Total flavonoids suppress lung cancer growth via the COX-2-mediated Wnt/β-catenin signaling pathway.

The aim of the present study was to explore the anti-cancer effects of total flavonoids (TF) on lung cancer and to investigate the underlying mechanism. The inhibitory effect of TF on the proliferation of A549 cells in vitro was measured using an MTT assay. The apoptotic rate of TF-treated A549 cells was analyzed using flow cytometry and terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick end labeling. Migration and invasion assays were performed to investigate the anti-migration effect of TF on A549 cells. Reverse-transcription quantitative PCR was used to analyze BCL2-like 2, BCL2, Bax, Bad, cyclooxygenase 2 (COX-2), Wnt and β-catenin mRNA expression levels in A549 cells. The in vivo anti-cancer effect of TF was investigated in a subcutaneous xenograft model of lung cancer in BALB/c nude mice. The results obtained in the present study revealed that TF exerted a significant inhibitory effect on the proliferation of A549 cells in a dose-dependent manner (P<0.01). TF induced apoptosis of A549 cells, which exhibited increased and decreased expression of pro- and anti- apoptotic genes, respectively. Furthermore, TF had a significant inhibitory effect on the migration and invasion of A549 cells (P<0.01). The mRNA expression levels of COX-2, Wnt and β-catenin were significantly downregulated in TF-treated A549 cells compared with controls. Additionally, treatment with TF inhibited tumor growth in mice, with a tumor inhibition rate of 64.07% compared with the controls. TF exhibited significant tumor inhibitory effects in vivo by promoting the apoptosis of tumor cells. In conclusion, the results suggested that TF may regulate lung cancer growth via the COX-2-Wnt/β-catenin signaling pathway. TF may serve as a novel anti-cancer agent for the treatment of lung cancer. Copyright: © Han et al.

Introduction

Non-small cell lung cancer (NSCLC) is one of the most common human cancers and is characterized by rapid growth, high metastatic potential and reoccurrence (1). Approximately 75% of patients are diagnosed with advanced stage NSCLC, which is associated with a poor 5-year survival rate of 15% (2). NSCLC includes adenocarcinoma, large cell carcinoma and squamous cell carcinoma, the latter of which is the most common type of lung cancer and accounts for approximately 80% of all lung cancer cases (3–5). A systematic review and meta-analysis have indicated the efficacy of targeted agents in the treatment of elderly patients with advanced NSCLC (6). Cancer cell migration and invasion are key events in the development, metastasis and reoccurrence of NSCLC, and previous studies have demonstrated the importance of inhibiting growth and metastasis when selecting clinical treatment regimens for NSCLC (7–9).

A previous study has shown that total flavonoids (TF) reduce the risk of developing chronic diseases, such as cancer and cardiovascular diseases (10). Currently, few studies have investigated the biological activity of TF, particularly in human cancer cells (11–13). Wang et al (14) revealed that TF extracted from Cotinus coggygria exhibit potential therapeutic effect by reducing the proliferation and inducing apoptosis by regulating the phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT)/ERK signaling pathway in glioblastoma cancer cells (14). The antitumor activity of TF isolated from Daphne genkwa has been analyzed in colorectal cancer, and revealed that the action of TF is likely associated with the regulation of immune function and decreased production of inflammatory cytokines (15). However, the therapeutic effects of TF in NSCLC are not well understood, particularly in terms of their in vivo anti-cancer efficacy (16).

The present study investigated whether TF exert anti-cancer effects in NSCLC cells by promoting apoptosis and inhibiting growth and migration. The results indicated that TF treatment significantly promoted apoptosis and inhibited the growth of A549 cells via the cyclooxygenase 2 (COX-2)/Wnt/β-catenin signaling pathway, which suggested that TF may serve as a novel therapeutic agent in NSCLC.

Materials and methods

Cell culture

A549 cells were purchased from the American Type Culture Collection and were cultured in Dulbecco's Modified Eagle Medium (DMEM; Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% heat-inactivated fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin (Sigma-Aldrich, Merck KGaA). Cells were maintained at 37°C and 5% CO2.

