Development of multiplex real-time PCR for rapid identification and quantitative analysis of Aspergillus species.

The identification of Aspergillus species and azole resistance is highly important for the treatment of invasive aspergillosis (IA), which requires improvements in current fungal diagnostic methods. We aimed to develop multiplex real-time PCR to identify major Aspergillus section and azole resistance. BenA and cyp51A genes were used to design primers, probes, and control DNA for multiplex PCR. Qualitative and quantitative analysis was conducted for 71 Aspergillus and 47 non-Aspergillus isolates. Further, the limit of detection (LOD) and limit of quantitation (LOQ) from hyphae or conidia were determined according to the culture time. Newly developed real-time PCR showed 100% specificity to each Aspergillus section (Fumigati, Nigri, Flavi, and Terrei), without cross-reaction between different sections. In quantitative analysis of sensitivity measurements, LOD and LOQ were 40 fg and 400 fg, respectively. Melting temperature analysis of the cyp51A promoter to identify azole resistance showed temperatures of 83.0 ± 0.3°C and 85.6 ± 0.6°C for susceptible A. fumigatus and resistant isolates with TR34 mutation, respectively. The minimum culture time and fungal colony size required for successful detection were 24 h and 0.4 cm in diameter, respectively. The developed multiplex real-time PCR can identify common Aspergillus sections quantitatively and detect presence of the TR34 mutation. Further, this method shows high sensitivity and specificity, allowing successful detection of early-stage fungal colonies within a day of incubation. These results can provide a template for rapid and accurate diagnosis of IA.

Introduction

Invasive aspergillosis (IA) is a fatal disease caused by Aspergillus species that occurs mainly in immunocompromised patients [1]. Common species that cause IA include Aspergillus fumigatus, A. flavus, A. terreus, and A. niger. Recently, global studies have reported “cryptic species” such as A. lentulus, A. udagawae, and A. tubingensis and increasing antifungal resistance. Above all, rapid and accurate fungal diagnosis is important, as the morbidity and mortality of IA remain high, and diagnosis and treatment impart a significant economic burden [2-5].

The method of Aspergillus species identification includes morphologic identification of fungi through culture and molecular identification via the polymerase chain reaction (PCR) [5, 6]. The former method is currently the gold standard; however, its use can depend largely on clinical specimen quality and the proficiency of the microbiology test personnel [6, 7] The latter method, molecular identification of filamentous ascomycetes, is mainly conducted through sequence analysis of the internal transcribed spacer (ITS) region, and β-tubulin (benA) and calmodulin (CaM) genes are also used for cryptic species-level identification [2, 8, 9]. However sequencing-based identification is time-consuming, as it takes 5–17 days to reach the final diagnosis; specifically, it takes 3–14 days to produce conidia following fungal culture from the clinical sample, followed by an additional 2–3 days to extract DNA from the conidia and obtain sequencing analysis results [10, 11].

Therefore, to take advantage and overcome the shortcomings of the multi-step molecular diagnosis method, there have been many efforts to explore new diagnostic approaches [6-14]. In this study, we aimed to develop a method for rapid molecular identification by using a multiplex platform that allows for quantitative analysis of major Aspergillus sections and rapid detection of azole resistance.

Material & method

Fungal isolates and culture

The fungal isolates used in this study were representative strains of clinical and environmental isolates stored anonymously, and standard strains including A. fumigatus (ATCC 16424; American Type Culture Collection, Manassas, VA, USA), A. terreus (ATCC 10690), A. flavus (ATCC 16883), and A. niger (ATCC 16888) [2, 15]. The representative Aspergillus isolates were selected for each sequence type according to benA and cyp51A sequencing results. The Aspergillus isolates used in this study included 20 strains of A. fumigatus, 2 strains of A. lentulus, 1 strain of A. turcosus, 1 strain of A. udagawae, 2 strains of A. luchuensis, 11 strains of A. awamori, 11 strains of A. niger, 12 strains of A. tubingensis, 4 strains of A. flavus, 1 strain of A. nidulans, 2 strains of A. sydowii, 3 strains of A. terreus, and 1 strain of A. subramanianii, which were registered to GenBank in our previous study [2]. In addition, 38 non-Aspergillus filamentous ascomycetes (No. 1–38), 1 non-filamentous ascomycetes (No. 39), and 8 non-ascomycetes molds (No. 40–47) were used to measure the specificity of the developed molecular identification method (S1 Table). Fungal isolates were cultured using Sabouraud’s dextrose agar medium (Becton-Dickinson Labware, Franklin Lakes, NJ, USA) in an incubator at 35°C for 1–10 days. Conidia or hyphae were harvested for genomic DNA (gDNA) extraction using 0.85% NaCl with 0.05% Tween 20. Pellets of conidia or hyphae were stored at −80°C until DNA extraction. The Institutional Review Board of Seoul St. Mary’s Hospital approved the research protocol of this study (KC16SISI0307) and waived informed consent for use of fungal isolates stored anonymized.

DNA extraction and purification

To optimize DNA extraction from fungal isolates, the following steps were conducted. In brief, the hyphae pellets stored in the deep freezer were placed in 500 μL Trizol reagent (Invitrogen, Carlsbad, CA, USA), and the conidia pellets were placed in 500 μL of yeast cell lysis solution (MasterPure™ Yeast DNA Purification Kit, Epicentre, Madison, WI, USA); subsequently, the pellets were subjected to two freeze-thaw cycles. After adding RNase A (Epicentre), incubating at 5 min in room temperature. And bead-beating (1.0 mm zirconium beads; Sigma-Aldrich, St. Louis, MO, USA) was repeated 3–5 times at 12,500 rpm for 5 min and cooled on ice at 1 min in between time. Then, the supernatant was obtained after centrifugation (>12,000 × g, 4°C, 5 min). In the method using Trizol reagent, chloroform (Sigma-Aldrich) was added and reacted at room temperature for 5 min; in the method using yeast cell lysis solution, MPC protein precipitation reagent (Epicentre) was added and vortexed. The sample was centrifuged (>12,000 × g, 4°C, 15 min) to collect the supernatant, which was then treated with isopropanol (Sigma-Aldrich). A QIAamp DNA Mini spin column (Qiagen, Hildren, Germany) was used to purify fungal DNA. The extracted DNA concentration was measured using Quant-iT™ PicoGreen™ dsDNA Reagent (Invitrogen) according to the manufacturer’s protocol. In the case that further DNA purification was required, the DNeasy PowerClean Pro CleanUp Kit (Qiagen) was used according to the manufacturer’s protocol. The extracted DNA was stored at −20°C before the next experiment.

