Literature DB >> 32176732

Towards low cost, multiplex clinical genotyping: 4-fluorescent Kompetitive Allele-Specific PCR and its application on pharmacogenetics.

Wei Suo1, Xiujin Shi1, Sha Xu1, Xiao Li1, Yang Lin1.   

Abstract

Single-nucleotide polymorphisms (SNPs) is associated with efficacy of specific drugs. Although there are several methods for SNP genotyping in clinical settings, alternative methods with lower cost, higher throughout and less complexity are still needed. In this study, we modified Kompetitive Allele Specific PCR to enable multiplex SNP genotyping by introducing additional fluorescent cassettes that specifically help to differentiate more amplification signals in a single reaction. This new format of assay achieved a limit of detection down to 310 copies/ reactions for simultaneous detection of 2 SNPs with only standard end-point PCR workflow for synthetic controls, and genotyped 117 clinical samples with results that were in 100% agreement with hospital reports. This study presented a simplified, cost-effective high-throughput SNP genotyping alternative for pharmacogenetic variants, and enabled easier access to pharmaceutical guidance when needed.

Entities:  

Mesh:

Year:  2020        PMID: 32176732      PMCID: PMC7075562          DOI: 10.1371/journal.pone.0230445

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Background

Single-nucleotide polymorphisms (SNPs) is associated with efficacy of specific drugs. For pharmacogenomic purpose SNP test is extensively used to guide clinical decisions. For example, Polymorphisms of the CYP2C9 (cytochrome P450, family 2, subfamily C, polypeptide 9) gene (CYP2C9*2, CYP2C9*3) and the VKORC1 (vitamin K epoxide reductase complex, subunit 1) gene (−1639G>A) can pose major impact on the maintenance dose of certain drugs such as Warfarin. Genotyping target SNPs for patients provides a time-saving method to guide proper maintenance dose, while reducing the adverse reaction risks and reoccurrence of thromboembolic episodes. [1] The genotyping of glucose-6-phosphate dehydrogenase (G6PD) is another typical example which demonstrates how population genotyping provides guidance in personalized medicine. G6PD deficiency prevalence is found to be high in malaria-endemic regions, while dominant antimalarial drugs can cause hemolysis to various degrees in G6PD deficient patients. Screening of G6PD deficiency alleles in high-risk populations would provide valuable estimation of hemolysis risk when using drugs such as primaquine, thereby improving public drug safety.[2] Many methods exist for clinical SNP genotyping. Majority of methods that can be used in clinical settings are PCR-based [3], which include, probe based qPCR assay that detect SNP by allele specific probes labeled with difference fluorescent dye [4]; allele-specific PCR (ASPCR) using SNP-containing primers only direct amplification on their complementary allele [5]; melting curve analysis (high-resolution melting analysis) utilizing saturated intercalating dye that would display the change of melting curve caused by slight difference of Tm between two SNP alleles [6]; and Cold-PCR which amplifies minority alleles selectively from mixtures of wild-type, utilizing the difference of dsDNA-dissociation by precisely controlled denaturing temperature [7]. These chemistries represent the most commercial kit now used for clinical diagnosis of SNP. Other methods also exist, such as Mass Array [2], Capillary electrophoresis [8] and digital PCR [9]. Although being high-throughput or super sensitive, these methods highly rely on the post-PCR analysis, which is time-consuming, vulnerable to cross contamination and equipment-demanding, therefore hindering the application in clinical settings where turnaround time, robustness and simplicity is crucial. Improved from ASPCR, Kompetitive Allele Specific PCR (KASP, LGC Group) introduced fluorescence resonance energy transfer (FRET) for signal generation, where 2 fluorescent cassettes are used for identification of allele-specific amplification for a single bi-allelic SNP. Compared with other alternatives, KASP is more flexible [10], cost-effective [11] and robust [12], and therefore is now widely applied in large scale genotyping for many areas including agriculture [13] and human health [14, 15]. However, due to KASP’s closed platform, the multiplexity is limited to only single bi-allelic SNP in each reaction, restricting the further improvement of the throughput and efficiency. In Beijing Anzhen Hospital, we provided 22,593 patients with genotype test and pharmaceutical guidance report service in 2018. Average number of SNPs tested for each patient is between 2~5. The current kit adopted for these tests utilize a ligase chain reaction-based technology that detect single SNP in each reaction, which means at least over 22,000 separate reactions are needed for the above tests. If 2 or even more SNPs can be tested in 1 reaction, more than 10, 000 reactions can be saved, enabling lower cost and reduced turnaround time. To address this problem, we aim to develop an enhanced version of KASP: 4-fluorescent KASP, which simultaneously utilize more fluorescent channels than just FAM/ Hex, and thereby enabling multiplexing genotyping. Here we describe the feasibility of genotyping with the new cassette with Cal Red 610 and Quasar 670 labels, and the compatibility of the new cassette with those contained in standard KASP reagent.