Reverse-transcription quantitative PCR (RT-qPCR)

Total RNA was extracted from A549 cells using the RNeasy Mini kit (Qiagen, Inc.) according to the manufacturer's protocol. The mRNA expression levels of BCL2-like 2 (BCL2L2), BCL2 apoptosis regulator (BCL2), BCL2 associated agonist of cell death (BAD) and BCL2 associated X apoptosis regulator (BAX), COX-2, Wnt and β-catenin in A549 cells were measured by RT-qPCR with β-actin as an endogenous control as previously described (17). The forward and reverse primers used for qPCR were synthesized by Invitrogen, Thermo Fisher Scientific, Inc., and are presented in Table I. qPCR was performed using SYBR-Green Master Mix (Takara Bio, Inc.) according to the manufacturer's instructions and an ABI 7500 Fast Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The following thermocycling conditions were used: 95°C for 90 sec, followed by 45 cycles of 95°C for 30 sec, 57.5°C for 20 sec and 72°C for 30 sec. mRNA expression levels were calculated using the 2−ΔΔCq method (18) and normalized to β-actin levels.

Table I.

Primer sequences used for quantitative PCR.

Gene name	Sequence (5′→3′)
BCL2 associated X apoptosis regulator	F: CTTCTCACTGTCGACTACCGC
	R: GCGTCTCCTGTGCATTCG
BCL2 associated agonist of cell death	F: GCAAGGACAAGATTCGATACT
	R: GCCAGACTACATGGAAATCTA
BCL2 apoptosis regulator	F: CATGCTGGGGCCGTACAG
	R: TTGTCCGACCTTTGGCAACT
BCL2-like 2	F: ATTTGCGTGTGGAGTATTTGG
	R: GCTGTTCCGTCCCAGTAGATTA
Cyclooxygenase 2	F: CCGGGTACAATCGCACTTAT
	R: GGCGCTCAGCCATACAG
Wnt	F: CTCGTCGTACTCCTGCTTGGT
	R: ACTGGTGAGACCTGCGTGTA
β-catenin	F: CATCTACACAGTTTGATGCTGCT
	R: GCAGTTTTGTCAGTTCAGGGA
β-actin	F: CATGTACGTTGCTATCCAGGC
	R: CTCCTTAATGTCACGCACGAT

Overexpression of COX-2

The human COX-2 gene was cloned into a pcDNA3.1 plasmid (Invitrogen; Thermo Fisher Scientific, Inc.) to produce the pcDNA3.1-COX-2 vector. A549 cells (1×105 cells/well) were cultured in six-well plates until 90% confluence was reached and subsequently transfected with the pcDNA3.1-COX-2 vector (100 nM) or empty pcDNA3.1 (100 nM) plasmid using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

MTT cytotoxicity assay

A549 cells (1×103 cells/well) were incubated in 96-well plates with 2.5, 5.0 and 7.5 mg/ml TF (purity ≥95%, Sigma-Aldrich; Merck KGaA) for 24, 48 and 72 h at 37°C. TF were originally extracted from Daphne genkwa and dissolved in 40% ethanol. For the control group, cells were incubated with PBS instead of TF. A total of 20 µl MTT (5 mg/ml) solution in PBS was added to the wells at each time point, and the cells were incubated for an additional 4 h. Subsequently, 100 µl dimethyl sulfoxide were added to the wells to dissolve the formazan crystals and the optical density was measured at wavelength of 490 nm using a plate reader. Each experiment was performed in triplicate.

Cells invasion and migration assays

A549 cells were incubated with 5 mg/ml TF for 24 h at 37°C based on the maximum inhibitory effect on cell growth. A total of 1×105 A549 cells in 500 µl serum-free DMEM were pipetted into the upper chamber of Transwell inserts (8-µm pore size; Corning Life Sciences) and incubated for 48 h at 37°C. For the invasion assay, the Transwell inserts were precoated with Matrigel (1 mg/ml; BD Biosciences) for 48 h at 37°C. The cells were subsequently fixed with 4% paraformaldehyde for 5 min at 37°C and stained with 0.1% crystal violet for 30 min at 37°C. The numbers of migratory or invading A549 cells were counted in at least three randomly selected fields of view using a phase contrast microscope (Olympus Corp; magnification, ×100). Each experiment was performed at least three times.