Design of primers and probes

In this study, the sequences of clinical and environmental Aspergillus isolates were analyzed to design new primers for amplifying the relatively short sequence of exons 5–6 of the benA gene (for A. fumigatus AF293 strain benA gene, GCA_000002655.1_ASM265v1, locus_tag = AFUA_1G10910, location no. 544–803) (Table 1). The nucleotide sequence of Aspergillus isolates was analyzed using MegAlign Pro 15 (DNASTAR, Madison, WI, USA). A probe that could detect filamentous ascomycetes was designed in exon 5, and other probes were designed for the intron between exons 5 and 6 (S1 Fig). For the amplification and simultaneous detection of the benA target, dimer and hairpin formation of primers and probes was measured, and heterodimer delta G values ranged from −3.6 to −8.9 kcal/mol of five probe.

Table 1

Nucleic acid sequences of biomarkers (primers or/and probes set) designed for multiplex identification in this study.

PCR	Target species	Primers / probes	Sequence (5′ → 3′)	Target loci	Product size	Reference
Multiplex real-time PCR primer	Aspergillus spp.	benA F3	TCGGTGTAGTGACCCTTGG	β-tubulin (benA)	254 ~ 272 bp	In this study
		benA R2	GCTGGAGCGYATGAACGTCT
	A. tubingensis	Tubcyp 1F46	CTCGTTGCGATAGTCTTKAATGT	cyp51A	263 bp
		Tubcyp 1R308	GCCCAAGTATACGGTKGTCTTTT
	A. fumigatus	TR F1	TAATCGCAGCACCACTTCAG		WT‡: 111 bp	[16]
		TR R1	AGGGTGTATGGTATGCTGGAA		TR34 : 145 bp	In this study
Hydrolysis probe	Ascomycetes	Asco 1F9	6-FAM-AVACGAAGTTGTCGGGRC-TAMRA	β-tubulin (benA)	18 bp	In this study
	Section Fumigati	Fumi 1R2	HEX-CGGCAACATCTCACGATCTGACTCGC-BHQ1		26 bp
	Section Nigri	Nig 1R26	6-FAM-ACTTCAGCAGGCTAGCGGTAACAAGT-TAMRA		26 bp
	Section Flavi	Flavi 1F18	HEX-CGGTCAGGAGTTGCAAAGCGTTTTCA-BHQ1		26 bp
	Section Terrei	Terrei 1R29	6-FAM-ACCATCCTGGGACAGATTCTYCACGC-TAMRA		26 bp
	A. tubingensis	Tubcyp 201	6-FAM-GTCAGYCACTGTCCATATGCGATTG-TAMRA†	cyp51A	25 bp

† The underlined area is a probe synthesized by LNA.

‡ Wild type

We designed two staged probe sets: For the first stage, primer and probe sequences specific to four major Aspergillus sections (Fumigati, Nigri, Terrei, and Flavi) were designed, and a control probe sequence was also determined to identify filamentous ascomycetes. Based on the analysis using the OligoAnalyzer web program (https://sg.idtdna.com/pages/tools/oligoanalyzer) for each primer and probe, the final biomarkers were developed for multiplex molecular identification (Table 1). The specificity of the synthesized probe was evaluated using BLASTn (https://blast.ncbi.nlm.nih.gov/Blast.cgi), and the presence of cross-reactions between sections was identified. For the second stage, primers and probes specific for both TR mutations in the cyp51A promoter and A. tubingensis were designed (Table 1). The A. tubingensis probe was designed for a specific sequence in the cyp51A gene using locked nucleic acid to increase specificity. Promoter mutation was detected by melting temperature analysis instead of the probe detection method.

Synthesized the control DNA

More controls need more wells. In clinical settings, more control leads to fewer test samples, especially in quantitative analysis. Therefore, we designed a synthesized control including all probes (5 probes). At first, we aligned each consensus sequence of benA in Aspergillus species (S1 Fig). We used benA sequence of A. fumigatus as the template and designed to have each probe sequence (conserved probe of filamentous ascomycetes, Fumigati, Nigri, Flavi, and Terrei) (Table 2). And then, the designed DNA was synthesized genetically (Bionics Corporation, Seoul). We cloned it into the pUC57 plasmid, and it was transformed into Escherichia coli (E. coli) BL21 strain. Plasmid DNA of transformants was extracted, tested for the multiplex, and used as control DNA.

Table 2

Positive control nucleic acid sequences for Aspergillus real-time PCR assays.

Oligo

DNA Sequence (5′ → 3′)

Aspergillus Positive Control DNA (276 bp)

ATCGTAAGCTTTCGGTGTAGTGACCCTTGGCCCAGCCGAAGACGAAGTTGTCGGGACGGACGGTCAGGAGTTGCAAAGCG            benA F3 primer                Asco 1F9 probe               Flavi 1F18 probeTTTTCAGCACGGACAACTCAGGGACGGTGTGATCTAACCTCATGGTACGCGTGGAGAATCTGTCCCAGGATGGTAGAACGG                  Terrei 1R29 probeCACGAGGTAGCGAGTCAGATCGTGAGATGTTGCCGAAATAGTATAAATCAAGAGACTTGTTACCGCTAGCCTGCTGAAGTAA             Fumi 1R2 probe                 Nig 1R26 probeATAGACGTTCATGCGCTCCAGCGAGCTCATCGT       benA R2 primer

Qualitative and quantitative analysis by multiplex real-time PCR

Qualitative and quantitative analyses were conducted using the LightCycler® 480 Probes Master Kit (Roche, Basel, Switzerland) and Roche LightCycler® 480 Instrument II (Roche). The primer and probe concentrations used in the experiment were 0.5 μM and 0.1 μM, respectively. The amplification process was conducted as follows: 10 min of pre-denaturation at 95°C followed by 40 cycles of denaturation at 95°C for 25 s, annealing at 58°C for 30 s, and extension at 72°C for 35 s. For quantitative analysis, 4 ng fungal gDNA and 4 pg Aspergillus positive control DNA were each subjected to 10-fold serial dilutions to reach 4 fg/μL and 4 ag/μL, respectively. Melting peak analysis was conducted using the LightCycler® 480 SYBR Green I Master Kit (Roche) and Roche LightCycler® 480 Instrument II (Roche).

