Literature DB >> 32135030

Long non-coding RNA FEZF1-AS1 induced progression of ovarian cancer via regulating miR-130a-5p/SOX4 axis.

Ziqian Sun1, Shouyang Gao1, Lili Xuan1, Xiaojun Liu1.   

Abstract

Emerging studies have revealed the critical role of long non-coding RNAs (lncRNAs) in epithelial ovarian cancer (EOC) development and progression. Till now, the roles and potential mechanisms regarding FEZF1 antisense RNA 1 (FEZF1-AS1) within ovarian cancer (OC) remain unclear. The objective of this study was to uncover the biological function and the underlying mechanism of LncRNA FEZF1-AS1 in OC progression. FEZF1-AS1 expression levels were studied in cell lines and tissues of human ovarian cancer. In vitro studies were performed to evaluate the impact of FEZF1-AS1 knock-down on the proliferation, invasion, migration and apoptosis of OC cells. Interactions of FEZF1-AS1 and its target genes were identified by luciferase reporter assays. Our data showed overexpression of FEZF1-AS1 in OC cell lines and tissues. Cell migration, proliferation, invasion, wound healing and colony formation were suppressed by silencing of FEZF1-AS1. In contrast, cell apoptosis was promoted by FEZF1-AS1 knock-down in vitro. Furthermore, online bioinformatics analysis and tools suggested that FEZF1-AS1 directly bound to miR-130a-5p and suppressed its expression. Moreover, the inhibitory effects of miR-130a-5p on the OC cell growth were reversed by FEZF1-AS1 overexpression, which was associated with the increase in SOX4 expression. In conclusion, our results revealed that FEZF1-AS1 promoted the metastasis and proliferation of OC cells by targeting miR-130a-5p and its downstream SOX4 expression.
© 2020 The Authors. Journal of Cellular and Molecular Medicine published by Foundation for Cellular and Molecular Medicine and John Wiley & Sons Ltd.

Entities:  

Keywords:  FEZF1 antisense RNA 1 (FEZF1-AS1); epithelial ovarian cancer; invasion; miR-130a-5p; migration; proliferation

Mesh:

Substances:

Year:  2020        PMID: 32135030      PMCID: PMC7171310          DOI: 10.1111/jcmm.15088

Source DB:  PubMed          Journal:  J Cell Mol Med        ISSN: 1582-1838            Impact factor:   5.310


INTRODUCTION

Recently, surging evidence indicated that dysfunction of lncRNA was involved in human cancer.1, 2 Wang et al3 testified that serum long non‐coding RNAs HOX transcript antisense intergenic RNA (LNCRNA HOTAIR) could be used as a potential biomarker for the diagnosis of oesophageal squamous cell carcinoma. Overexpression of lncRNA Pvt1 Oncogene (PVT1) promoted proliferation of non‐small cell lung cancer (NSCLC) cells by interaction with Enhancer of zeste homolog 2 (EZH2), thereby inhibiting the expression of large tumour suppressor kinase 2 (LATS2).4 The overexpression of FEZF1AS1 was found in colorectal cancer (CRC), which is a newly discovered carcinogenic lncRNA in human digestive tract cancer.5 SRY‐related HMG‐box 4 (SOX4) is a potent tumour suppressor gene, and its expression is induced in many types of cancer.6 Castro‐Oropeza et al demonstrated that LncRNA DANCR competed with Sox4 mRNA to bind with miR‐138, thereby affecting the expression of Sox4.7 Sun et al8 found that miR‐339‐5p directly targeted SOX4 and exerted anti‐proliferative effects in acute myeloid leukaemia (AML). Yang et al9 found that lncRNA ARNILA acted as a competitive endogenous RNA to promote SOX4 by supporting mir‐204 in triple‐negative breast cancer. In addition, SOX4 was involved in the regulation of EMT processes in carcinogenesis of liver, colon, prostate and breast tissues.10 LncRNA FEZF1AS1 was a novel oncogene discovered recently.11, 12 However, the expression levels of SOX4 in epithelial ovarian cancer (EOC) and its correlation with FEZF1AS1 have rarely been reported. In this study, our results for the first time revealed that by up‐regulating SOX4, FEZF1AS1 interacted with miR‐130a‐5p to accelerate metastasis and proliferation of EOC cells.

METHODS

Clinical samples

Fifty‐two paired EOC specimens, serum samples and surrounding normal tissues were taken from individuals who underwent tumour surgeries in China‐Japan Union Hospital of Jilin University from January 2012 to October 2014 were retrospectively studied. All clinical tissues were confirmed by experienced pathologists who confirmed the diagnosis of EOC samples. None of the enrolled individuals had chemotherapy or radiotherapy preoperatively. EOC tissue samples were obtained and then immediately frozen in liquid nitrogen at −80°C until analysis. All samples were diagnosed in accordance with the World Health Organization criteria. The investigation was agreed by the Clinical Research Ethics Committee of the China‐Japan Union Hospital of Jilin University, and the informed consent and written agreements were received from patients. The clinicopathological parameters were illustrated in Table 1.
Table 1