Method

Design of fluorescent cassette

Following FRET principle, one fluorescent dye and one BHQ-2 quencher were attached to 5’ and 3’ ends of two reverse complementary single stranded DNA separately. The sequence was blasted to confirm that it would not amplify any natural sequences. These sequences were sent to LGC, Biosearch Technologies for synthesis. Multiple pairs of cassettes were designed for empirical selection. The final selected sequences are as follows,

Design of KASP primers

The allele specific primer was designed by following the principles described previously[5], and validated with Primer-BLAST tool against NCBI database. The sequence of the used primers is available upon request. For standard KASP, sequences of specific primers were respectively added at 5’ end by FAM tag or Hex tag following previous published papers [16]. For modified KASP which involved fluorescent other than FAM/ Hex, and tails for specific fluorescent cassette were added, which were CAL Fluor Red 610 tag or Quasar 670 tag. Oligos were ordered through LGC, Biosearch Technologies. The sequences are as follows,

Design of positive control

Positive control for each target was designed and ordered through LGC, Biosearch Technologies. The sequence was designed by including primer binding site for allele specific sequences of each primer, with ‘tt’ as spacer. The sequences are as follows,

Clinical samples

This study was approved by the Clinical Research Ethics Committee of Beijing Anzhen Hospital. As the samples were collected for clinical tests following routine protocol and we used only small portion of the retention before it was discarded, the Clinical Research Ethics Committee of Beijing Anzhen Hospital agree to exempt the informed consent. The clinical DNA, extracted from blood samples between Oct. 12th to Jan. 6th 2020, was provided with clinically diagnosed genotype. The information was accompanied with sample ID only, personal information were not revealed for privacy purpose.

Clinical diagnostics

Clinical diagnostic in our hospital was done using a commercial kit from Sino Era Genotech (http://www.sino-era.com/, Beijing, China). The kit includes reagents for sample preparation, molecular beacon probes and hybridization buffer. Briefly, 200 μL of whole blood was added to 1 mL of red blood cell lysis buffer and incubated for 5 minutes at room temperature. The mixture was centrifuged (3000 rpm) for 5 minutes and the supernatant removed. 50 μL preservation solution was added to resuspend the precipitate. 1.5 μL of sample was then combined with detecting reagent and analyzed with the TL998A real-time PCR system (Tianlong, Xi’an, China). The detecting reagent includes hybridization buffer and two molecular beacon probes labeled with FAM and HEX for wild-type and mutation, respectively.

PCR protocol and data analysis

For standard KASP, the reaction was done with KASP V4.0 2X Master Mix (Low Rox, LGC Biosearch Technologies) following manufacturer’s instructions. For assays with additional fluorescent channels, 0.08 μM of both fluorescent oligos and 0.32 μM of corresponding quencher oligos were added to BHQ probe mastermix (LGC Biosearch Technologies), or KASP V4.0 2X Master Mix. For each SNP, 0.15 μM of each allele specific primer and 0.4 μM of common reverse primer were used. The reaction volume in this study was 10 μl unless other wisely specified. The PCR protocol was the same as standard KASP (36 cycles of amplification in total), except that all fluorescent channel was read at the final step. The reaction was done with Biorad CFX96 and analyzed by Bio-Rad CFX Maestro 1.1 (Version:4.1.2433.1219) software.