The results were analyzed using LightCycler® 480 Software version 1.5.0 SP3 (Roche). The quantification cycle (Cq) was calculated automatically by the program based on curve fitting to the baseline curve subtraction. A standard curve was obtained using the measured results, and the slope value, mean Cq value (MCq), and standard deviation (SD) were calculated. The amplification efficiency (Efficiency, E [%]) was calculated by the following equation: [10(−1/(slope)) − 1] × 100. Sensitivity analysis of the developed identification method was conducted using the limit of detection (LOD) and limit of quantitation (LOQ). The LOD was set to the minimum value detected above 95% of analysis results (<5% false negative result). The LOQ was determined to be a value of MCq − (2 × SD) below 35 [17, 18].

All experiments were conducted in accordance with the “Minimum Information for the Publication of Real-Time Quantitative PCR Experiments” (MIQE) guidelines [19, 20]. In addition, the experiment was conducted in a biosafety cabinet in an area separate from the DNA extraction area to prevent contamination from aerosol and carryover. To remove contaminants on the surface, 1.5% sodium hypochlorite (NaOCl) was used, followed by 70% EtOH. The experiment was conducted using filter tips (TipOne; StarLab, Hamburg, Germany) after removing all possible contaminants.

Inhibition testing

The SPUD assay was used as an exogenous amplification control [19]. The SPUD inhibition assay results generate the expected baseline Cq value for the SPUD amplicon and use it as the basis for the uninhibited assay. Based on this, Cq values exceeding 1 cycle or more of other DNA amplifications indicate the presence of a PCR inhibitor. The reaction of each qPCR was carried out using the LightCycler 480 SYBR Green I Master Kit (Roche). The SPUD plasmid DNA was 1.3 X 105 genome copy number (copy/μL) and the primer 0.5 μM. And sample extract was added 4ng gDNA. Thermal cycling conditions were 10 min of pre-denaturation at 95° C followed by 40 cycles of denaturation at 95° C for 10 s, annealing at 60° C for 10 s, and extension at 72° C for 20 s.

Results

Qualitative analysis to determine probe specificity

Multiplex real-time PCR of 118 fungal DNA samples showed that the probes specifically amplified the Aspergillus section as presented in Table 3. No amplification was observed in non-Aspergillus isolates. 1 non-filamentous ascomycetes (No. 39), and 8 non-ascomycetes molds (No. 40~47) showed no amplification of all primers and probes, including the Asco 1F9 probe. Further, the Aspergillus positive control DNA was amplified in all primers and probes designed for the first stage, and there was no interference between probes. For the second stage, real-time PCR was performed for 20 A. fumigatus (17 wild-type and 3 mutant strains), 2 A. lentulus, 1 A. turcosus, and 1 A. udagawae strains, and the melting peaks were analyzed. The melting temperature was 83.0 ± 0.3°C in A. fumigatus wild-type samples and 85.6 ± 0.6°C in mutant isolates with TR34 (S2 Fig). Aspergillus section Fumigati isolates were not amplified except for A. fumigatus. In addition, one primer pair (Tubcyp 1F46 and Tubcyp 1R308) and one probe (Tubcyp 201) designed to identify A. tubingensis from Aspergillus section Nigri were tested on 36 Aspergillus isolates of section Nigri in real-time PCR analysis. All 12 A. tubingensis isolates with different cyp51A sequence types were amplified (Table 3); other isolates were not amplified.

Table 3

Specific amplification of the designed probes.

Probe (n)	Aspergillus section					Non-Aspergillus (47)
	Fumigati (24)	Nigri (36)	Flavi (4)	Terrei (3)	other (4)
Asco 1F9	24 / 24 (100%)	36 / 36 (100%)	4 / 4 (100%)	3 / 3 (100%)	4 / 4 (100%)	30 / 38† (63.82%)
Fumi 1R2	24 / 24 (100%)	0 / 36 (0%)	0 / 4 (0%)	0 / 3 (0%)	0 / 4 (0%)	0 / 47 (0%)
Nig 1R26	0 / 24 (0%)	36 / 36 (100%)	0 / 4 (0%)	0 / 3 (0%)	0 / 4 (0%)	0 / 47 (0%)
Flavi 1F18	0 / 24 (0%)	0 / 36 (0%)	4 / 4 (100%)	0 / 3 (0%)	0 / 4 (0%)	0 / 47 (0%)
Ter 1R29	0 / 24 (0%)	0 / 36 (0%)	0 / 4 (0%)	3 / 3 (100%)	0 / 4 (0%)	0 / 47 (0%)
Tubcyp 201	0 / 24 (0%)	12 / 12 (100%)	0 / 4 (0%)	0 / 3 (0%)	0 / 4 (0%)	0 / 47 (0%)

† Ratio of non-Aspergillus Filamentous ascomycetes

Probe sensitivity and efficiency measurement

Quantitative analysis results of gDNA of major Aspergillus sections are shown in Fig 1. There was no interference during the amplification of two probes analyzed in the multiplex assay, and gDNA was amplified from 4 ng/μL to 40 fg/μL in all probes. Similarly, amplification occurred without interference in the positive control DNA, which was amplified from 4 pg/μL to 40 ag/μL in all probes. The standard curve obtained from plotting gDNA concentration on the X-axis and Cq value on the Y-axis yielded slope values, intercept values, and R2 –in the ranges of −3.2119 to −3.7230, 40.316 to 43.702, and 0.9979 to 0.9998, respectively. The amplification efficiency of each probe was found to be 89.8% ~ 104.8% in gDNA and 90.0% ~ 99.4% in Control DNA (Table 4). The LOD and LOQ of gDNA in all probes was 40 fg/μL (1.0–1.2 × 100 genome copies/μL) and 400 fg/μL (1.0–1.2 × 101 genome copies/μL), respectively. For positive control DNA, all probes showed similar correlations and regression analysis results, as shown in Table 5. According to the sensitivity analysis results using this data, the LOD and LOQ were calculated as 40 ag/μL (1.2 × 101 genome copies/μL) and 400 ag/μL (1.2 × 102 genome copies/μL), respectively (Table 5). The quantitative analysis results for Aspergillus gDNA and positive control DNA showed similar correlations and regression coefficients for all probes.