Flow cytometry analysis

A549 cells (1×106 cells/well) were cultured until 90% confluence was reached. Apoptosis was assessed after incubation with TF (5 mg/ml) for 24 h at 37°C. A549 cells were subsequently trypsinized, washed in cold PBS, and adjusted to 1×106 cells/ml in PBS. Cells were stained with annexin V-fluorescein isothiocyanate and propidium iodide (Annexin V-FITC kit; cat. no. 556547; BD Biosciences) and analyzed using a flow cytometer (FACScan; BD Biosciences). Cell apoptosis was measured using BD FACSuite software (version 2; BD Biosciences).

Animal study

A total of 60 specific pathogen-free male BALB/c nude mice (age, eight weeks; weight, 32–35 g) were purchased from Shanghai Slack Experimental Animals Co., Ltd. Mice received an inguinal injection of 1×108 A549 cells in 150 µl PBS and were randomly divided into two groups (n=10 per group). Mice received treatment 6 days after tumor implantation when the tumor diameter reached 5–8 mm. Mice were intravenously injected with 20 mg/kg/day TF (dissolved in 40% ethanol) or vehicle (ethanol) as a control (19). The treatment was continued for 10 days (20). The tumor volumes were calculated as previously described using the following equation: Volume (mm3)=axb2/2, where a and b represent the longest and shortest diameters, respectively (21). On day 30, three mice per group were sacrificed for further analysis. The remaining mice were kept to investigate the survival time over a 100-day period. Tumor growth, animal health and behavior including self-centered behavior, motivation, anhedonia, anxiety and despair behavior were monitored every five days as described previously (22). Mice were sacrificed by cervical dislocation when the tumor diameter reached 15 mm. Experiments were performed in triplicate. Tumor inhibition rate was calculated using the following formula: Inhibitory rate (%)=(mean tumor volume in PBS-mean tumor volume in TF)/mean tumor volume in PBS ×100%. The present study was approved by the Ethics Committee of Mudanjiang Medical University.

Immunohistochemistry

Tumor tissues were harvested and fixed using 4% formaldehyde for 30 min at 25°C. Tissues were embedded in paraffin and cut into 4-µm serial sections. Antigen retrieval was performed by incubating the tumor sections with citrate buffer (pH 6.0) for 7 min at 100°C. Tumor sections were blocked with 5% BSA (Sigma-Aldrich; Merck KGaA) overnight at 4°C and incubated with rabbit anti-human COX-2 (1:1,000; ab15191; Abcam), Wnt (1:1,000; ab15251; Abcam) and β-catenin (1:1,000; ab32572; Abcam) primary antibodies overnight at 4°C. Following the primary incubation, sections were incubated with horseradish peroxidase-conjugated polyclonal anti-rabbit IgG secondary antibodies (1:10,000; ab6721; Abcam) for 1 h at room temperature. A Ventana Benchmark automated staining system was used to perform the staining (Bio-Rad Laboratories, Inc.). The staining was observed in six randomly selected fields of view (magnification, ×100) under a Zeiss immunofluorescence microscope (DMI5000M; Carl Zeiss AG). Densitometric quantification of the protein expression was performed using Quantity-One software (version 1.2; Bio-Rad Laboratories, Inc.)

Terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick end labeling (TUNEL)

TUNEL staining was used to analyze apoptotic cells in lung tumor tissues. Briefly, paraffin-embedded tumor sections were labeled with BrdU (cat. no. MAB4072; 1:1,000; Sigma-Aldrich; Merck KGaA) as previously described (23) and TUNEL-positive cells were identified using the ApopTag kit (EMD Millipore) according to the manufacturer's instructions. The staining was observed in at least three randomly selected microscopic fields under a fluorescence microscope (Carl Zeiss AG; magnification, ×100). Statistical quantification of TUNEL-positive tumor cells was performed to evaluate the pro-apoptotic effects of TF using six randomly selected fields of view to count the total number of cells and TUNEL-positive cells.

Statistical analysis

All data are expressed as the mean ± SD of three independent experiments and analyzed using the Student's t-test or one-way ANOVA followed by the Tukey post hoc test. The Kaplan-Meier method and the log-rank test were used to evaluate overall survival rate. All data were analyzed using SPSS software (version 19.0; IBM Corp.) and GraphPad Prism software (version 5.0; GraphPad Software, Inc.). P<0.05 was considered to indicate a statistically significant difference.

