KCTD12 promotes G1/S transition of breast cancer cell through activating the AKT/FOXO1 signaling.

BACKGROUND: Sustaining proliferation is the most fundamental step for breast cancer tumor genesis. Accelerated proliferation is usually linked to the uncontrolled cell cycle. However, the internal and external factors linked to the activation of breast cancer cell cycle are still to be investigated.
METHODS: quantitative PCR (qPCR) and Western blotting assay were used to detect the expression of potassium channel tetramerization domain containing 12 (KCTD12) in breast cancer. MTT and colony formation assays were performed to evaluate the effect of KCTD12 on cell proliferation of breast cancer. Anchorage-independent growth assay was used to examine the in vitro tumorigenesis of breast cancer cells. Flow cytometry assay, qPCR, and Western blotting were used to investigate the detailed mechanisms of KCTD12 on breast cancer progression.
RESULTS: Herein, the result showed that the level of KCTD12 is significantly decreased in breast cancer tissues and cells, and lower level of KCTD12 predicts poorer survival for patients with breast cancer. Further cell function tests illustrated that downregulation of KCTD12 significantly promotes cell proliferation and in vitro tumor genesis. Besides, molecular biologic experiments showed that downregulation of KCTD12 can enhance the G1/S transition through activating the AKT/FOXO1 signaling.
CONCLUSION: Our study inferred that downregulation of KCTD12 can be a novel factor for poor prognosis in breast cancer.

American Type Culture Collection

Bric‐a‐brac, Tram‐track, Broad complex poxvirus zinc finger

cyclin‐dependent kinase

CDK inhibitors

Dulbecco's modified eagle medium

dimethyl sulfoxide

fatal bovine serum

GABAB receptors

potassium channel tetramerization domain containing 12

phosphorylation of AKT

phosphorylation of FOXO1

phosphorylated Rb

quantitative PCR

phosphorylate retinoblastoma

The Cancer Genome Atlas

INTRODUCTION

Breast cancer is the most frequently diagnosed cancer and the leading cause related with cancer in females, with about 2.1 million new cased and 0.6 million deaths in 2018. Breast cancer has been become a threat to women's health. Over the past decades, exploring the specific etiologic factors related with breast cancer never stop. However, the underlying precise mechanisms of tumorigenesis and progression in breast cancer are still poorly known.

The tumorigenesis and progression of breast cancer are composed of multiple steps. Among them, sustaining proliferation is the most fundamental step. Accelerated proliferation is usual linked to the uncontrolled cell cycle. During cell cycle, G1/S transition, known as restriction point, is the crucial point that determines whether cells enter into proliferation. In early G1 cyclin‐dependent kinase (CDK), 4/6 is activated by cyclin D, and in late G1, CDK2 is activated by cyclin E. The cyclin‐dependent kinases in turn phosphorylate retinoblastoma (Rb), a tumor suppressor. Phosphorylated Rb (p‐Rb) leads to the dissociation of Rb from E2F, which further results in transcription of S phase genes and facilitating entry into S phase and DNA synthesis. Furthermore, during this step, cells will integrate multiple signals. If the conditions go against division, the restriction point will be activated and cell cycle is arrested. For example, the CDK inhibitors (CKIs) can combine with CDKs/cyclins complex and prevent Rb phosphorylating to halt cell cycle procession. , , The research on cell cycle is increasing in recent years. However, the internal and external factors linked to the activation of cell cycle are still to be investigated.

Potassium channel tetramerization domain containing 12 (KCTD12, also named as Pfetin), belonging to KCTD family, was originally identified in human fetal cochlea. It contains two conserved binding domains, a voltage‐gated potassium (K+) channel tetramerization T1 domain and a BTB/POZ (Bric‐a‐brac, Tram‐track, Broad complex poxvirus zinc finger) domain. Recent study demonstrated that KCTD12 is the auxiliary submit of GABAB receptors (GABABR) and can alter emotionality and neuronal excitability through GABAB receptor signaling. Not only that KCTD12 plays an important suppressive function and its high level is related with favorable prognosis in gastrointestinal stromal tumors. Abbaszadegan et al showed that KCTD12 can suppress Wnt/Notch signaling, stem cell factors, and chromatin remodelers in esophageal squamous cell carcinoma. Nonetheless, KCTD12 is dramatically upregulated and closely correlated with larger tumor sizes, higher pathologic stages, and poor survival in cervical and lung cancers. Therefore, the expression and function of KCTD12 in cancers remain controversial. And the roles of KCTD12 in breast cancer are unknown.