Fig 1

Sensitivity measurements of Aspergillus gDNA and quantification curve.

Aspergillus gDNA and Aspergillus positive-control DNA were subjected to multiplex real-time PCR using Fumi 1R2, Nigri 1R26, Flavi 1F18, Terrei 1R29, Asco 1F9 and the results were presented as a standard curve. The spot is the average of Cq ± SD and n = 6. Abbreviations. gDNA; genomic DNA, SD; Standard Deviation.

Table 4

Correlation and regression analysis between two DNA.

Probe name	Genomic DNA				Control DNA
	Range	E (%)†	Slope	R2	Range	E (%)†	Slope	R2
Fumi_1R2	21.1 ~ 38.6 (± 0.39)	92.2	-3.5245	0.9993	21.5 ~ 38.6 (± 0.20)	90.1	-3.5844	0.9998
Nig_1R26	21.0 ~ 39.6 (± 0.20)	89.8	-3.5930	0.9983	21.1 ~ 39.1 (± 0.31)	90.0	-3.5866	0.997
Flavi_1F18	20.9 ~ 37.4 (± 0.55)	92.6	-3.5132	0.9995	21.9 ~ 39.1 (± 0.74)	94.0	-3.4755	0.999
Ter_1R29	20.9 ~ 37.0 (± 0.62)	104.8	-3.2119	0.9998	21.1 ~ 38.9 (± 0.73)	92.5	-3.5168	0.9978
Asco_1F9	21.0 ~ 37.6 (± 0.87)	103.5	-3.2412	0.9979	22.0 ~ 38.5 (± 0.13)	99.4	-3.3373	0.9975

†E: Efficiency

Table 5

Correlation and regression analysis between two DNA.

gDNA / control DNA	Fumi 1R2	Nig 1R26	Flavi 1F18	Ter 1R29	Asco 1F9
4 ng / 4 pg	21.07 / 21.50	21.01 / 20.12	20.94 / 21.92	20.98 / 21.20	20.93 / 22.08
400 pg / 400 fg	24.30 / 25.21	25.21 / 24.41	24.59 / 25.00	24.31 / 24.41	24.50 / 25.45
40 pg / 40 fg	28.34 / 29.01	29.17 / 28.70	28.07 / 28.42	27.41 / 27.26	27.88 / 28.15
4 pg / 4 fg	31.65 / 32.55	32.53 / 32.00	31.41 / 32.41	30.79 / 30.54	30.83 / 31.37
400 fg / 400 ag	35.05 / 36.23	36.47 / 36.06	35.29 / 35.58	33.94 / 33.58	33.59 / 34.57
40 fg / 40 ag	38.64 / 39.69	39.65 / 39.12	38.44 / 39.10	37.01 / 36.95	37.64 / 36.52

Sensitivity measurement for molecular identification method by culture time

Four reference strains were used to measure the fungal colony diameter over the culture time. The size of A. fumigatus, A. niger, A. terreus, and A. flavus colonies was 0.2–1.5 cm at 18–24 h after incubation, 1.4–5.2 cm after 48 h, and 4.0–7.8 cm after 72 h. Further, conidia formation was observed after 72 h. Multiplex real-time PCR using DNA extracted from early-stage colonies showed successful amplification in hyphae-state after culturing for 24 h. The minimum colony diameter to confirm colony DNA amplification in all probes was 0.4 cm (confidence interval, CI > 95%), and the minimum culture time was 18–24 h. The result of multiplex real-time PCR of DNA from hyphae-state colonies of 0.4 cm in diameter for all isolates showed Cq values of 31.425 ± 0.245 for A. fumigatus, 32.345 ± 0.185 for A. niger, 32.63 ± 0.36 for A. terreus, and 32.16 ± 0.12 for A. flavus. This suggested that amplification occurred within the range of the standard curve of Aspergillus positive control DNA used as standard DNA, which is between approximately 1.0–1.2 × 102 and 1.0–1.2 × 101 copies/μL when calculated with respect to genomic DNA copy number.

Inhibition

Each of the DNA extracts material was included in a SPUD assay and results indicated that no inhibition was present in gDNA samples (S3 Fig).

Discussion

In this study, a molecular identification method for major Aspergillus sections (Fumigati, Nigri, Flavi, and Terrei) and filamentous ascomycetes were developed based on the benA gene, which reduced diagnosis time compared with the current methods of morphological or molecular identification based on ITS sequencing. Also, probe-based real time PCR can more sensitive, specific, fast, and used in a quantitative than multiplex PCR. For this reason, probe-based real time PCR was used in the design. In addition, TR mutation and the cyp51A gene were used to identify azole-resistant A. fumigatus and A. tubingensis. Instead of probe-based sequencing, melting temperature analysis methods were selected for faster and simultaneous analysis. The designed probes and primers were used for qualitative and quantitative analyses of 118 clinical and environmental isolates. Sensitivity and specificity were evaluated for the developed multiplex real-time PCR method. Further, both LOD and LOQ with minimum culture time were analyzed to evaluate to the applicability of the method for early diagnosis.

For the molecular identification of mold, there is a need to improve the process and purity of DNA extraction. Extracted DNA quality and impurity contents, such as PCR inhibitors, differ between each clinical and environmental isolate; thus, it is difficult to conduct quantitative measurements and evaluate the sensitivity of molecular identification. In this study, we optimized methods to extract mold (filamentous fungal) DNA. We did lysis of clinical and environmental mold using enzyme and Qiagen purification kit. However, their purity was not good for quantitative analysis, and many variables among species and strains. So, we tried to look for the efficient lysis and complete removal of protein and PCR inhibitors, and then it has been tested in hundreds of mold strains. First, freeze-thawing and bead-beating methods were used for mechanical lysis, and different lysis and protein removal solutions were used for the conidia and hyphae (hyphae, Trizol solution and isopropanol; conidia, Epicentre’s lysis buffer and protein precipitation solution). Some researchers suggested bead beating could be more efficient at lysing fungus than enzymatic lysis [21]. And, Trizol reagent (Invitrogen) led to a better yield in the hyphae, but affected the purity in conidia as the handling process during supernatant isolation and showed the incomplete lysis in conidia of some strain. Therefore, we performed lysis conidia using different lysis buffers. In the purification process, the most commonly used method was column chromatography for final purification, and high-purity fungal DNA was obtained in almost all strains. For accurate quantification, Quant-iT™ PicoGreen™ dsDNA Reagent (Invitrogen) was used, which has a lower error rate compared with conventional OD methods and offers advantages in quantitative analysis and sensitivity measurements.