Results

Evaluation of the inhibitory effects of TF on A549 cells

The inhibitory effects of TF on the proliferation, migration and invasion of A549 cells were analyzed in vitro. Compared with the control group, TF-treated cells exhibited a significant dose-dependent decrease in proliferation (P<0.01; Fig. 1A and B). A concentration of 5 g/ml TF inhibited the proliferation of A549 cells to the greatest extent. Furthermore, treatment with 5 mg/ml TF for 24 h significantly inhibited the migration and invasion of A549 cells compared with the control group (P<0.01; Fig. 1C and D). These results indicated that TF treatment significantly inhibited the proliferation, migration and invasion of A549 cells.

Figure 1.

TF inhibited the growth and migration and invasion abilities of A549 cells. (A) TF exerted a significant inhibitory effect on the growth of A549 cells compared with the control. (B) TF inhibited growth of A549 cells in a dose-dependent manner. Following treatment for 24 h, 5 mg/ml TF significantly inhibited the (C) migration and (D) and invasion of A549 cells compared with the control. **P<0.01 vs. control. TF, total flavonoids.

TF treatment induces apoptosis of A549 cells

The effects of TF (5 mg/ml) on the apoptosis of A549 cells were investigated in vitro. TF treatment significantly increased the apoptosis of A549 cells compared with the control (P<0.01; Fig. 2A). RT-qPCR revealed that TF treatment decreased the expression levels of the anti-apoptotic genes BCL2L1 and BCL22 compared with control A549 cells (P<0.01; Fig. 2B). Furthermore, TF treatment increased the expression levels of the pro-apoptotic genes BAX and BAD compared with control A549 cells (P<0.01; Fig. 2C). These results indicated that TF treatment significantly affected apoptosis of A549 cells by regulating the expression of apoptosis-associated genes.

Figure 2.

TF treatment induced apoptosis of A549 cells. (A) Compared with the control, TF treatment induced apoptosis of A549 cells. (B) The expression levels of the anti-apoptotic genes BCL2L2 and BCL2 were significantly decreased in TF-treated A549 cells compared with the control. (C) The expression levels of the pro-apoptotic genes BAX and BAD were significantly increased in TF-treated A549 cells compared with the control. **P<0.01 vs. control. TF, total flavonoids; PI, propidium iodide; BCL2L2, BCL2 like 2; BCL2, BCL2 apoptosis regulator; BAX, BCL2 associated X apoptosis regulator; BAD, BCL2 associated agonist of cell death.

TF treatment suppresses proliferation via the COX-2/Wnt/β-catenin signaling pathway

The potential mechanism underlying the anti-cancer effects of TF was analyzed by investigating the COX-2/Wnt/β-catenin signaling pathway in A549 cells. TF treatment significantly decreased the mRNA expression levels of COX-2, Wnt and β-catenin in A549 cells compared with the control group (P<0.01; Fig. 3A). Furthermore, COX-2 overexpression inhibited the TF-mediated COX-2, Wnt and β-catenin downregulation in A549 cells (P<0.01; Fig. 3B). Additionally, COX-2 overexpression inhibited the TF-mediated decrease in proliferation and apoptosis of A549 cells (P<0.01; Fig. 3C and D). The transfection efficiency was determined by RT-qPCR after 72 h (Fig. S1). These results suggested that TF treatment significantly suppressed proliferation and promoted apoptosis of A549 cells via the COX-2/Wnt/β-catenin signaling pathway.

Figure 3.

TF treatment decreased the growth of A549 cells via the COX-2-Wnt/β-catenin signaling pathway. (A) Compared with the control, TF treatment decreased the mRNA expression levels of COX-2, Wnt and β-catenin in A549 cells. COX-2 overexpression inhibited the TF-mediated (B) downregulation of COX-2, Wnt and β-catenin, (C) growth reduction and (D) apoptosis of A549 cells. **P<0.01 vs. control. TF, total flavonoids; COX-2, cyclooxygenase; PI, propidium iodide; NS, not significant.

