Investigation of CYP1B1 Gene Involvement in Primary Congenital Glaucoma in Iraqi Children.

PURPOSE: Primary congenital glaucoma (PCG) is a severe type of glaucoma that occurs early in life. PCG is usually inherited in an autosomal recessive pattern. Cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1) gene is reported to be PCG-related gene. It codes for the CYP1B1 enzyme which is considered as phase I xenobiotic-metabolizing enzyme and its function is related to the eye oxidative homeostasis and correspondingly to the normal development of the eye. This is the first genetic study in Iraq that investigates the CYP1B1 polymorphisms behind the PCG disease.
METHODS: Genomic DNA was extracted from the whole blood of 100 unrelated Iraqi PCG patients and 100 healthy children, all of them were aged between 1 month and 3 years. All the coding sequence of CYP1B1 gene was amplified using polymerase chain reaction; restriction fragment length polymorphism was used to follow G61E and E229K mutations. Direct sequencing was performed to screen for other mutations.
RESULTS: CYP1B1 mutations were identified in 78 (78%) of the patients. We detected a total of eight mutations: Four missense mutations (c.182G>A, c.685G>A, g.6813G>A, and g.6705G>A), one silence mutation (D449D) and three insertions (g.10068ins10069, g.10138ins10139, and g.10191ins10192). Five mutations (g.6813G>A, g.6705G>A, g.10068ins10069, g.10138ins10139, and g.10191ins10192) are novel. G61E is the only mutation that was detected in patients merely.
CONCLUSIONS: CYP1B1 mutation (G61E) is considered as PCG-related allele in the Iraqi population. Copyright:

Introduction

Glaucoma is a heterogeneous group of ocular disorder that includes optic nerve degeneration, when left untreated, lead to irreversible loss of vision.[1] Almost 15% of blindness worldwide is due to glaucoma. It is categorized under three broad types; primary congenital glaucoma (PCG), closed-angle glaucoma, and primary open-angle glaucoma.[23] PCG is an aggressive type of glaucoma occurs early in life (from birth up to 3 years in age).[4] It is considered as an autosomal recessive disorder. PCG dominance differs from 1:10,000 for the Western communities, 1:3300 for Southern India, and 1:2500 for Saudi Arabia to 1:1250 for the Slovakia Gypsy population,[56] suggesting a strong genetic role in etiology. PCG is caused by developing anomalies in the trabecular meshwork (TM) and the anterior chamber angle of the eye.[17] These anomalies cause impairment in the aqueous humor (AH) outflow leading to elevated intraocular pressure (IOP), which causes optic nerve damage and when left without treatment, permanent blindness.[4]

PCG is considered as a genetically heterogeneous disorder occurring in families and sporadically. Four loci were identified to be related to the disease by linkage analysis; GLC3A which belongs to 2p22-p21, GLC3B belongs to 1p36.2-36.1, GLC3C belongs to14q24.3, and GLC3D belongs to 14q24.2-24.3.[8910] The GLC3A was characterized to harbor mutations in Cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1) gene.[11]

Mutations in CYP1B1 were detected in over 85% of families affected with PCG in Slovakia, Turkey, and Saudi Arabia;[1213] they were reported to be disease-related in the Japanese, Indian, Pakistani, Omani, and Moroccan populations.[141516] CYP1B1 gene comprises three exons (371, 1044, and 3707 bp) and two introns (390 and 3032 bp).[17]

This study was designed to examine the role of CYP1B1 mutations in the pathogenesis of PCG in Iraqi children. This is the first genetic study in Iraq that investigates the CYP1B1 polymorphisms behind the PCG disease.

Methods

Study subjects

This study follows the principles of the Helsinki Declaration, and it was approved by the Ethics Committee, Department of Chemistry, College of Science, Mustansiriyah University, Baghdad, Iraq. The blood samples were taken after informed consent of the participants before their inclusion in the study. The affected pediatric were recruited from Ibn Al-Haitham Teaching Eye Hospital, Baghdad, Iraq, while the healthy children were volunteers. All the patients were diagnosed by glaucoma specialist, the standers that were adopted to diagnose PCG are as follows: age of onset runs between 1st day and 3 years, enlarged cornea so the parameter was bigger than 11 mm, elevated IOP (over 21 mmHg) and increased cup-to-disc ratio. Patients have other ocular anomalies, such as anterior segment dysgenesis, aniridia, neurofibromatosis, Sturge–Weber syndrome, and congenital hereditary endothelial dystrophy were excluded from the study.