To establish a multiplex real-time PCR method with high specificity and sensitivity, benA and cyp51A were used to select a primer pair and probe specific to the major Aspergillus sections, and benA has been used as an important molecular marker to analyze the phylogenic relationship between filamentous ascomycetes [5, 22]. The genetic analysis of benA is useful to distinguish cryptic species, which is not possible with ITS sequencing. Although there are differences between species, approximately 560 bp (bt2ab region: exons 3−6) can be amplified for nucleotide sequence analysis. However, in this study, the region was designed to be shorter (exons 5−6) to be more suitable for the multiplex probe-based real-time PCR method, which improved efficiency while maintaining specificity (S1 Fig, Table 1). While developing a probe-based method for rapid simultaneous detection, we also designed benA primers for further sequence analysis to achieve specificity toward each species after amplification/probe detection. This could specifically amplify certain Aspergillus sections through multiplex real-time PCR, reflecting high specificity without cross-amplification of other fungal species. Further, quantification analysis of each probe showed an extremely small error rate, and approximately 101 genomic copies could be detected, indicating high sensitivity. These results show that the developed method have similar sensitivity to existing methods used for detection and quantification analysis [4, 19].

Regarding the use of standard DNA as a control for a developed method, gDNA usage for each Aspergillus strain is complex and requires much time; furthermore, many standard DNA types for specific probes are needed. Therefore, in this study, synthetic DNA was designed and used as standard DNA that reacted with all probes. The developed Aspergillus positive control DNA was amplified in all benA probes that identified different Aspergillus sections. Further, reconstructed Aspergillus positive control DNA for quantitative analysis was used to compare analyses with a standard curve, which correlated with the standard gDNA curve (Table 5). These results indicate that this DNA can be used as the control for sample gDNA quantification, to verify the primers and probe used in the experiment, and to measure experimental sensitivity and specificity. Also, use of multiple control DNAs complicates the experiment and can increase the cost of diagnostics by using multiple wells. To solve this problem, control DNA was synthesized and used. The synthetic DNA could be applied with the newly designed benA probe in the field for IA diagnosis.

Among the sections amplified in the first stage, azole resistance in A. fumigatus and A. tubingensis of section Nigri can be detected using multiplex real-time PCR primer/probes designed in the second stage. Using isolates from Aspergillus section Fumigati, the melting peak and temperature were identified for the primers that specifically amplified the cyp51A TR region in A. fumigatus and gDNA subjected to a 10-fold serial dilution. Wild-type isolates and mutant isolates with TR34 showed different melting temperatures. In particular, A. tubingensis revealed intrinsically higher azole minimum inhibitory concentrations according to previous studies [2, 3, 5]. The A. tubingensis-specific primers and probe designed in this study showed that only A. tubingensis was amplified without affecting other Aspergillus in section Nigri.

Interestingly, we tried to use DNA extracted from early-stage fungal colonies for PCR analysis and determined that the minimum diameter and culture time required for successful PCR detection were 0.4 cm and 24 h, respectively. The same results were obtained for four probes, suggesting that fungal colony hyphae cultured for 24 h can be used for earlier molecular identification. Although there may be some limitations in early diagnosis, our developed method can dramatically reduce the minimum culture period for molecular identification within 2–3 days. In other words, it has been reduced by 3 to 14 days compared to the previous method.

In conclusion, first, newly designed primers and probes were used to conduct a multiplex real-time PCR assay, and high sensitivity and specificity was confirmed through clinical and environmental fungal isolates. Second, azole-resistant A. fumigatus and A. tubingensis were detected, and major Aspergillus sections were identified. Third, this real-time PCR method resulted in successful amplification specific to each section with DNA extracted from Aspergillus hyphae in the early phases of the cultured colony. This method can provide a template for rapid and quantitative diagnosis of IA. Fourth, Aspergillus positive control DNA designed for the standard control permitted quantitative analysis. It is expected that further research on new biomarkers will be conducted using the database obtained through this study. And we will approach the LOQ and LOD both in fungal DNA extraction and multiplex real time PCR from clinical specimens for clinical use in further study.

Probe and primer design by sequence comparison analysis of major Aspergillus species.

The MegAlign Pro program from DNAStar Lasergene (version 15 software package) was used to compare the sequence analysis by using Clustal Omega alignment. The comparison of benA sequences in Aspergillus species. All benA sequences in Aspergillus were compared and regions specific to the section without affecting other sections were selected as probe candidates, and primers that included all selected regions were chosen. Finally, one pair of primers and five probes were selected.

(TIF)

Click here for additional data file.

Analysis of melting peak for two types of Aspergillus fumigatus showing different azole resistance.

Wild-type (WT) isolate without azole resistance in A. fumigatus and azole-resistant isolate with TR34 sequence were used in the experiment. A pair of primers that amplified the region in the cyp51A promotor known to be involved in azole resistance was used for the melting peak analysis. DNA was subjected to a 10-fold dilution (4 ng to 40 fg). The melting temperatures from the melting curve analysis were different: 83.0ºC ± 0.3ºC in WT and 85.6ºC ± 0.6ºC in azole-resistant type (n = 3).

(TIF)

Click here for additional data file.

SPUD analysis of SPUD plasmid DNA and genomic DNA.

Quantitative PCR was performed using positive control SPUD plasmid DNA (1.3 × 105 copies / μL, n = 20) and various genomic DNAs containing the same amount of SPUD (n = 70), and the results were plotted on a box plot. It can be seen that the Cq value between the two DNAs varies within 1 cycle. The experiment repeated three times.

(JPG)

Click here for additional data file.

Non-Aspergillus species used for negative control in qualitative analysis.

(DOCX)

Click here for additional data file.