Herein, we found the level of KCTD12 is significantly decreased in breast cancer and cells, and lower level of KCTD12 predicts poorer survival for patients with breast cancer. Further cell function tests illustrated that downregulation of KCTD12 significantly promotes cell proliferation and in vitro tumorigenesis. Besides, molecular biologic experiments showed that downregulation of KCTD12 can enhance the G1/S transition through activating the AKT/FOXO1 signaling; especially, knockdown of FOXO1 can restore the inhibitory effect of KCTD12 on cell proliferation of breast cancer. Accordingly, we inferred that downregulation of KCTD12 can be a novel factor for poor prognosis in breast cancer.

MATERIALS AND METHODS

Patients and cell line

The tissues used in the study were gathered from The First Affiliated Hospital of Sun Yat‐sen University. Before collecting, informed consent from patients and approval from the Institutional Ethics Committee were both obtained. The normal breast cell HBL100 and breast cancer cell lines MDA‐MB‐231, MCF‐7, BT‐549, SK‐BR‐3, and T47D in the study were purchased from American Type Culture Collection (ATCC). The breast cancer cells were cultured in Dulbecco's modified eagle medium (DMEM; Invitrogen) containing 10% fatal bovine serum (FBS; HyClone).

Plasmid

Full‐length KCTD12 was amplified by PCR using the total cDNA as the template and cloned into pLVX plasmid to obtain the pLVX‐KCTD12 plasmid overexpressed KCTD12. To downregulate KCTD12, two human shRNA fragments were cloned into pLKO.1 plasmid. The fragments were as follows: sh#1, GCGCTACACCTCGCGCTATTA; sh#2, CTTCCGCTACATCCTGGATTA. psPAX2 (virus‐packaging plasmid), pMD2G (envelope plasmid), and pLVX‐KCTD12/pLKO.1‐shKCTD12 were transfected into 293T cells to produce pseudotyped lentiviral particles. 48 hours later, we harvested the particles, and then, the particles were used to infect MCF‐7 cells overnight. 48 hours after infection, the normal culture media was replaced. Stable cell lines were screened by 5 μg/mL puromycin for 7 days.

RNA extraction and quantitative PCR

Total RNA was extracted using the TRIzol reagent (Invitrogen) according to the guidance method. quantitative PCR (qPCR) was performed using ABI Prism 7500 Sequence Detection System (Applied Biosystems). The primers are as follows: KCTD12, forward, 5′‐CCGGAATTCCACCTCTCTGTCATGGCTCT‐3′ and reverse 5′‐CTGCAGAGAACTCAGCACCAAG‐3′; p21, forward 5′‐AGGTGGACCTGGAGACTCTCAG‐3′ and reverse 5′‐TCCTCTTGGAGAAGATCAGCCG‐3′; p27, forward 5′‐CGTCCTCCATAGCAGCCAAGAT‐3′ and reverse 5′‐ACCCAATGGAGCCCAGGATGAA‐3′; CCND1, forward 5′‐TCTACACCGACAACTCCATCCG‐3′ and reverse 5′‐TCTGGCATTTTGGAGAGGAAGTG‐3′; CCND2, forward 5′‐GAGAAGCTGTCTCTGATCCGCA‐3′ and reverse 5′‐CTTCCAGTTGCGATCATCGACG‐3′; CCND3, forward 5′‐AGATCAAGCCGCACATGCGGAA‐3′ and reverse 5′‐ACGCAAGACAGGTAGCGATCCA‐3′; CCNE1, forward 5′‐TGTGTCCTGGATGTTGACTGCC‐3′ and reverse 5′‐CTCTATGTCGCACCACTGATACC‐3′; CCNE2, forward 5′‐CTTACGTCACTGATGGTGCTTGC‐3′ and reverse 5′‐CTTGGAGAAAGAGATTTAGCCAGG‐3′.