One hundred unrelated Iraqi PCG affected pediatric (58 males and 42 females) were included in this study and 100 unrelated healthy children (60 males and 40 females) from the same ethnicity without any systemic or ocular disease were served as controls. All the patients and controls aged between 1 month and 3 years. Five milliliter of venous blood was taken from the enrolled children by using plastic disposable syringes and were kept in Ethylenediaminetetraacetic acid (EDTA) tubes and stored at −20°C until used in genetic analysis.

Mutation analysis

Genomic DNA was extracted from whole blood using the genomic DNA extraction kit according to the instructions of the manufacturer (Geneaid, Biotech, Taiwan). The DNA purity and concentration were measured by a nanodrop (BioDrop μLITE, BioDrop co., UK), while the DNA integrity was checked using 0.8% agarose gel electrophoresis, which is prestained with ethidium bromide (0.7 μg/ml) in Tris-Borate-Ethylenediaminetetraacetic acid (TBE) buffer.

The coding region of CYP1B1 gene was amplified using three overlapping primers scheduled in Table 1. The lyophilized primers were purchased from Bioneer, South Korea. The polymerase chain reaction (PCR) reaction was performed using a total of 25 μl PCR reaction mixture that contains 3 μl (100 ng of genomic DNA), 2 μl (20 pmol/l) for both forward and reverse primers, 13 μl of free DNAase distilled water, and 5 μl PCR premix from Bioneer, South Korea. Each 5 μl of PCR premix contains 250 μM of dNTPs, 1 U of Top DNA polymerase, 30 mM of KCl, 10 mM of Tris-HCl (pH 9.0), and 1.5 mM of MgCl2. The following program was applied in PCR thermocycler (MyGenieTM 96/384 Thermal Block, Bioneer, South Korea): initial denaturation at 95°C for 5 min, thirty cycles of amplification (denaturation at 94°C for 45 s, annealing at primer-specific annealing temperature [Table 1] for 45 s, extension at 72°C for 1 min, and final extension at 72°C for 10 min). Amplification was verified by electrophoresis on 1.5% agarose gel prestained with ethidium bromide (0.5 mg/ml). Three DNA fragments (776 bp, 757 bp and 872 bp) was selected for amplification, and they supposed to cover all the coding region on exon two and exon three of CYP1B1 gene. Restriction fragment length polymorphism (RFLP)-PCR technique was used to identify the mutations on exon two (G61E and E229K). RFLP-PCR detection for G61E and E229K was done using the restriction endonucleases; TaqI and EarI respectively according to the manufacturer's instruction, New England Biolabs, UK. The three PCR fragments were commercially sequenced according to instruction manuals of the sequencing company, Macrogen Inc. Geumchen, Seoul, South Korea.

Table 1

Polymerase chain reaction primers used to amplify CYP1B1 gene

Exon	Forward (5ˋ- 3ˋ)	Reverse (5ˋ- 3ˋ)	Reference	Annealing temperature (°C)	Product size (bp)
2	ATTTCTCCAGAGAGTCAGCTCCG	TGTAGCGGCAGCCGAAACACAC	[18]	65	776
2	GCATGATGCGCAACTTCTTCACG	TCACTGTGAGTCCCTTTACCGAC	[18]	62	757
3	AATTTAGTCACTGAGCTAGATAGCC	TATGGAGCACACCTCACCTGATG	[18]	62	872

Statistical analysis

Statistical analysis system-2012 program (SAS-2012, Statistical Analysis System, Version 9.1th ed. SAS. Inst. Inc. Cary. North Carolina, USA) was used for the statistical analysis of the study parameters. T-test used to obtain the mean and standard deviation for the measured parameters.

