGCAGTGC | |
| 16SIR | 16SrRNA | 875 | Reverse | 21 bp | AAACACATGCTCCACCGCTTG |
* Position relative to the start of recA gene of Sphingobacterium spiritivorum ATCC 33861 (ACHA02000002.1; recA primers); relative to the start of atpD gene of Sphingobacterium spiritivorum ATCC 33861 (ACHA02000004.1; atpD183 and atpD872), or Pseudomonas fluorescens Pf0-1 (CP000094.2; atpD133 and atpD762). Position relative to the start of 16S rRNA gene of Rhizobium leguminosarum bv. trifolii WSM1689 (NZ_CP007045.1).
Congo red absorption and growth speed of bacteria isolated from L. parviflorus nodules.
| Isolates | Congo Red Absorption | Growing Velocity | |
|---|---|---|---|
| Sample Spot A | LpA5a, LpA6, LpA8, LpA9, LpA12, LpA13b, LpA14, LpA5b | − | Fast |
| LpA7a, LpA7b, LpA10, LpA13a | + | Moderate | |
| LpA11 | − | Slow | |
| Sample Spot B | LpB5b, LpB5c, LpB5e, LpB5f, LpB5g, LpB12a, LpB16a, LpB16b, LpB16c, LpB16d | − | Very fast |
| LpB10d | + | ||
| LpB9a, LpB9b, LpB12b, LpB13, LpB14a, LpB14b, LpB15b¸ LpB17b | − | Fast | |
| LpB5d, LpB10a LpB10b | + | ||
| LpB19a, LpB23b, LpB26 | − | Slow | |
| LpB10c, LpB23a | + |
Very fast: colonies visible within 24 h; Fast: colonies visible within 1–2 days; Moderate: colonies visible within 3–4 days; Slow: colonies visible within 5–8 days.
Figure 2Phylogeny of 16S rRNA based on 920 positions. Analyses were conducted with IQ-tree using Maximum Likelihood (ML) and ModelFinder (Best model: TIM3+F+I+G4) methods. Confidence levels of bootstrap are presented in red near each node. NCBI Genebank accession codes are presented next to each strain. Acidobacterium capsulatum 1372T (D26171.1), a bacterium from the Acidobacteria phylum, was selected as an outgroup. Isolates obtained from L. parviflorus nodules are in bold.
Host range assays performed in different legume host plants inoculated with the different bacterial isolates.
| Isolates | Symbiotic Phenotype | ||||||
|---|---|---|---|---|---|---|---|
|
|
| ||||||
| Lc | Lt P | Lt E | Lu | Lp | Ll | Gm | |
| LpA11 | Fix− | Nod− | Fix− | Fix+ | Fix+ | Fix+ | Nod- |
| LpB19a, LpB23b, LpB26 | Fix− | Fix− | NT | Fix+ | Fix+ | Fix+ | Nod- |
| LpA5a, LpA5b, LpA6, LpA7a, LpA7b, LpA8, LpA9, LpA10, LpA12, LpA13a, LpA13b, LpA14 | Nod− | Nod− | Nod− | Nod− | Nod− | NT | NT |
| LpB5b, LpB5c, LpB5d, LpB5e, LpB5f, LpB5g, LpB9a, LpB9b, LpB10a, LpB10b, LpB10c, LpB10d, LpB12a, LpB12b, LpB13, LpB14a, LpB14b, LpB15b, LpB16a, LpB16b, LpB16c, LpB16d, LpB17b, LpB23a | Nod− | Nod− | NT | Nod− | Nod− | NT | NT |
Lc: L. corniculatus cv. San Gabriel; LtP: Lotus tenuis cv. Inta PAMPA; Lt E: Lotus tenuis cv. Esmeralda; Lu: L. uliginosus cv. Sunrise; Lp: L. parviflorus; Ll: Lupinus luteus; Gm: Glycine max. NT: Not tested; Nod−: lack of nodulation; Fix−: Nodulation occurred, but no nitrogen fixation; Fix+: Partially efficient nitrogen fixation; Fix+: Efficient nitrogen fixation.
Figure 3Phylogeny of concatenated sequences of glnII (300 nt), atpD (328 nt), and recA (333 nt) genes, based on a total of 968 nt. Bootstrap values are shown in red at each node. Analyses were conducted with IQ-tree using Maximum Likelihood (ML) and ModelFinder (Best model: TIM+F+I+G4) methods. NCBI Genebank accession codes are shown. Sinorhizobium meliloti USDA 1002T (DQ767676.1; AJ294400.1; AJ294382.1) was selected as an outgroup. Isolates obtained from L. parviflorus nodules are in bold.
Figure 4Phylogenetic tree of nodC gene sequences. Analyses were conducted with IQ-tree using Maximum Likelihood (ML) and ModelFinder (Best model: HKY+F+G4) methods), for a total of 203 positions. Bootstrap values are shown in red at each node. NCBI Genebank accession codes and original legume host of isolation are indicated. Burkholderia tuberum STM678T (AJ306730.1), a bacterium from the beta-proteobacteria class that nodulates Aspalathus carnosa, was selected as an outgroup. Lotus spp. and isolates obtained from L. parviflorus nodules are in bold.
Figure 5Phylogenetic tree of nifH gene sequences. Analyses were conducted with IQ-tree using Maximum Likelihood (ML) and ModelFinder (Best model: K2P+G4) methods), for a total of 203 positions. Bootstrap values are shown at each node. NCBI Genebank accession codes and original legume host of isolation are indicated. Burkholderia tuberum STM678T (AJ302315.1), a bacterium from the beta-proteobacteria class that nodulates Aspalathus carnosa, was selected as an outgroup. Lotus spp. and isolates obtained from L. parviflorus nodules are in bold.
Plant growth promotion (PGP) traits: Phosphate solubilization, siderophore production, antagonistic activity against phytophatogens, and lytic enzymes production. Only isolates that showed at least one activity assayed are presented, even though all isolates were tested.
| Isolates | P sol | Sid Production | Antagonistic Activity | Lytic Enzymes Production | |||
|---|---|---|---|---|---|---|---|
|
|
| Cel | Pect | ||||
| LpB16d | + | − | + | + | + | − | |
| LpA7a, LpA7b, LpB16a, LpB16b | − | − | + | + | + | − | |
| LpB23a | − | − | − | + | + | + | |
| LpB9b | − | − | − | − | + | + | |
| LpB5b, | − | + | − | − | + | − | |
| LpB12b, LpB10b, LpB5f | − | − | − | − | + | − | |
| LpA6, LpB12a, LpB5c | − | + | − | − | − | − | |
| LpB5e | − | − | − | − | − | − | |
P sol: Phosphate solubilization; Sid production: Siderophore production; cel: Cellulase activity; Pect: Pectinase activity.