Result

Evaluation of cassettes with Cal Red 610 and Quasar 670

Feasibility of doing self-made KASP with fluorescent channels other than FAM/ Hex was evaluated by adding newly designed fluorescent cassette labeled with Cal Red 610 and Quasar 670 to routinize PCR master mix (BHQ probe Mastermix, LGC Biosearch Technologies). Synthetic controls for rs1057910 and rs4986893 were assayed with this self-made KASP system, and all 16 controls were correctly clustered for both assays (Fig 1), indicating that this new pair of cassettes with Cal Red 610 and Quasar 670 works fine both for rs1057910 and rs4986893 in routine qPCR master mix.
Fig 1

Genotyping of rs1057910 (left) and rs4986893 using cassette with Cal Red 610 and Quasar 670 in routine qPCR master mix following KASP protocol. Allele specific primers were added with tail for Cal Red 610 (G for rs1057910, and C for rs4986893) or Quasar 670 (T for rs1057910, and T for rs4986893). Synthetic positive control of each gene was genotyped individually (homozygotes being approximately 300,000 copies/ reactions, and heterozygotes being 150,000 copies of each allele per reaction). One None-Template Control (NTC) was included in each run.

Genotyping of rs1057910 (left) and rs4986893 using cassette with Cal Red 610 and Quasar 670 in routine qPCR master mix following KASP protocol. Allele specific primers were added with tail for Cal Red 610 (G for rs1057910, and C for rs4986893) or Quasar 670 (T for rs1057910, and T for rs4986893). Synthetic positive control of each gene was genotyped individually (homozygotes being approximately 300,000 copies/ reactions, and heterozygotes being 150,000 copies of each allele per reaction). One None-Template Control (NTC) was included in each run.

Evaluation of new cassette in standard KASP reagent

To confirm the compatibility of the new cassette with standard KASP chemistry, cassettes with Cal Red 610 and Quasar 670 were added to standard KASP, and genotyped clinical samples as well as synthetic controls for rs1057910 and rs4986893. The controls are all correctly genotyped, and the result for the clinical samples is in 100% agreement with that from hospital report (Table 1), indicating that the newly designed cassettes with Cal Red 610 and Quasar 670 work well within standard KASP reagent.
Table 1

Genotyping result reported by hospital and by KASP using new cassettes.

MethodGenotyping results (n = 117)
 rs1057910 (n = 32)rs4986893 (n = 85)
 GGTTTCCTTT
Genotype reported by hospital 30207861
KASP using new cassettes 30207861

Limit of detection of 4-fluorescent KASP

The limit of detection (LOD) was determined as the minimal amount of positive control added to each reaction that produced a correct clustering. The LOD was determined to be 310 copies/ reactions, or 5 μl of 62 copies/ μl positive control (Fig 2), indicating that this new 4-fluorescent KASP was highly sensitive in all four channels, and could meet the needs of clinical detection.
Fig 2

Limit of detection of 4-fluorescent KASP.

Allele specific primers were added with tails for Cal Red 610 (G for rs1057910), Quasar 670 (T for rs1057910), FAM (A for rs9923231) and Hex (G for rs9923231). Positive control of rs1057910 and rs9923231 were diluted by 10-fold from 6.23 x 1010 copies/ μl (100 nM stock solution) to 6.2 copies/ μl. The two synthetic genes were diluted together to make duplex-SNP controls, where allele-G for rs1057910 and allele-A for rs9923231 were put in one solution and the other two alleles were put in another solution. The heterozygote controls were made by mixing homozygote solution of both alleles with 1:1 ratio at each concentration. 5 μl of each concentration was used in each reaction. For each concentration, each genotype was run in duplicates, with a total of 12 NTCs included. The data above showed the concentrations from 62 copies/ μl to 6.23 x 106 copies/ μl (6 concentrations in total). The 6.2 copies/ μl samples were not clustered correctly and therefore not included.