Results

The results [Table 2] showed the detection of a total of eight mutations: Three missense mutations (G61E, E2229K and g.6705G>A), one silent mutation (D449D), three insertion mutations (g.10068ins10069, g.10138ins10139, and g.10191ins10192), and one intronic missense mutation (g.6813G>A). Five mutations (g.6705G>A, g.6813G>A, g.10068ins10069, g.10138ins10139, and g. 10191ins10192) were novel. E229K was detected only in a heterozygous state in 9 (9%) of the patients and in 7 (7%) of the controls. G61E was detected in 78 (78%) of the patients (homozygous 65 [65%] and heterozygous 13 [13%]), while its distribution in the controls was 0%. The detection of G61E and E229K mutations was done by using the RFLP-PCR technique and direct sequencing, while the other mutations was detected only by the direct sequencing. In case of G61E, a 776 bp PCR fragment was digested with TaqI endonuclease, three pieces (630, 75, and 71 bp) were obtained in the case of the wild type, four pieces (322, 308, 75, and 71 bp) were obtained in case of homozygous mutant type and seven pieces (appeared as five bands); 630, 322, 308, two bands of 75 and two bands of 71 bp were obtained in case of heterozygous mutant type as shown in Figure 1a. For the detection of E229K, EarI endonuclease was used. In case of the wild type, three pieces (359, 232, and 166 bp) were obtained, while in the heterozygous mutant type, five pieces (591, 359, 232, and 2 pieces of 166 bp) were obtained [Figure 1b], whereas homozygous mutant type was not detected in the study groups. G61E and E229K were confirmed by performing sequencing using Sanger protocol, all the other single-nucleotide polymorphisms (SNPs) were detected by Sanger sequencing as well as shown in Figure 2a-h.

Table 2

Analysis of the single-nucleotide polymorphisms detected in primary congenital glaucoma patients and controls

Exon/intron location	Nucleotide change	Amino acid change	Reference SNP number	Homozygous/heterozygous	SNPs distribution, n (%)		χ2	Mutation type	Restiction enzyme	Diagnosis method
					Patients	Controls
Exon 2	g.3987G>A	G61E	rs28936700	Homozygous	16 (16)	0 (0)	6.733**	Missense	+TaqI	TaqI digestion in addition to Direct sequencing using sanger protocol
Exon 2	g.3987G>A	G61E	rs28936700	Heterozygous	6 (6)	0 (0)	2.409 (NS)	Missense	+TaqI	TaqI digestion in addition to Direct sequencing using sanger protocol
Exon 2	g.4490G>A	E229K	rs57865060	Heterozygous	9 (9)	7 (7)	0.298 (NS)	Missense	-EarI	EarI digestion in addition to Direct sequencing using sanger protocol
Exon 2	g.6705G>A		Novel	Homozygous	2 (2)	2 (2)	0.00	Missense		Direct sequencing using sanger protocol
Intron 2	g.6813G>A		Novel	Homozygous	2 (2)	3 (3)	0.211 (NS)			Direct sequencing using sanger protocol
Exon 3	g.8184T>C	D449D	rs1056837	Homozygous	12 (12)	14 (14)	0.745 (NS)	Silent		Direct sequencing using sanger protocol
Exon 3	g.8184T>C	D449D	rs1056837	Heterozygous	10 (10)	6 (6)	0.786 (NS)	Silent		Direct sequencing using sanger protocol
Exon 3	g.10068ins10069		Novel	Homozygous	2 (2)	2 (2)	0.00	Frame shift		Direct sequencing using sanger protocol
Exon 3	g.10138ins10139		Novel	Homozygous	3 (3)	2 (2)	0.211 (NS)	Frame shift		Direct sequencing using sanger protocol
Exon 3	g.10191ins10192		Novel	Homozygous	2 (2)	2 (2)	0.00	Frame shift		Direct sequencing using sanger protocol

Loss or gain of restriction sites are denoted - and+respectively. **Significant at P≤0.01. NA: Not available, NS: Nonsignificant, SNP: Single-nucleotide polymorphisms

Figure 1

(a) Restriction fragment length polymorphism polymerase chain reaction genotyping of G61E mutation using TaqI endonuclease on 3% agarose gel. M: 50 bp DNA marker. Lane 1 shows negative control. Lanes 2–6, 8–10, and 12 show the wild type. Lanes 7 and 13 show the homozygous mutant type. Lane 11 shows the heterozygous mutant type. (b) Restriction fragment length polymorphism polymerase chain reaction genotyping of E229K mutation using EarI endonuclease on 3% agarose gel. M: 25 bp DNA marker. Lane 1 shows negative control. Lanes 3, 4, 6, 7, 9, and 11 show the wild type. Lanes 2, 5, 8, 10, and 12 show heterozygous mutant type

Figure 2

Direct sequencing of the CYP1B1 gene coding sequence using Sanger protocol. (a) wild type pattern (G/G) regarding G61E single-nucleotide polymorphism. (b) Heterozygous mutant type (G/A) of G61E. (c) Homozygous mutant type (A/A) of G61E. (d) wild type pattern (G/G) regarding E229K single-nucleotide polymorphism. (e) Heterozygous mutant type (G/A) of E229K. (f) wild type pattern regarding D449D single-nucleotide polymorphism (T/T). (g) Heterozygous mutant type (T/C) of D449D. (h) Homozygous mutant type (C/C) of D449D

