Prevalence and Genotype Distribution of Giardia duodenalis in Rabbits in Shandong Province, Eastern China.

Giardia duodenalis is a zoonotic enteric parasite that can infect humans and a number of animal species including rabbits with a worldwide distribution. Infection with G. duodenalis can cause serious public health problems and significant economic losses to animal husbandry. So accurate understanding of the prevalence and genotype distribution of G. duodenalis in rabbits is necessary. In the present study, a total of 616 fecal samples were collected from rabbits in Shandong province, eastern China, and examined in G. duodenalis prevalence and genotypes by nested PCR amplification of β-giardin (bg), glutamate dehydrogenase (gdh), and triosephosphate isomerase (tpi) gene loci of G. duodenalis. Sixty-nine (11.2%) of the examined rabbit fecal samples were G. duodenalis-positive. Of them, the prevalence of G. duodenalis is 8.4% (41/490) in Rizhao city and 22.2% (28/126) in Weihai city. Breeds, region, and feeding modes were highly correlated with G. duodenalis infection in rabbits. Moreover, three genotypes (assemblages A, B, and E) were identified in rabbits at three gene loci, and the assemblage E was the dominant genotype, while the assemblage A was reported in rabbits in China for the first time. It is noticeable that two rabbits were found to be infected with two different G. duodenalis assemblages (assemblages A and E, assemblages B and E, respectively). These findings enrich the genotype distribution of G. duodenalis in rabbits and provide baseline data for preventing and controlling G. duodenalis infection in rabbits in eastern China.

1. Introduction

Giardia duodenalis (syn. Giardia intestinalis, Giardia lamblia) is a common gastrointestinal protozoon that causes enteric disease in a variety of animal species and humans [1-4]. More than 40 species of animals have been reported to be infected with G. duodenalis over the world [2, 5]. Humans can be infected through ingesting water and food contaminated with G. duodenalis cysts [6]. The clinical symptoms of giardiasis are diarrhea, dehydration, abdominal pain, nausea, vomiting, and weight loss [2, 6, 7]. Giardiasis caused by G. duodenalis also has been recognized as an important zoonotic disease for both public and animal health [2, 7, 8].

Eight assemblages have been identified in G. duodenalis, including assemblages A–H [2, 5]. The structure of eight assemblages is similar, but the genotypes are distinct [8]. Among assemblages A–H, both of the assemblages A and B are usually identified in various mammals, including humans [9], while the remaining assemblages mainly occur in the relatively specific groups of animals [10, 11].

Rabbits are one of the most important economic animals in China, and the consumption of meat and fur accounts for a large part of China's economy [12]. However, rabbits are susceptible to many pathogens [5, 13, 14], including G. duodenalis [15-20], which can cause significant economic losses to the rabbit breeding industry. There are limited reports about G. duodenalis prevalence in rabbits in China [15, 18–20]; therefore, the objective of the present study was to investigate the prevalence and genotype distribution of G. duodenalis in rabbits in Shandong province, eastern China.

2. Materials and Methods

2.1. Collection of Fecal Samples

A total of 616 rabbit fecal samples (490 from Rizhao city, 126 from Weihai city) were collected from Shandong province, eastern China. The fecal samples were composed of 207 New Zealand white rabbits, 188 long-haired rabbits, and 221 Tolai hares. Each fresh fecal sample was collected with gloves and placed into a box with ice, then marked with the breed, age, and region, respectively, and transported to the laboratory. All of the fecal samples were stored at −20°C for further DNA extraction.

2.2. Genomic DNA Extraction

Each rabbit fecal sample was washed with distilled water, uniformly stirred, and the residue was filtered through a 60-mesh sieve (0.23 × 0.23 mm). The filtrate was centrifuged at 4000g for 5 min in a centrifuge, the filtrate was discarded, and the precipitate was retained; then approximately 300 mg of each precipitate of fecal sample was used to extract genomic DNA using the commercial E.Z.N.A.R® Stool DNA Kit (Omega Bio-Tek Inc., Norcross, GA, USA), following the manufacturer's recommendations. The extracted genomic DNA was stored at −20°C for further PCR amplification.

2.3. Nested PCR Amplification

The prevalence and genotypes of G. duodenalis were examined by nested PCR amplification of the bg, gdh, and tpi gene loci as described previously [2, 15]. The primers and corresponding annealing temperature are shown in Table 1. Positive and negative controls were included in each PCR reaction. The secondary PCR products were electrophoresed in 1% (w/v) agarose gels containing ethidium bromide.

Table 1

Nest PCR primers and annealing temperatures used in this study.