Limit of detection of 4-fluorescent KASP.

Allele specific primers were added with tails for Cal Red 610 (G for rs1057910), Quasar 670 (T for rs1057910), FAM (A for rs9923231) and Hex (G for rs9923231). Positive control of rs1057910 and rs9923231 were diluted by 10-fold from 6.23 x 1010 copies/ μl (100 nM stock solution) to 6.2 copies/ μl. The two synthetic genes were diluted together to make duplex-SNP controls, where allele-G for rs1057910 and allele-A for rs9923231 were put in one solution and the other two alleles were put in another solution. The heterozygote controls were made by mixing homozygote solution of both alleles with 1:1 ratio at each concentration. 5 μl of each concentration was used in each reaction. For each concentration, each genotype was run in duplicates, with a total of 12 NTCs included. The data above showed the concentrations from 62 copies/ μl to 6.23 x 106 copies/ μl (6 concentrations in total). The 6.2 copies/ μl samples were not clustered correctly and therefore not included.

Discussion

Clinical SNP test is critical for prescribing specific drugs [1, 2]. In Beijing Anzhen Hospital, we provided 22,593 patients with genotype test and pharmaceutical guidance report service in 2018. The currently used genotyping assays were approved by the State Drug Administration of China, all of which involved more than just 1 SNP. These assays can only detect 1 SNP in each reaction, therefore multiple reactions are required for each patient. In addition, the cost is up to $ 60 per SNP, limiting the access of the low-income patients and thus exposing them to higher risks. Alternative method with higher throughout and lower cost is imperatively needed. Although Mass-array and NGS offer super high multiplexibility, ranging from tens to even thousands of SNPs with reasonable price, they do not fit clinical needs at Anzhen hospital. As only 2~5 SNPs are required for each patient, and the result shall be returned within 24 hours, rendering both Mass-array and NGS incompatible in this scenario. To address this problem, we also considbuquered probe-based multiplex qPCR, which efficiently detects 2~3 SNPs in one reaction, but the perplexity of designing both primers and probes for each SNP, and the burden of fine tune PCR conditions for each assay is challenging. With this new 4-fluorescent KASP assay available, the output for SNP genotyping will be doubled without requiring additional labor or significant cost. The workflow is exactly the same as standard KASP, which is already well known for its simplicity and flexibly [10, 12], and the additional cassette added to the assay is only single-labeled oligos, which is significantly less expensive as compared with dual-labeled oligos used for routine multiplex genotyping. The cost can be further reduced by making this single-labeled oligos in bulk; these single-labeled oligos are not gene-specific, and therefore applicable for genotyping of all SNPs. The universal-nature of these oligos bring in at least two benefit: 1, the unit cost (per nmol) of synthesizing oligos goes down significantly as the scale goes up. The universal oligos that can be made in one large batch for all SNPs will be more cost-effective than those individually customized, small scale probes; 2, the perplexity of designing both primers and probes for each SNP no longer exists, as only gene specific primers are needed, leading to improved convenience and flexibility for designing new assays for multiplexing SNP analysis. The limitations of current study include limited scale of clinical validation, and small number of SNP sites evaluated for dual-SNP assays. To further support 4-fluorescent KASP’s capacity on clinical genotyping, experiments that involve more clinical samples, and various SNP sites should be conducted. Current result, to our knowledge, is the first demonstration of performing KASP for multiple SNPs in one reaction. Although we only used 2 pairs of cassettes with 4-fluorescent channels for simultaneously genotyping of 2 SNPs in one reaction, there is the potential that more cassettes can be added and thus more SNPs and even multi-allelic SNPs can be evaluated in a single reaction, considering that 6 or more channels plate reader and qPCR machines are emerging. 2 Jan 2020 PONE-D-19-32764 Towards low cost, multiplex clinical genotyping: 4 fluorescent Kompetitive Allele-Specific PCR and its application on pharmacogenetics PLOS ONE Dear Mrs. Lin, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. The manuscript should be prepared in accordance with the rules of the journal. All information and details should be fully presented in the work. The English style must be checked by a native English speaker or a specialized language service. We would appreciate receiving your revised manuscript by Feb 16 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Ruslan Kalendar, PhD Academic Editor PLOS ONE Journal Requirements: 1. When submitting your revision, we need you to address these additional requirements. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2.  Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. 3. We noticed you have some minor occurrence(s) of overlapping text with the following previous publication(s), which needs to be addressed: https://doi.org/10.1373/clinchem.2008.115295 https://doi.org/10.1016/j.jmoldx.2017.05.007 In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the Methods section. Further consideration is dependent on these concerns being addressed. 4. Please note that all PLOS journals ask authors to adhere to our policies for sharing of data and materials: https://journals.plos.org/plosone/s/data-availability. According to PLOS ONE’s Data Availability policy, we require that the minimal dataset underlying results reported in the submission must be made immediately and freely available at the time of publication. As such, please consider including the minimal information (fluorescent cassette sequence and primer sequences) upon publication. 5. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was suitably informed and (2) what type you obtained (for instance, written or verbal). If your study included minors under age 18, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information. Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? Reviewer #1: Yes Reviewer #2: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No Reviewer #2: No ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? Reviewer #1: No Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? Reviewer #1: No Reviewer #2: No ********** 5. Review Comments to the Author Reviewer #1: This paper describes an incremental advance that is unlikely to be adopted because there are many better and more accessible methods for genotyping. While the work demonstrates multiplexed genotyping, the level of multiplexing is very limited. Specific comments: Too few samples with rare genotypes are tested. It is important to show that there are no errors with rare genotypes. The statement in the materials and methods "Sequence of used primers is available upon request" is not acceptable for PLOS One. Authors should include all sequence information in the paper or Supplementary Information section. It is not optional information that should have to be requested. English language needs to be reviewed by a native English speaker. Reviewer #2: In the current study, a modified Kompetitive Allele Specific PCR, in which 4 fluorescents were used, was described. Further, this modified KASP was used and evaluated. Overall, this job is an improvement for the routine KASP that can be a cost-effective high-throughput SNP genotyping alternative for pharmacogene variants. There are many mistakes in the text concerning English wording and grammar. It is suggested to authors to co-opt a native English speaker when revising the manuscript. Specific Comments 1. Why did rs1057910 and rs4986893 were selected to evaluated the modified KASP? 2. the result of modified KASP for clinical samples was in 100% agreement with that from hospital report. The authors should describe what kind of method the hospital reports based on. Moreover, the number of the samples (n=40) that were carried out to evaluate the mothed was extremely limited. The authors should increase sample size. 3. Three-line table should be used in the manuscript. 4. The format of reference in the text doesn’t meet the standard of PLOS ONE. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 16 Feb 2020 Dear Editor, Thank you for the kind suggestions. We have updated the manuscript accordingly by addressing to all points raised both you and the reviewers. For Journal Requirements: 1. we have updated our manuscript to meet PLOS ONE's style requirements, including those for file naming. 2. we have no supporting info for this manuscript, all relevant info is now incorporated in main body of the manuscript. 3. we have revised the wording and cited all sources, which is now in line 35 to 48. 4. we have listed fluorescent cassette sequence and primer sequences in revised manuscript, which is now in line 92, line 102 and line 107. 