30 Dec 2019

PONE-D-19-32117

Development of Multiplex Real-time PCR for Rapid Identification and Quantitative Analysis of Aspergillus Species

PLOS ONE

Dear Dr Lee,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Feb 10 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Ruslan Kalendar, PhD

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following financial disclosure:

"This research was supported by an industry-university research grant (5-2019-D0166-00004) through the Yuhan Corporation."

We note that one or more of the authors have an affiliation to the commercial funders of this research study : [Yuhan Corporation.].

1) Please provide an amended Funding Statement declaring this commercial affiliation, as well as a statement regarding the Role of Funders in your study. If the funding organization did not play a role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript and only provided financial support in the form of authors' salaries and/or research materials, please review your statements relating to the author contributions, and ensure you have specifically and accurately indicated the role(s) that these authors had in your study. You can update author roles in the Author Contributions section of the online submission form.

* Please also include the following statement within your amended Funding Statement.

“The funder provided support in the form of salaries for authors [insert relevant initials], but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the ‘author contributions’ section.”

If your commercial affiliation did play a role in your study, please state and explain this role within your updated Funding Statement.

2) Please also provide an updated Competing Interests Statement declaring this commercial affiliation along with any other relevant declarations relating to employment, consultancy, patents, products in development, or marketed products, etc.

Within your Competing Interests Statement, please confirm that this commercial affiliation does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: "This does not alter our adherence to  PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests). If this adherence statement is not accurate and  there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

* Please include both an updated Funding Statement and Competing Interests Statement in your cover letter. We will change the online submission form on your behalf.

Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: N/A

Reviewer #3: I Don't Know

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

**********

5. Review Comments to the Author

Reviewer #1:

1. What are the novelties of your work compared to other studies using "multiplex real time PCR" for Aspergillus detection like: "Multiplex real-time PCR for detection and quantification of mycotoxigenic Aspergillus, Penicillium and Fusarium" 2009. Journal of Stored Products Research.

2. Lines 56-58, Introduction part: -These steps are shared between your method and "identification via the polymerase chain reaction" methods. - What are the merits of your method compared to other molecular methods such as multiplex PCR?

3. Line 215, discussion part: In average, how much time was reduced compared to other methods?

Reviewer #2:

The manuscript is relevant for PlosOne but there are some issues. You have a very good results but I would like that you explain more about material and methods used to synthesize the control DNA. When you explain about the standard curve, never show the efficiency (E). However in M&M is explianed that it has been calcualted.

Reviewer #3:

1-DNA extraction and purification

Authors indicated: “ In this study, we optimized methods to extract mold DNA. First, freeze-thawing and bead-beating methods were used for mechanical lysis, and different lysis and protein removal solutions were used for the conidia and hyphae (hyphae, Trizol solution and isopropanol; conidia, Epicentre’s lysis buffer and protein precipitation solution). Different lysis buffers were used because Trizol reagent”.

Please, for this issue referr to previous validations of fungal DNA extraction, where it was shown that columns and magnetic beads allowed collecting DNA and separate PCR inhibitors, but detection rates could not be related to DNA-avidity of beads or to elution but to the lack of proteolysis.

Please refer to:

-Goldschmidt P, Degorge S, Merabet L, Chaumeil C. Enzymatic treatment of specimens before DNA extraction directly influences molecular detection of infectious agents. PLoS One. 2014 Jun 17;9(6):e94886. doi:10.1371/journal.pone.0094886.)

-Hsu M, Chen K, Lo H, Chen Y, Liao M, et al. (2003) Species identification of medically important fungi by use of realtime LightCycler PCR. J. Med. Microbiol 52: 1071–1076.

2- As for potential clinical use it should be stressed that the yields of DNA extraction and the PCR inhibitors must be monitored (i.e. by adding internal controls to each sample). results of the systematic validation of this issue were not found in the manuscript.

3- Resutls of LOQ and LOD were 40 fg and 400 fg, respectively. Here, in addition to the quantitative analysis expressed as DNA mass (pg, fg, etc), the sensitivity of the test for each sample should be also related to the number of colony forming units.

For further clinical use, the detection limits should be be also compared with fresh titrated fungal suspensions seeded into the haemoculture system (inoculums containing serial diluted CFU/bottle).

Please, refer to:

-Obara H, Aikawa N, Hasegawa N, Hori S, Ikeda Y, et al. (2011) The role of a real-time PCR technology for rapid detection and identification of bacterial and fungal pathogens in whole-blood samples. J Infect Chemother 3: 327–33.

-Goldschmidt P, Degorge S, Che Sarria P, Benallaoua D, Semoun O, Borderie V, Laroche L, Chaumeil C. New strategy for rapid diagnosis and characterization of fungal infections: the example of corneal scrapings. PLoS One. 2012;7(7):e37660.)

4- Results of specificity of the different set of primers with no filamentous fungi were not found.

-Marr KA, Carter R, Crippa F, Wald A, Corey L (2002) Epidemiology and outcome of mould infections in hematopoietic stem cell transplant recipients. Clin Infect Dis 34: 909–17.

-Horvath L, George B, Murray C, Harrison L, Hospenthal D (2004) Direct comparison of the BACTEC 9240 and BacT/ALERT 3D automated blood culture systems for Candida growth detection. J Clin Microbiol 42: 115–8.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: Dear Editor.docx

Click here for additional data file.

Submitted filename: PONE-D-19-32117_reviewer.pdf

Click here for additional data file.

Submitted filename: Plosone revised 18-12-2019.docx

Click here for additional data file.

8 Feb 2020

Answers to Editor’s & Reviewers’ comments

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf

- We made further edits in response to the editor's comments. The revised version was corrected by the style of the journal, and modified parts were given in highlight.

2. Thank you for stating the following financial disclosure:

"This research was supported by an industry-university research grant (5-2019-D0166-00004) through the Yuhan Corporation."

We note that one or more of the authors have an affiliation to the commercial funders of this research study : [Yuhan Corporation.].

1) Please provide an amended Funding Statement declaring this commercial affiliation, as well as a statement regarding the Role of Funders in your study. If the funding organization did not play a role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript and only provided financial support in the form of authors' salaries and/or research materials, please review your statements relating to the author contributions, and ensure you have specifically and accurately indicated the role(s) that these authors had in your study. You can update author roles in the Author Contributions section of the online submission form.

* Please also include the following statement within your amended Funding Statement.