Western blotting assay

The total proteins were collected using lysis buffer (Cell Signaling Technology) and then maintained on ice for 30 minutes. Before Western blotting assay, the protein was mixed with loading buffer and then boiled at 95°C for 5 minutes. The proteins were separated using SDS‐PAGE gel. The detailed protocol was in accordance with the introduction previously described.

MTT assay

The cells were seeded into 96‐well plates. At the indicated time, the cells were stained using 0.5 mg/mL MTT reagent (Sigma) for 4 hours. Subsequently, 150 μL dimethyl sulfoxide (DMSO) was added into each well. The absorbance was detected at 570 nm and 655 nm as the reference wavelength.

Colony formation and anchorage‐independent growth ability assay

5 × 102 cells were seeded into 6‐well plates. 10 days later, the colonies formed were fixed using 10% formaldehyde and then dyed using 0.1% crystal violent. Finally, the colony numbers were counted. The anchorage‐independent growth ability assay was performed according to the protocol previously described.

Flow cytometry assay

The cells were treated using 75% ethanol for 1 hour and then incubated in propidium iodide staining buffer for 10 minutes away from light. The flow cytometry assay was performed using FACSCalibur instrument (BD Biosciences). The percentages of cells distributed in different cell cycle were analyzed using CellQuest 3.3 software.

Statistical analysis

All experiments were performed three times independently. All values were analyzed using SPSS version 21.0 (SPSS) and presented as mean ± standard deviation. Statistical differences were evaluated by Student's t test, and P < .05 was considered as statistical significance.

RESULTS

KCTD12 is significantly decreased in breast cancer and negative correlated with patients’ overall survival

Through analyzing the public data from The Cancer Genome Atlas (TCGA; https://cancergenome.nih.gov/), we found the expression of KCTD12 is significantly decreased in primary breast cancer tissues (Tumor) relative to normal breast tissues (Normal) (Figure 1A). Meanwhile, we analyzed the KCTD12 in paired tissues. Compared with matched normal breast tissue, KCTD12 is significantly reduced in breast cancer tissues (Figure 1B). Furthermore, we analyzed the effect of KCTD12 on overall survival of patients with breast cancer using Kaplan‐Meier plotter datasets (www.kmplot.com). As demonstrated in Figure 1C, lower levels of KCTD12 are closely related with poorer survival.

Figure 1

KCTD12 is significantly decreased in breast cancer and inverse correlation with patients’ overall survival by analyzing available public dataset. A, KCTD12 mRNA expression is significantly decreased in breast cancer tissues compared with normal breast tissues by analyzing TCGA. B, KCTD12 mRNA expression in paired breast cancer tissues from TCGA. C, Lower levels of KCTD12 are closely related with poorer survival by analyzing Kaplan‐Meier plotter datasets

In addition, further analysis of TGCA dataset revealed that KCTD12 mRNA expression was much lower in triple‐negative breast cancer (TNBC) tissues and non‐TNBC tissues compared with normal breast tissues, but there isn't significant difference between non‐TNBC tissues and TNBC tissues (Figure 2A). Similarly, the expression of KCTD12 in all molecular subtype of breast cancer is significantly decreased compared with normal breast tissues. Especially, the levels of KCTD12 in the basal‐like subtype of breast cancer, which present similar characteristics with TNBC, are much lower than Luminal A, but not lower than Luminal B and Her2 (Figure 2B). According to the above analysis, KCTD12 does not have a significant potential effect on hormone receptor.

Figure 2

KCTD12 expression in subtype of breast cancer and breast cancer cells. A, KCTD12 expression in normal breast tissues, triple‐negative breast cancer (TNBC) tissues, and non‐TNBC tissues using data from TCGA. B, The expression of KCTD12 in different molecular subtype of breast cancer. C, KCTD12 mRNA expression in normal breast cell HBL100 and breast cancer cell lines MDA‐MB‐231, MCF‐7, BT‐549, SK‐BR‐3, and T47D, *P < .05; **P < .01; ***P < .001; ns: no significance

Subsequently, we examined the KCTD12 mRNA expression in normal breast cell HBL100 and breast cancer cell lines MDA‐MB‐231, MCF‐7, BT‐549, SK‐BR‐3, and T47D and found that KCTD12 mRNA levels is significantly decreased in breast cancer cells compared with normal breast cells. Especially, the mRNA expression of KCTD12 in MCF‐7 is medium (Figure 2C), so we choose MCF‐7 as a research subject.