Inhibitory effect of TF on tumor growth in vivo

The anti-cancer efficacy of TF treatment was investigated in mouse xenograft tumor model. No animals presented with multiple tumors in the present study. As shown in Fig. 4A, TF treatment significantly inhibited tumor growth in mice compared with controls (P<0.01), with a tumor inhibition rate of 64.07%. Results demonstrated that TF treatment increased the percentage of apoptotic cells in tumor tissue compared with control (P<0.01; Fig. 4B). Immunohistochemistry revealed that COX-2, Wnt and β-catenin expression levels in tumor tissues were significantly decreased compared with the controls (P<0.01; Fig. 4C). Furthermore, TF administration significantly prolonged the survival of the animals compared with controls over a 100-day period (P<0.01; Fig. 4D). These results suggested that TF may serve as an efficient anti-cancer agent for lung cancer in vivo.

Figure 4.

Inhibitory effect of TF on tumor growth in a xenograft tumor mouse model. (A) TF treatment inhibited tumor growth in mice and the tumor inhibition rate of TF was 64.07% compared to PBS group determined the mean tumor volume. (B) TF treatment increased the percentage of apoptotic cells in tumor tissue compared with PBS. (C) Histological analysis revealed that COX-2, Wnt and β-catenin expression levels were significantly decreased in tumor tissues obtained from TF-treated animals compared with the control Magnification, ×100. (D) TF administration significantly increased the survival time over a 100-day period. The Kaplan-Meier method and the log-rank test were used to evaluate the overall survival rate. **P<0.01 vs. PBS. TF, total flavonoids; COX-2, cyclooxygenase 2; TUNEL, terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick end labeling.

Discussion

NSCLC has a high incidence and a poor prognosis (24). A previous study revealed that a Chinese medicine consisting of TF isolated from Fructus viticis inhibited the stem-like properties of lung cancer stem-like cells by downregulating the expression of p-AKT (25). In the present study, treatment with TF extracted from Daphne genkwa significantly inhibited the proliferation and migration and invasion abilities of A549 cells in a dose-dependent manner. Furthermore, TF promoted the apoptosis of A549 cells by increasing the expression levels of the pro-apoptotic genes apoptotic peptidase activating factor 1 (APAF1) and BAD and decreasing the expression levels of the anti-apoptotic genes BCL2L2 and BCL2. Further investigation revealed that TF increased apoptosis via the COX-2/Wnt/β-catenin signaling pathway.

TF have been shown to exhibit antitumor activity various human cancer cells (26). A previous study has demonstrated that TF significantly inhibited tumor growth and induced the apoptosis of prostate cancer cells via the PI3K/Akt/phosphatase and tensin homolog signaling pathway, which provided a theoretical basis for the investigation of the anti-cancer effects of TF (27–29). Furthermore, TF reduced the proliferation and promoted apoptosis of the human breast cancer cell line MCF-7, by selectively reducing BCL2 and nuclear factor-κB expression and increasing the expression of caspase-3 and 9, suggesting that TF inhibited cellular proliferation by activating the mitochondria-dependent apoptotic pathway (30). The results in the present study revealed that compared with the control, TF treatment promoted apoptosis and increased expression of BAK and BAD in A549 cells. Furthermore, the present study revealed that TF treatment inhibited proliferation, migration and invasion of A549 cells by downregulating the COX-2/Wnt/β-catenin in vitro and in vivo. A previous study demonstrated that the COX-2/Wnt/β-catenin signaling pathway may be involved in the antitumor mechanism of TF isolated from Radix tetrastigmae in hepatocellular carcinoma cells (31).

The Wnt/β-catenin signaling pathway plays an important role in regulating tumor growth, differentiation, oncogenesis, invasion and metastasis (32,33). In the present study, TF treatment inhibited the Wnt/β-catenin signaling pathway, which decreased the proliferation of A549 cells and increased apoptosis. A previous study demonstrated that the inhibition of the Wnt/β-catenin signaling pathway improves the anti-tumor effects of sorafenib in hepatocellular carcinoma (34). Another study demonstrated that downregulation of the Wnt/β-catenin signaling pathway inhibited the proliferation and increased apoptosis in A549 and H460 cells (35).

In conclusion, to the best of the authors' knowledge, the present study was the first to report the therapeutic significance of TF in lung cancer to investigate the potential mechanism. TF inhibited the proliferation and induced apoptosis of A549 cells by downregulating the COX-2/Wnt/β-catenin signaling pathway. The results obtained in the current study suggested that TF may serve as a novel anticancer agent and demonstrated that the COX-2/Wnt/β-catenin signaling pathway may be a potential therapeutic target for the treatment of lung cancer.