“The funder provided support in the form of salaries for authors [insert relevant initials], but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the ‘author contributions’ section.”

If your commercial affiliation did play a role in your study, please state and explain this role within your updated Funding Statement.

2) Please also provide an updated Competing Interests Statement declaring this commercial affiliation along with any other relevant declarations relating to employment, consultancy, patents, products in development, or marketed products, etc.

Within your Competing Interests Statement, please confirm that this commercial affiliation does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: "This does not alter our adherence to PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests). If this adherence statement is not accurate and there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

* Please include both an updated Funding Statement and Competing Interests Statement in your cover letter. We will change the online submission form on your behalf.

Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests

- As you indicated, we revised “Competing Interest” and attached it to the rebuttal letter.

Review Comments to the Author

Reviewer #1:

1. What are the novelties of your work compared to other studies using "multiplex real time PCR" for Aspergillus detection like: "Multiplex real-time PCR for detection and quantification of mycotoxigenic Aspergillus, Penicillium and Fusarium" 2009. Journal of Stored Products Research.

: I appreciate that you reviewed our paper in detail. In this study, our strategy for the molecular detection of Aspergillus focused on the diagnostics of the invasive aspergillosis (IA). Due to the high morbidity and mortality of IA, the rapid detection and identification are very important in the clinical setting. Aspergillus fumigatus, A. niger, A. flavus, and A. terreus have been reported as the significant species isolated in IA. Our designed probe can be specifically and sensitively to the major species of IA (A. fumigatus, A. niger, A. flavus, and A. terreus), in addition to the filamentous ascomycetes. Also, our work additionally detects to azole-resistant A. fumigatus and A. tubingensis of which strains have high MIC to azole comparing to other Aspergillus species. Taken together, our work could be used as the rapid identification and azole resistance in the diagnostic of IA, compared to other studies. In Discussion part, we discussed it in the revised version (line 297-302 ).

2. Lines 56-58, Introduction part: -These steps are shared between your method and "identification via the polymerase chain reaction" methods. - What are the merits of your method compared to other molecular methods such as multiplex PCR?

: As you commented, “molecular identification is limited” should be unclear. We intended to improve the limitations of current time-consuming filamentous fungal identification by sequencing-based methods. Therefore, it is modified as “sequencing-based identification is time-consuming” (line 54-55).

Compared to multiplex PCR, our method has the advantages of the probe-based real time PCR, so it can be more sensitive, more specific, faster, and used in a quantitative method. Also, our probe-based method could be a time effective way because it does not need additional time for the sequencing (line 233-235 in the section Discussion).

3. Line 215, discussion part: In average, how much time was reduced compared to other methods?

: It usually takes 3-14 days of fungal culture for conidia production (Different culture time for each clinical strains), 2-3 days for PCR & sequencing, and 2-3 days for azole-resistant MIC analysis. Therefore, on average, it takes 7 to 20 days. However, in this study, we increased sensitivity and detected in the early stages of hyphae generation, and we performed probe-based real time PCR that did not perform sequencing. As a result, the time required for diagnosis after culture was reduced to 2 ~ 3 days. In other words, it has been reduced by 3 to 14 days compared to the previous method.

This has been modified in the introduction (line 54-57) and discussion (line 294-296).

Reviewer #2:

The manuscript is relevant for PlosOne but there are some issues. You have a very good results but I would like that you explain more about material and methods used to synthesize the control DNA.

When you explain about the standard curve, never show the efficiency (E). However in M&M is explianed that it has been calcualted.

Line 127: What is the protocol used to synthesized the control DNA?

: I appreciate that you reviewed our paper in detail.

As you commented, our explanation could be insufficient. So we described more in materials and methods (lines 124-131) as below.

At first, we aligned each consensus sequence of benA in Aspergillus species (S1 Fig). We used benA sequence of A. fumigatus as the template and designed to have each probe sequence (conserved probe of filamentous ascomycetes, Fumigati, Nigri, Flavi, and Terrei) (Table 2). And then, the designed DNA was synthesized genetically (Bionics Corporation, Seoul). We cloned it into the pUC57 plasmid, and it was transformed into Escherichia coli BL21strain. Plasmid DNA of transformants was extracted, tested for the multiplex, and used as control DNA.

Line 130: why has the author synthesized a control DNA instead to clon different fragments of DNA as positives controls?

: If different fragments are used as controls, several control-set should be needed. More controls need more wells. In clinical settings, more control leads to fewer test samples, especially in quantitative analysis. Therefore we designed a synthesized control including all probes (5 probes). We describe it at the section of Material & Method and Discussion (line 124-131, line 279-281).

Results: Line 167: delete a "were not"

: I thank you for reviewing in detail. We had been corrected it (line 177-178).

Line 188: The author should include the Efficiency (%) calculated, as explianed in M&M, to each standard curve.

: As you commented, we added efficiency (%) in the revised version. The amplification efficiency of each probe was found to be 89.8% ~ 104.8% in gDNA and 90.0% ~ 99.4% in Control DNA. These results are described in the line 192-193 of the results section, and each value is added in Table 5.

Reviewer #3:

1-DNA extraction and purification

Authors indicated: “ In this study, we optimized methods to extract mold DNA. First, freeze-thawing and bead-beating methods were used for mechanical lysis, and different lysis and protein removal solutions were used for the conidia and hyphae (hyphae, Trizol solution and isopropanol; conidia, Epicentre’s lysis buffer and protein precipitation solution). Different lysis buffers were used because Trizol reagent”.

Please, for this issue referr to previous validations of fungal DNA extraction, where it was shown that columns and magnetic beads allowed collecting DNA and separate PCR inhibitors, but detection rates could not be related to DNA-avidity of beads or to elution but to the lack of proteolysis.

Please refer to:

-Goldschmidt P, Degorge S, Merabet L, Chaumeil C. Enzymatic treatment of specimens before DNA extraction directly influences molecular detection of infectious agents. PLoS One. 2014 Jun 17;9(6):e94886. doi:10.1371/journal.pone.0094886.)

-Hsu M, Chen K, Lo H, Chen Y, Liao M, et al. (2003) Species identification of medically important fungi by use of realtime LightCycler PCR. J. Med. Microbiol 52: 1071–1076.

: I appreciate that you reviewed our paper in detail.