Finally, we examined the mRNA and protein levels in paired fresh breast cancer tissues. The qPCR assay showed relative KCTD12 mRNA expression is significantly decreased in breast cancer tissues compared with corresponding normal breast tissues (Figure 3A). And the Western blotting assays showed the similar trend (Figure 3B).

Figure 3

KCTD12 expression is significantly decreased in fresh breast cancer tissues by quantitative PCR (A) and Western blotting assay (B)

Altogether, the expression of KCTD12 is significantly reduced in breast cancer tissues and cells, and its low level predicts poor overall survival for patients with breast cancer.

Downregulation of KCTD12 promotes breast cancer cell proliferation and in vitro tumorgenesis

Next, we investigate the function of KCTD12 on breast cancer progression. The correlation analysis between KCTD12 levels and proliferative marker Ki67 in fresh breast tissues were performed. As shown in Figure 4A, there is negative correlation between them. Subsequently, we screened the cell lines that stably overexpressed or silenced KCTD12 using breast cancer cells MCF‐7, respectively (Figure 4B). Furthermore, MTT assay showed that downregulation of KCTD12 dramatically increases, while upregulation decreases breast cancer cell proliferation (Figure 4C), which was confirmed by colony formation assay (Figure 4D). To examine the oncogenic function of KCTD12 on in vitro tumorignicity of breast cancer cells, we performed the anchorage‐independent growth ability assay. As demonstrated in Figure 4E, the colony numbers and sizes significantly increased in KCTD12‐silenced cells, while decreased in KCTD12‐upregulated cells, suggesting that KCTD12 significantly suppresses anchorage‐independent growth ability of MCF‐7 cells.

Figure 4

Downregulation of KCTD12 promotes breast cancer cell proliferation and in vitro tumorgenesis. A, There is negative correlation between KCTD12 and Ki67 by quantitative PCR assay in fresh breast cancer tissues. B, The mRNA (upper panel) and protein (lower panel) expression of KCTD12 in different stable cell lines. C, MTT assay showed that downregulation of KCTD12 promotes, while upregulation inhibits the breast cancer cell proliferation. D, Colony formation assay was performed to detect the effect of KCTD12 on breast cancer cell proliferation. E, Anchorage‐independent growth ability assay showed downregulation of KCTD12 promotes, while upregulation inhibits the in vitro tumorigenesis of breast cancer cell.*P < .05; **P < .01; ***P < .001

Altogether, downregulation of KCTD12 significantly promotes breast cancer cell proliferation and in vitro tumorigenesis.

Downregulation of KCTD12 significantly promotes the G1/S transition of breast cancer cells

We further investigate the molecular mechanisms of KCTD12 involved in breast cancer cell proliferation. Firstly, flow cytometry assay illustrated that downregulation of KCTD12 dramatically increases the cell percentage in S phase, but reduces the percentage in G0/G1 phase. Whereas, upregulation of KCTD12 showed the inverse results (Figure 5A). The abovementioned results showed that downregulation of KCTD12 markedly promotes the G1/S transition of MCF‐7 cell cycle.

Figure 5

Downregulation of KCTD12 significantly promotes the G1/S transition of breast cancer cells. A, The flow cytometry assay was used to examine the cell distribution in different cell cycle phases. B, The mRNA expression of p21, p27, CCND1, CCND2, CCND3, CCNE1, and CCNE2 in different cell lines. C, The protein expression of Cyclin D1, p27, p21, RB, p‐RB, FOXO1, p‐FOXO1, AKT, and p‐AKT in different cell lines. D, MTT assay showed that FOXO1 inhibitor can significantly restore breast cancer cell proliferation of KCTD‐upregulated cells. E, Colony formation assay showed that FOXO1 inhibitor can significantly restore breast cancer cell proliferation of KCTD‐unregulated cells. *P < .05

Moreover, we performed the genes involved in G1/S transition. As shown in Figure 4B, the mRNA expression of p21 and p27 significantly increases in KCTD12‐overexpressed cells, while reduces in KCTD12‐silenced cells. CCND1 mRNA showed the adverse variation trend. Nevertheless, there are nearly no change in the mRNA levels of CCND2, CCND3, CCNE1, and CCNE2 in different stable cell lines (Figure 5B).