5. we have updated ethical statement in line 110 : “This study was approved by the Clinical Research Ethics Committee of Beijing Anzhen Hospital. As the samples were collected for clinical tests following routine protocol and we used only small portion of the retention before it was discarded, the Clinical Research Ethics Committee of Beijing Anzhen Hospital agree to exempt the informed consent. “ For Reviewers' comments: Reviewer #1: 1, Too few samples with rare genotypes are tested. It is important to show that there are no errors with rare genotypes. Response: due to limited number of available clinical samples, the sample size in previous version of manuscript is indeed small. We have now enrolled more participants, and evaluated our assay in 117 clinical samples. The manuscript has been updated accordingly. It is indeed important to evaluate new assays with as many genotypes as possible, including those rare genotypes. Current study, however, focuses only on germline mutation that is currently clinically relevant in our hospitals, we do not yet have resource to explore more rare genotypes. But we would surely consider cooperate with other organizations that have such need and resources in future. 2, The statement in the materials and methods "Sequence of used primers is available upon request" is not acceptable for PLOS One. Authors should include all sequence information in the paper or Supplementary Information section. It is not optional information that should have to be requested. Response: we have now disclosed final version of all sequences in the manuscript, which is now in line 92, line 102 and line 107. 3, English language needs to be reviewed by a native English speaker. Response: we have the manuscript reviewed by a native English speaker. Reviewer #2: 1. Why did rs1057910 and rs4986893 were selected to evaluated the modified KASP? Response: Current study focuses on SNP that is currently clinically relevant in our hospitals. rs1057910 and rs4986893 is among the most common sites that is being evaluated daily. Although there is a couple of other sites, we are not yet able to completed all of them due to limited resources. 2. the result of modified KASP for clinical samples was in 100% agreement with that from hospital report. The authors should describe what kind of method the hospital reports based on. Moreover, the number of the samples (n=40) that were carried out to evaluate the mothed was extremely limited. The authors should increase sample size. Response: our hospital uses a commercial kit from Sino Era Genotech (http://www.sino-era.com/, Beijing, China). Detailed info and protocol has been added to revised manuscript in line 119 to 127. We have also increase sample size to 117. 3. Three-line table should be used in the manuscript. Response: all tables is now updated using a three-line format. 4. The format of reference in the text doesn’t meet the standard of PLOS ONE. Response: format is now updated in accordance with PLOS ONE guideline. 2 Mar 2020 Towards low cost, multiplex clinical genotyping: 4-fluorescent Kompetitive Allele-Specific PCR and its application on pharmacogenetics PONE-D-19-32764R1 Dear Dr. Lin, We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication. Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. With kind regards, Ruslan Kalendar, PhD Academic Editor PLOS ONE 4 Mar 2020 PONE-D-19-32764R1 Towards low cost, multiplex clinical genotyping: 4-fluorescent Kompetitive Allele-Specific PCR and its application on pharmacogenetics Dear Dr. Lin: I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. For any other questions or concerns, please email plosone@plos.org. Thank you for submitting your work to PLOS ONE. With kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Ruslan Kalendar Academic Editor PLOS ONE
Sequence Name5' modificationsequence3' modification
CalCAL Fluor Red 610TAG AAG GCA CAG TCG AGG
Cal quencherCGA CTG TGC CTT CTABHQ-2
QuaQuasar 670GTA AAA CGA CGG CCA GTG
Qua quencherGGC CGT CGT TTT ACBHQ-2
Sequence nameSequence
rs1057910-FAMGCGATTAGCCGTTAGGATGAGGTGGGGAGAAGGTCAAT
rs1057910-HEXGTCGGTGAACAGGTTAGAGA GCTGGTGGGGAGAAGGTCAAG
rs1057910-Quasar 670GTA AAA CGA CGG CCA GTGGCTGGTGGGGAGAAGGTCAAG
rs1057910-Cal Red 610TAG AAG GCA CAG TCG AGGGGTGGGGAGAAGGTCAAT
rs1057910-CommonGGAGCCACATGCCCTACACAGAT
rs4986893-FAMGCGATTAGCCGTTAGGATGAAAC TTG GCC TTA CCT GGA TC
rs4986893-HEXGTCGGTGAACAGGTTAGAGA AAC TTG GCC TTA CCT GGA TT
rs4986893-Quasar 670GTA AAA CGA CGG CCA GTGAAC TTG GCC TTA CCT GGA TT
rs4986893-Cal Red 610TAG AAG GCA CAG TCG AGGAAC TTG GCC TTA CCT GGA TC
rs4986893-CommonAAACATCAGGATTGTAAGCAC
rs9923231-FAMGCGATTAGCCGTTAGGATGATTG AGC CAC CGC ACC A
rs9923231-HEXGTCGGTGAACAGGTTAGAGA TAG CCA CCG CAC CG
rs9923231-Quasar 670GTA AAA CGA CGG CCA GTGTAG CCA CCG CAC CG
rs9923231-Cal Red 610TAG AAG GCA CAG TCG AGGTTG AGC CAC CGC ACC A
rs9923231-CommonGGAAGTCAAGCAAGAGAAGACCTGAA
Sequence nameSequence
rs1057910control-GGCTGGTGGGGAGAAGGTCAAGttATCTGTGTAGGGCATGTGGCTCC
rs1057910control-TGGTGGGGAGAAGGTCAATttATCTGTGTAGGGCATGTGGCTCC
rs4244285control-ATTCCCACTATCATTGATTATTTCCCAttAAGAACACCAAGAATCGATGGA
rs4244285control-GTTCCCACTATCATTGATTATTTCCCGttAAGAACACCAAGAATCGATGGA
rs4986893control-CAAC TTG GCC TTA CCT GGA TCttGTGCTTACAATCCTGATGTTT
rs4986893control-TAAC TTG GCC TTA CCT GGA TTttGTGCTTACAATCCTGATGTTT
rs9923231control-ATTG AGC CAC CGC ACC AttTTCAGGTCTTCTCTTGCTTGACTTCC
rs9923231control-GTAG CCA CCG CAC CGttTTCAGGTCTTCTCTTGCTTGACTTCC
  16 in total