We reviewed the two papers which you referred to. Both papers showed better removal of PCR inhibitors using lyticase and protease K. In these papers you mentioned, only a few strains of filamentous fungus (mold) were tested. We did lysis of clinical and environmental mold using enzyme and Qiagen purification kit. However, their purity was not good for quantitative analysis, and many variables among species and strains. So, we tried to look for the efficient lysis and complete removal of protein and PCR inhibitors, and then it has been tested in hundreds of mold strains.

We used a bead beating lysis method using Trizol reagent (invitrogen) in the case of hyphae and lysis solution of MasterPure ™ Yeast DNA Purification Kit (Epicentre) in conidias. In addition, we performed purification using phenol/chloroform or precipitation buffer (kit), and then they were additionally purified by the column kit (Qiagen). In tested mold strains, these methods performed complete physical lysis and a fungal DNA purification with the high purity for the quantitative analysis. Trizol agent is more economical and effective in hyphae, but it showed the incomplete lysis in conidia of some strain. The lysis solution of the kit showed the complete lysis and removal of PCR inhibitor in both hyphae and conidia.

Some researchers suggested bead beating could be more efficient at lysing fungus than enzymatic lysis (EAPCRI method for Aspergillus DNA from whole blood) (Rosemary A Barnes, P Lewis White, C Oliver Morton, Thomas R Rogers, Mario Cruciani, Juergen Loeffler, J Peter Donnelly, Diagnosis of aspergillosis by PCR: Clinical considerations and technical tips. Medical Mycology 2018 56(suppl_1):60-72. https://doi.org/10.1093/mmy/myx091).

We discussed it in the Discussion part (line 241-257)

2- As for potential clinical use it should be stressed that the yields of DNA extraction and the PCR inhibitors must be monitored (i.e. by adding internal controls to each sample). results of the systematic validation of this issue were not found in the manuscript.

: Actually, we monitored of PCR inhibitors using SPUD plasmid DNA (insert in pUC57 vector) as an internal control. It is a routine task and I did not write it in the paper. However, I regret that it was not mentioned in the first version of our paper. We add the monitoring results in the revised version.

We performed an experiment to determine the presence of a PCR inhibitor. In the real time PCR process, the experiment was conducted by spiking SPUD DNA with a 1.3 X 105 copy number. When the difference of Cq value was <1 compared to the SPUD DNA diluted in PBS, it was determined that there was no PCR inhibitor. Also, we checked the yields of DNA extraction by monitoring the mass of genomic DNA. When fungal DNA was extracted in ~108 of conidia, and the amount is >3.5μg (usually 4-5 μg) measured by Quant-iT™ PicoGreen™ dsDNA Reagent (Invitrogen), we used it in our study (the mass of one genome copy of Aspergillus was calculated to around 40 fg). We described it in the section of Material and Method and Result. (S3 Fig, line 159-166, 226-228).

3- Resutls of LOQ and LOD were 40 fg and 400 fg, respectively. Here, in addition to the quantitative analysis expressed as DNA mass (pg, fg, etc), the sensitivity of the test for each sample should be also related to the number of colony forming units.

For further clinical use, the detection limits should be be also compared with fresh titrated fungal suspensions seeded into the haemoculture system (inoculums containing serial diluted CFU/bottle).

Please, refer to:

-Obara H, Aikawa N, Hasegawa N, Hori S, Ikeda Y, et al. (2011) The role of a real-time PCR technology for rapid detection and identification of bacterial and fungal pathogens in whole-blood samples. J Infect Chemother 3: 327–33.

-Goldschmidt P, Degorge S, Che Sarria P, Benallaoua D, Semoun O, Borderie V, Laroche L, Chaumeil C. New strategy for rapid diagnosis and characterization of fungal infections: the example of corneal scrapings. PLoS One. 2012;7(7):e37660.)

: As you mentioned, it could be a better way to describe the sensitivity related to the number of colony-forming units (CFU). However, CFU of the filamentous fungus (mold) is difficult to be counted due to the existence of hyphae and conidia (live/dead), the different growth rates of each conidia, error rate of hemocytometer counting, and so on. Therefore, the quantitative analysis from CFU of mold is very variable, and the validation should be difficult. We decided to validate our method by DNA mass related to fungal genome copy. Although the graphs and graphs are the mass of DNA (pg, fg), the genome copies number was obtained using the genome size and molar concentration, and we described in the text (Fig 1, Line 193-197, 220-224).

Therefore, we statistically described multiplex real time PCR results of LOQ and LOD in this paper, not the method of fungal DNA extraction. As you mentioned, we will approach the LOQ and LOD both in fungal DNA extraction and multiplex real time PCR from clinical specimens for clinical use in further study.

We will discuss it in the section of Discussion (line 304-305).

4- Results of specificity of the different set of primers with no filamentous fungi were not found.

-Marr KA, Carter R, Crippa F, Wald A, Corey L (2002) Epidemiology and outcome of mould infections in hematopoietic stem cell transplant recipients. Clin Infect Dis 34: 909–17.

-Horvath L, George B, Murray C, Harrison L, Hospenthal D (2004) Direct comparison of the BACTEC 9240 and BacT/ALERT 3D automated blood culture systems for Candida growth detection. J Clin Microbiol 42: 115–8.

: We designed a probe able to detect filamentous ascomycetes. Besides, non-ascomycetes and non-filamentous ascomycetes were used in the specificity of the test, and these results were described (Line 171-173). In one of non-filamentous ascomycetes (No. 39, Table S1), and 8 of non-ascomycetes molds (No. 40-47, Table S1), there was no cross-reaction in all set of probes. In the designed real time PCR in this study, the fungal DNA of filamentous ascomycetes (No. 1-38, Table S1) was amplified specifically. (Table 3, Table S1)

Submitted filename: Plosone Response to Reviewers.docx

Click here for additional data file.

11 Feb 2020

Development of Multiplex Real-time PCR for Rapid Identification and Quantitative Analysis of Aspergillus Species

PONE-D-19-32117R1

Dear Dr. Lee,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Ruslan Kalendar, PhD

Academic Editor

PLOS ONE

18 Feb 2020

PONE-D-19-32117R1

Development of Multiplex Real-time PCR for Rapid Identification and Quantitative Analysis of Aspergillus Species

Dear Dr. Lee:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Ruslan Kalendar

Academic Editor

PLOS ONE