Gene	Primer	Sequence (5′-3′)	Annealing temperature (°C)	Length (bp)	Reference
bg	F1	AAGCCCGACGACCTCACCCGCAGTGC	55		[2]
	R1	GAGGCCGCCCTGGATCTTCGAGACGAC
	F2	GAACGAACGAGATCGAGGTCCG	55	511
	R2	CTCGACGAGCTTCGTGTT
gdh	F1	TTCCGTRTYCAGTACAACTC	50		[2]
	R1	ACCTCGTTCTGRGTGGCGCA
	F2	ATGACYGAGCTYCAGAGGCACGT	65	530
	R2	GTGGCGCARGGCATGATGCA
tpi	F1	AAATIATGCCTGCTCGTCG	55		[2]
	R1	CAAACCTTITCCGCAAACC
	F2	CCCTTCATCGGIGGTAACTT	55	530
	R2	GTGGCCACCACICCCGTGCC

2.4. Sequence Analysis and Phylogeny

All of the positive secondary PCR products were sent to Tsingke Biotechnology Technology Company (Xi'an city, China) for two-directional sequencing. The obtained sequences were compared with reference sequences in GenBank database (http://www.ncbi.nlm.nih.gov/BLAST/) and edited using computer Clustal X 1.83 [21]. The phylogenetic tree was constructed using the Neighbor-Joining [NJ] analysis in MEGA7 (https://www.megasoftware.net/), the Kimura 2-parameter model was selected, and 1,000 bootstrap replicates were calculated.

2.5. Statistical Analysis

The relationship between the G. duodenalis prevalence in rabbits with different variables such as breed, region, age, and feeding mode was analyzed by the Chi-square (χ2) test. The 95% confidence intervals (CIs) and odds ratios (ORs) were estimated by SPSS version 24.0 (SPSS Inc., Chicago, IL, USA). If the statistical resultP < 0.05, the difference was considered statistically significant.

3. Results and Discussion

3.1. The Prevalence of G. duodenalis in Rabbits

In the present study, 69 (11.2%, 95% CI: 8.71–13.69) of the examined 616 rabbit fecal samples were positive for G. duodenalis by nested PCR amplification of the bg, gdh, and tpi loci (Table 2). Among different breeds, the highest prevalence was 23.1% (95% CI: 17.52–28.63) in Tolai hares, followed by 7.3% (95% CI: 3.72–10.78) in New Zealand white rabbits and 1.6% (95% CI: 0.19–3.39) in long-haired rabbits, and the difference was considered significant (χ2 = 50.03, df = 2, P < 0.01). Moreover, the G. duodenalis prevalence in rabbits from Rizhao city (8.4%, 95% CI: 5.92–10.82) was significantly lower than that from Weihai city (22.2%, 95% CI: 14.96–29.48) (χ2 = 19.34, df = 1, P < 0.01). Rabbits raised outdoors had a significantly higher G. duodenalis prevalence (23.1%) than that raised indoors (4.6%) (χ2 = 48.87, df = 1, P < 0.01) (Table 2). Rabbits that are less than 6 months had a slightly lower G. duodenalis prevalence of 9.4% (95% CI: 5.93–12.77) than rabbits of more than 6 months old (12.7%, 95% CI: 9.17–16.27) (Table 2). The G. duodenalis prevalence in male rabbits (11.5%) (95% CI: 7.70–15.33) was slightly higher (χ2 = 0.05, df = 1, P=0.82) than that in female rabbits (11.0%) (95% CI: 7.67–14.22) (Table 2).

Table 2

Prevalence and risk factors of Giardia duodenalis infection in rabbits.

Factor	Category	No. tested	No. positive	% (95% CI)	P value	OR (95% CI)
Breeds	Long-haired rabbit	188	3	1.6 (0.19–3.39)	0.01	Reference
	New Zealand white rabbit	207	15	7.3 (3.72–10.78)		4.82 (1.37–16.92)
	Tolai hare	221	51	23.1 (17.52–28.63)		18.50 (5.67–60.38)
Region	Rizhao	490	41	8.4 (5.92–10.82)	0.01	Reference
	Weihai	126	28	22.2 (14.96–29.48)		3.13 (1.85–5.30)
Feeding	Indoors	395	18	4.6 (2.50–6.62)	0.01	Reference
	Outdoors	221	51	23.1 (17.50–28.64)		6.28 (3.56–11.08)
Age	Young (<6 months)	278	26	9.4 (5.93–12.77)	0.19	Reference
	Adult (≥6 months)	338	43	12.7 (9.17–16.27)		1.41 (0.84–2.37)
Gender	Female	347	38	11.0 (7.67–14.22)	0.82	Reference
	Male	269	31	11.5 (7.70–15.33)		1.06 (0.64–1.75)
Total		616	69	11.2 (8.71–13.69)