Then, we detected the protein expression of p21, p27, and Cyclin D1 using Western blotting assay. As shown in Figure 5C, they showed the same variation trend as their mRNA expression. It has been documented that FOXO1 can regulate p21, p27, and Cyclin D1 at the transcription levels. , Western blotting assay showed that knockdown of KCTD12 increases and its upregulation decreases the phosphorylation of FOXO1 (p‐FOXO1). Since FOXO1 is a downstream of the AKT, the phosphorylation level of AKT was analyzed. As shown in Figure 5C, downregulation of KCTD12 increases and its upregulation decreases the phosphorylation of AKT (p‐AKT). These results showed that KCTD12 regulates the cell cycle of breast cancer cells through AKT/FOXO1 pathway.

Eventually, we used 0.1 μM FOXO1 inhibitor, AS1842856, to inhibit the expression of FOXO1 in KCTD12‐upregulated cells. MTT and colony formation assay showed that FOXO1 inhibitor can significantly restore breast cancer cell proliferation in KCTD12‐upregulated cells (Figure 5D and E), suggesting that FOXO1 plays an essential role in the antiproliferative of KCTD12.

Altogether, downregulation of KCTD12 significantly promotes G1/S transition of breast cancer cell cycle through the AKT/FOXO1 signaling.

DISCUSSION

The research presented the important evidence that downregulation of KCTD12 promotes the breast cancer cell proliferation and in vitro tumorigenesis. Our findings also showed that knockdown of KCTD12 inhibits the expression of p21 and p27, while upregulates the expression of Cyclin D1. These results provided evidence that downregulation of KCTD12 plays an indispensable function in enhancing breast cancer cell proliferation.

Uncontrolled cell proliferation is the fundamental characteristics for malignancy , and is involved in multiple alterations of genes and proteins correlated with proliferation and cell cycle. , Therefore, identifying the factors leading to promoting cell proliferation is essential to develop effective therapeutic strategy. Herein, we found that mRNA and protein levels of KCTD12 both significantly downregulate in breast cancer tissues and closely related with poor survival of patients with breast cancer. Moreover, downregulation of KCTD12 promotes breast cancer cell proliferation and in vitro tumorigenesis, which implicates that KCTD12 may be served as a suppressive protein in the progression of breast cancer.

The uncontrolled cell proliferation usually accompanies the uncontrolled cell cycle progression. One of the crucial regulations of cell cycle is the existence of checkpoints. Rb is one of the notable regulatory proteins for checkpoint and is a potent inhibitor of G1/S transition. Its activation is dependent on the CDKs/cyclins complex. , , In the present study, we found that cyclin D1 is significantly increased in KCTD12‐silenced breast cancer cell to activate the phosphorylation of Rb, which can promote G1/S transition. Moreover, the phosphorylation of Rb is relied on AKT/FOXO1 signaling. FOXO1 plays a vital role in suppressing cell proliferation via transcription regulation of several proteins such as p21, p27, and cyclin D1. It was reported that deregulation of FOXO1 has been found in multiple cancers. , , , Herein, we found that downregulation of KCTD12 can promote the phosphorylation levels of FOXO1. Nevertheless, our result showed that KCTD12 can affect cancer proliferation in breast cancer, but the direct target of KCTD12 needs our future study. The study on the effect of KCTD12 on cancer cell proliferation is little. Zong et al showed that KCTD12 can bind with CDK1 to regulate CDK1 phosphorylation and further to influence Hela cell proliferation by immunoprecipitation and mass spectrometry analysis. And whether the same fact exits in breast cancer needs more evidence.

In summary, our research KCTD12 may be a suppressive protein of breast cancer. The therapeutic use of KCTD12 needs more evidences, for example, in vivo experiments, correlation analysis between KCTD12 levels and clinical characteristics. We will perform these tests in future.

ETHICS STATEMENT

The tissues used in the study were gathered from The First Affiliated Hospital of Sun Yat‐sen University. Before collecting, informed consent from patients and approval from the Institutional Ethics Committee were both obtained. Medical research was conducted according to the World Medical Association Declaration of Helsinki.