Discussion

This is the first genetic study in Iraq that investigates the CYP1B1 polymorphisms behind the PCG. We selected CYP1B1 gene to be screened for mutations in our PCG patients because it is considered as the most PCG-related gene in Middle East countries.[192021] The entire coding region (1626 bp located in exons two and exon three)[22] was screened for mutations because all the reported pathogenic mutations are located in these two exons.[16]

CYP1B1 gene encodes a monooxygenase CYP1B1 enzyme that considered as phase I metabolizing enzyme, able to metabolize xenobiotics[23] and also endogenous compounds such as retinoids, estrogen, and testosterone.[2324] CYP1B1 enzyme catalyzes several reactions involved in the endogenous compounds metabolism that include retinals, 17 β-estradiol, melatonin, and arachidonic acid.[25] CYP1B1 was reported to be included in the synthesis pathway of retinoic acid.[2627] Functional analysis of CYP1B1 mutations associated with PCG showed irregular metabolism of retinol by distorted proteins.[28] CYP family of enzymes includes 70%–80% of the total phase I xenobiotic metabolizing enzymes (XMEs).[29] Phase I XMEs are known for their ability of both metabolic activation and detoxication. The metabolic activation of xenobiotics regularly leads to create electrophilic intermediates. Phase II XMEs help the electrophilic intermediates to conjugate with moieties such as acetate, sulfate, mercapturic acid, glutamine, glycine, and glucoside, yielding very hydrophilic compounds that can be easily expelled to complete the cycle of detoxication.[30] Even though the united effects of phase I and phase II XMEs mostly result in the detoxication of destructive chemical compounds, on the way from the parent compound to the expelled product, there is a chance for reactive oxygenated intermediates to be formed through the CYP-mediated reactions, therefore affecting the oxidative stress state of the cells.[30]

CYP1B1 is widely expressed in TM and the ciliary body in the eye. The development of the TM, which is the most important tissue in the case of PCG, depends critically on the CYP1B1 enzyme; therefore, mutations that are detrimental to the function of CYP1B1 can be disrupting to the proper development of the TM, which in turn would obstruct AH outflow, resulting in the elevation of IOP.[3132]

The AH in human glaucoma patients has a significant reduction in total anti-oxidant capacity (TAC) because of the increased oxidative stress in the glaucomatous eye, elevated oxidative stress can cause trabecular dysgenesis that leads to PCG.[33] Under H2O2 treatment (high oxidative stress), the TM cells are less viable indicating deficiency in antioxidant capacity to reduce reactive oxygen species (ROS) in the cell. CYP1B1 enzyme activity straightly determines the oxidative status of the TM cells; in other words, CYP1B1 deficiency directly leads to increased oxidative stress in the glaucomatous eye.[343536] On the other hand, it was reported that higher CYP1B1 enzymatic activity causes 4-OH-estradiol accumulation leading to the generation of quinones, which encourage the formation of ROS, increased oxidative stress may cause cell death in TM and retinal ganglion cells.[25]

CYP1B1 Mutations were found in 78% of our patients’ group, this ratio is considered comparable to the Omani (78%), Iranian (78%), and Saudi (76%) populations[19202137] and more than the ratio (47%) reported for the Moroccan population.[31]

We found that E229K SNP, which is existed in a heterozygous model only, is detected both in patients and controls with close ratios (9% for the patients and 7% for the controls) [Table 2].

By combining the results obtained from our previous report, in which we investigated the impact of oxidative stress in PCG,[38] with the results obtained from the current study it can be concluded that there is no influence for the presence of E229K SNP on the CYP1B1 enzyme, which ranged between 0.822 ± 0.20 ng/ml in the absence of the SNP and 0.871 ± 0.12 ng/ml for the heterozygous mutant type of E229K mentioning that homozygous mutant type was not detected in our study participants. In the same manner and as a result for the CYP1B1 enzyme function TAC and malondialdehyde (MDA) which considered as biochemical parameters reflecting the oxidative state, were measured and there were no significant differences in TAC and MDA in case of the presence or absence of E229K SNP [Table 3]. These facts may exclude E229K from being a disease-related allele. The obtained result is consent with the findings of El-Gayar et al. who ruled out heterozygous E229K from being a cause for PCG in one of their study families,[21] many other studies also reported that heterozygous E229K is found in the patients and healthy carriers.[3940] On the other hand, other studies reported that homozygous and compound heterozygous E229K alleles are associated with severe phenotype.[9161841] Furthermore, López-Garrido et al. stated that heterozygous E229K could increase the susceptibility for the development of primary open-angle glaucoma in the Spanish population.[42]