1.  Replacing PCR with COLD-PCR enriches variant DNA sequences and redefines the sensitivity of genetic testing.

Authors:  Jin Li; Lilin Wang; Harvey Mamon; Matthew H Kulke; Ross Berbeco; G Mike Makrigiorgos
Journal:  Nat Med       Date:  2008-04-13       Impact factor: 53.440

2.  SNP genotyping: the KASP assay.

Authors:  Chunlin He; John Holme; Jeffrey Anthony
Journal:  Methods Mol Biol       Date:  2014

3.  Allele-specific enzymatic amplification of beta-globin genomic DNA for diagnosis of sickle cell anemia.

Authors:  D Y Wu; L Ugozzoli; B K Pal; R B Wallace
Journal:  Proc Natl Acad Sci U S A       Date:  1989-04       Impact factor: 11.205

4.  Single Nucleotide Polymorphism Analysis Using KASP Assay Reveals Genetic Variability in Rotylenchulus reniformis.

Authors:  Churamani Khanal; Manjula T Kularathna; Jeffery D Ray; Salliana R Stetina; Edward C McGawley; Charles Overstreet
Journal:  Plant Dis       Date:  2019-06-13       Impact factor: 4.438

5.  High Throughput Multiplex SNP-analysis in Chronic Obstructive Pulmonary Disease and Lung Cancer.

Authors:  Zsuzsanna Elek; Zsuzsanna Kovács; Gergely Keszler; Miklós Szabó; Eszter Csanky; Jane Luo; András Guttman; Zsolt Rónai
Journal:  Curr Mol Med       Date:  2020       Impact factor: 2.222

6.  Rapid single-nucleotide polymorphism detection of cytochrome P450 (CYP2C9) and vitamin K epoxide reductase (VKORC1) genes for the warfarin dose adjustment by the SMart-amplification process version 2.