In the present study, the overall G. duodenalis prevalence in rabbits was 11.2% (69/616), which was higher than that in rabbits in Henan province (8.4%, 80/955) [15], Jilin province and Liaoning province (9.86%, 42/426) [18], Heilongjiang province (7.41%, 28/378) [20], Xinjiang province (1.9%, 6/321) [19] in China, and in Europe (7.6%, 40/528) [16] and Melbourne, Australia (1.03%, 1/97) [22], but lower than that in rabbits in Ecuador (20.0%, 4/20) [17]. The different G. duodenalis prevalence in rabbits may be caused by many factors such as geographical ecological environment, detection methods, sample size, and individual health status [23].

3.2. Molecular Characterization of G. duodenalis Isolates

Two G. duodenalis assemblages (assemblages B and E) have been reported in rabbits in China [15, 18–20]. In the present study, 616 rabbit fecal samples were used to identify G. duodenalis genotypes by nested PCR targeting the bg, gdh, and tpi genes. The results showed that 53 bg-positive samples and 39 gdh-positive samples were identified as assemblage E; two (2.9%, 2/69) tpi-positive samples and one (1.5%, 1/69) tpi-positive sample were identified as assemblage B and assemblage A, respectively. Interestingly, the assemblage E (98.6%, 68/69) was the dominant genotype in rabbits in the present study, which was different from the previous studies [18, 19]. Moreover, two mixed G. duodenalis assemblages (assemblages A and E, assemblages B and E) were identified in rabbits, and the assemblage A was firstly detected in rabbits in China in the present study. The G. duodenalis assemblage A was also reported in humans [9, 22]. This finding suggests that the rabbits may be a potential source of human infection with G. duodenalis.

3.3. Phylogenetic Analysis of G. duodenalis Isolates in Rabbits

To further elucidate the genetic relationship of G. duodenalis assemblages in rabbits, we aligned the obtained sequences with reference sequences in GenBank by Clustal X 1.83, which were used for phylogenetic analyses (Figures 1 and 2). The phylogenetic analyses showed that the G. duodenalis assemblage E in rabbits and dairy cattle was distributed on one branch, representing a closer genetic relationship (Figure 2). These findings indicated a possibility of spreading G. duodenalis between rabbits and dairy cattle. Moreover, the single nucleotide polymorphisms (SNPs) existed in bg sequences and gdh sequences in this study (Table 3) by comparing the obtained G. duodenalis sequences in the present study with corresponding sequences in the GenBank database. These findings indicated that various G. duodenalis types are distributed in rabbits. These findings enriched the genetic diversity of G. duodenalis in rabbits and other animals.

Figure 1

The phylogenetic relationships among G. duodenalis isolates. The numbers on the branches represent percent bootstrapping values from 1000 replicates, with values of more than 50% shown in the tree. The genotypes of G. duodenalis which were identified at gdh gene locus in the present study are marked by filled triangles.

Figure 2

The phylogenetic relationships among G. duodenalis isolates inferred by a Neighbor-Joining (NJ) algorithm using a Kimura two-parameter analysis (1000 replicates) based on the bg gene sequences. The genotypes of G. duodenalis which were identified at bg gene locus in the present study are marked by filled triangles.

Table 3

Variations in bg and gdh gene loci among the subtypes of Giardia duodenalis assemblage E in rabbits.

Isolate	Subtype (no.)	Nucleotide at position				GenBank ID
		83	201	429	471
bg	Ref. sequence	A	A	C	C	KU886048
JT-32	E1 (n = 1)	—	—	—	T	MK659571
JT-42	E2 (n = 1)	—	G	—	—	MK659572
JT-334	E3 (n = 1)	G	—	—	—	MK659573
YT-10	E4 (n = 1)	—	—	G	—	MK659574
		24	399
gdh	Ref. sequence	A	A			KF843962
JT-37	E1 (n = 1)	—	G			MK675546
YT-189	E2 (n = 1)	C				MK675547

4. Conclusions

The present study revealed a higher (11.2%) G. duodenalis prevalence in rabbits in Shandong province, eastern China. Different feeding methods, breeds, and regions were highly correlated with G. duodenalis prevalence in rabbits (P<0.05). Three G. duodenalis assemblages (assemblage A, assemblage B, and assemblage E) were identified in rabbits, assemblage A was reported in rabbits in China for the first time, while assemblage E was the dominant assemblage. These findings not only enriched the genotype distribution of G. duodenalis in rabbits but also have an implication for better control of G. duodenalis in rabbits. Further studies are necessary to examine the infection status and genotype distribution of G. duodenalis in rabbits in other areas of the country.