Table 3

The correlation between CYP1B1 single-nucleotide polymorphisms with CYP1B1 enzyme, total anti-oxidant capacity, and malondialdehyde concentrations

Genotype	Mean ± SE
	CYP1B1 (ng/ml)	TAC (U/ml)	MDA (μmol/L)
G61E
CC (wild type)	0.844 ± 0.12	2.619 ± 0.45	0.769 ± 0.25
CT (heterozygous mutant type)	0.754 ± 0.58	1.988 ± 0.68	0.929 ± 0.23
TT (homozygous mutant type)	1.028 ± 0.37	0.766 ± 0.20	1.526 ± 0.08
LSD value	1.013 (NS)	0.625**	0.432**
E229K
CC (wild type)	0.822 ± 0.20	4.78 ± 1.83	0.779 ± 0.25
CT (heterozygous mutant type)	0.871 ± 0.12	2.609 ± 0.49	1.006 ± 0.06
LSD value	0.613 (NS)	3.632 (NS)	0.379 (NS)
D449D
TT (wild type)	0.830 ± 0.13	2.898 ± 0.57	0.959 ± 0.08
CT (heterozygous mutant type)	1.033 ± 0.20	1.975 ± 0.68	0.992 ± 0.12
CC (homozygous mutant type)	0.988 ± 0.40	2.518 ± 0.42	0.990 ± 0.12
LSD value	0.947 (NS)	2.115 (NS)	0.315 (NS)

**Significant at P ≤ 0.01. SE: Standard error, NS: Nonsignificant, TAC: Total antioxidant capacity, MDA: Malondialdehyde

A silent mutation D449D is another SNP that was detected in our study groups, it was detected in both patients and controls and this agrees with an earlier report by Stoilov et al. who also detected D449D in both PCG patients and healthy individuals in the Brazil population.[43] We found that D449D is similar to E229K SNP, has no influence on the CYP1B1 enzyme, TAC and MDA levels and it may do not considered as pathogenic SNP. Unlike the other SNPs detected in this study, G61E was detected in the patients only; it also has no obvious effect on the level of CYP1B1 enzyme, which ranged between 0.844 ± 0.12 ng/ml for the wild type to 1.028 ± 0.37 ng/ml for homozygous mutant type, but we found that TAC decreased significantly in case of the presence of this SNP, it ran between 2.619 ± 0.45 U/ml in the absence G61E and 0.766 ± 0.20 U/ml in case of G61E is present. Correspondingly, MDA showed a significant increase in case of the presence of this SNP, and it ran between 0.769 ± 0.25 μmol/L in the absence G61E and 1.526 ± 0.08 μmol/L in the presence this SNP [Table 3]. It became clear that G61E is related to high oxidative stress. These findings indicate that G61E does not affect the concentration of CYP1B1 enzyme concentration, but it could affect the enzyme activity, which is in correspondence to the oxidative status representing by TAC and MDA. This is consent with the earlier report by Chavarria-Soley et al. who demonstrated that glycine 61 residue is located at the gate of the substrate entry channel to the active site of the enzyme, and residues in this section of the enzyme structure was shown to affect both steric and in electrostatic entrance of the substrate, thus affecting the enzyme activity without affecting the stability and the abundance of the enzyme.[44] Thus, higher enzymatic concentration does not necessarily mean higher enzymatic activity. The increased concentration of the enzyme could have a genetic cause or it could be a result for environmental factors such as increased oxidative stress caused by endogenous and exogenous sources, which could be an inducer for the elevation in the enzyme concentration.[4546]

Other novel SNPs (g.6705G>A, g.6813G>A, g.10068ins10069, g.10138ins10139, and g.10191ins10192) were detected with low distributions both in patients and controls [Table 2], and they need further investigation to discover if they have a role in the pathogenesis of PCG.

Conclusions

This study confirms that CYP1B1 gene has an important role in the pathogenesis of PCG in the Iraqi population. G61E which was detected in patients only and was associated with increased oxidative stress, it is considered as the disease-related allele. While all other detected SNPs (the previously reported SNPs [E229K, D449D] and the novel SNPs [g.6705G>A, g.6813G>A, g.10068ins10069, g.10138ins10139, and g.10191ins10192]) were detected both in patients and controls and have no clear effect on, enzyme concentration or the oxidative status; therefore, they cannot be considered as disease-related alleles.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.