Authors:  Tohru Aomori; Koujirou Yamamoto; Atsuko Oguchi-Katayama; Yuki Kawai; Takefumi Ishidao; Yasumasa Mitani; Yasushi Kogo; Alexander Lezhava; Yukiyoshi Fujita; Kyoko Obayashi; Katsunori Nakamura; Hugo Kohnke; Mia Wadelius; Lena Ekström; Cristine Skogastierna; Anders Rane; Masahiko Kurabayashi; Masami Murakami; Paul E Cizdziel; Yoshihide Hayashizaki; Ryuya Horiuchi
Journal:  Clin Chem       Date:  2009-01-30       Impact factor: 8.327

7.  High-resolution genotyping by amplicon melting analysis using LCGreen.

Authors:  Carl T Wittwer; Gudrun H Reed; Cameron N Gundry; Joshua G Vandersteen; Robert J Pryor
Journal:  Clin Chem       Date:  2003-06       Impact factor: 8.327

8.  High-throughput droplet digital PCR system for absolute quantitation of DNA copy number.

Authors:  Benjamin J Hindson; Kevin D Ness; Donald A Masquelier; Phillip Belgrader; Nicholas J Heredia; Anthony J Makarewicz; Isaac J Bright; Michael Y Lucero; Amy L Hiddessen; Tina C Legler; Tyler K Kitano; Michael R Hodel; Jonathan F Petersen; Paul W Wyatt; Erin R Steenblock; Pallavi H Shah; Luc J Bousse; Camille B Troup; Jeffrey C Mellen; Dean K Wittmann; Nicholas G Erndt; Thomas H Cauley; Ryan T Koehler; Austin P So; Simant Dube; Klint A Rose; Luz Montesclaros; Shenglong Wang; David P Stumbo; Shawn P Hodges; Steven Romine; Fred P Milanovich; Helen E White; John F Regan; George A Karlin-Neumann; Christopher M Hindson; Serge Saxonov; Bill W Colston
Journal:  Anal Chem       Date:  2011-10-28       Impact factor: 6.986

9.  Effector Polymorphisms of the Sunflower Downy Mildew Pathogen Plasmopara halstedii and Their Use to Identify Pathotypes from Field Isolates.

Authors:  Quentin Gascuel; Amandine Bordat; Erika Sallet; Nicolas Pouilly; Sébastien Carrere; Fabrice Roux; Patrick Vincourt; Laurence Godiard
Journal:  PLoS One       Date:  2016-02-04       Impact factor: 3.240

10.  Low and heterogeneous prevalence of glucose-6-phosphate dehydrogenase deficiency in different settings in Ethiopia using phenotyping and genotyping approaches.

Authors:  Getasew Shitaye; Endalamaw Gadisa; Lynn Grignard; Girma Shumie; Wakweya Chali; Temesgen Menberu; Mulualem Belachew; Getaneh Tegegn; Sagni Challi; Jonathan Curry; Laleta Mahey; Tsegaye Hailu; Hassen Mamo; Menakath Menon; Taye Balcha; Abraham Aseffa; Chris Drakeley; Teun Bousema; Fitsum G Tadesse
Journal:  Malar J       Date:  2018-08-02       Impact factor: 2.979

View more
  2 in total

1.  KASP: a genotyping method to rapid identification of resistance in Plasmodium falciparum.

Authors:  Ana Alvarez-Fernandez; María J Bernal; Isabel Fradejas; Alexandra Martin Ramírez; Noor Azian Md Yusuf; Marta Lanza; Shamilah Hisam; Ana Pérez de Ayala; José M Rubio
Journal:  Malar J       Date:  2021-01-06       Impact factor: 2.979

Review 2.  Molecular Genetic Techniques in Biomarker Analysis Relevant for Drugs Centrally Approved in Europe.

Authors:  Tatjana Huebner; Michael Steffens; Catharina Scholl
Journal:  Mol Diagn Ther       Date:  2021-12-14       Impact factor: 4.074

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.