Clinicopathological parameters and FEZF1‐AS1 expression in EOC patients

CharacteristicsTotal numberFEZF1‐AS1 expression P‐value
HighLow
n (%)n (%)
Age
<552715 (55.6)12 (44.4).427
≥552515 (60.0)10 (40.0)
Differentiation
Well189 (50.0)9 (50.0).105
Moderate2114 (66.7)7 (33.3)
Poor137 (53.8)6 (46.2)
Menopause
Pre‐2412 (50.0)12 (50.0).178
Post‐2818 (64.3)10 (35.7)
Depth of invasion
T1‐T3205 (25.0)15 (75.0).004
T43225 (78.1)7 (21.9)
Lymph node metastasis
Absent (NO)186 (33.3)12 (66.7)<.001
Present (N1‐N3)3424 (70.6)10 (29.4)
Distant metastasis
Absent (M0)174 (23.5)13 (76.5).021
Present (M1‐M3)3526 (74.3)9 (26.7)
TNM stage
I‐II194 (21.1)15 (78.9)<.001
III‐IV3326 (78.8)7 (21.2)
FIGO Stage
I‐ II2116 (76.2)5 (23.8).008
III‐IV3114 (45.2)17 (54.8)
Clinicopathological parameters and FEZF1AS1 expression in EOC patients

Cell lines

EOC cell lines PEO1, SKOV‐3, COC1, CAOV3, A2780, 3AO and human normal ovarian epithelial cell lines (IOSE‐80) were purchased from the American Type Culture Collection (ATCC). The cells were cultured in RPMI 1640 medium supplemented with 10% FBS (ExCell Bio), 100 mg/mL streptomycin and 100 U/mL penicillin (Gibco; Thermo Fisher Scientific, Inc) and maintained in an incubator at 37°C with 5% CO2.

Luciferase reporter assay

About 2 × 105/well OC cells were seeded in 24‐well plates. Cells were cotransfected with FEZF1AS1‐3′‐UTR WT or mutant vector along with miR‐130a‐5p mimics/inhibitor, and pRL‐SV40 renilla plasmid (Promega Corporation) using Lipofectamine 2000. After 48 hours, the dual‐luciferase reporter assay system (Promega) with the luminometer (Promega) was used to measure the activities of firefly and renilla luciferase. Each treatment was performed in triplicate.

MTT assay

The cells were seeded into 96‐well plates at a density of 1 × 103 cells per well with DMEM medium containing 10% FBS for 24 hours, and 5 mg/mL (10 μL) MTT was supplemented into each well, which were then incubated for 4 hours away from the light. Next, 150 μL dimethylsulphoxide was added into the wells, which was then measured at the optical density (OD) of 570 nm.

Cell colony formation assay

We inoculated cells in 6‐well plates with DMEM medium supplemented with 10% FBS for 14 days. Next, at room temperature, colonies were fixed with methanol for 20 minutes, which were then stained with 0.1% crystal violet for 10 minutes (Invitrogen). The number of observed colonies was counted under an inverted microscope.

Cell apoptosis analysis

COC1, SKOV‐3 and PEO1 cells transfected with si‐NC or siFEZF1AS1 were collected and subjected to double staining with FITCAnnexin V and PI using Apoptosis Detection Kit (CWBIO).

Cell invasion and migration assays

Cell invasion and migration assays were conducted with Boyden Transwell chambers (BD Biosciences) as previously described.13

Wound healing assay

SKOV‐3, COC1 as well as PEO1 cells were treated with siFEZF1AS1 or si‐NC transfection in DMEM medium with 10% FBS, which was kept for 48 hours with 5% CO2 at 37°C. Linear scratches were created on the cell layer with a pipette tip, and the cells were kept for 24 hours in DMEM medium free of serum. Wound healing process was observed with optical microscope and then analysis was performed with Image J software.

qRT‐PCR assay

Total RNAs were extracted from EOC cells and tissues of patients. A total of 10 ng total RNA was reverse‐transcribed into cDNAs using Reverse Transcription Kit (Takara). SYBR Green Real‐time PCR Master Mix. was applied, and reagents were incubated at 95°C for 1 minute, which were subjected to 40 cycles of 95°C for 10 seconds, 58°C for 15 seconds and 72°C for 1 minutes. The primers of miR‐218, miR‐142, miR‐193a miR‐130a‐5p and miR‐499 were obtained from TransGen Biotech, Shanghai, China. U6 small nuclear RNA: 5′‐GAGAAGGGCTATCCAGGAAG‐3′ (forward), 5′‐CCGAAAGGAATTGAAGCACT‐3′ (reverse) was used as the internal standard. The primers for FEZF1AS1: 5′‐ACACATTACCAAACCAGC‐3′ (forward), 5′‐GGTCCAGGCCAGTTTATT‐3′ (reverse). SOX4: 5′‐ACAGTTTTGTGCCCTCA‐3′ (forward) and 5′‐G GGGTCGATGCTGTGTTTTG‐3′ (reverse); Slug: 5′‐ CTCGATGCACACCACATTGC‐3′ (forward) and 5′‐GGCAGAGTAAGGAAAGCT‐3′ (reverse); GAPDH: 5′‐ACAGCATCACTCGCCTCA‐3′ (forward) and 5′‐GCCCAGACCCAATACC‐3′ (reverse). GAPDH was used as the internal control. The expression was calculated by the 2−ΔΔCt method.

Western blot assay

Protein (60 μg) was separated using 10% SDS‐PAGE, which was then transferred onto PVDF membranes. Then, the membranes were blocked with 5% (w/v) non‐fat milk. After blocking, the membranes were incubated with monoclonal primary antibody against vimentin (sc‐51721, 1:800; Santa Cruz, CA, USA), E‐cadherin (ab15148, 1:800; Abcam), Slug (ab27568, 1:600; Abcam), SOX4 (1:800; Abcam), N‐cadherin (sc‐59987, 1:1000; Santa Cruz) and anti‐GAPDH (ab14247, 1:2000; Abcam) at 4°C overnight. After incubating with secondary antibodies (Sigma) at room temperature for 60 minutes, protein bands were detected with the gel image system (Bio‐Rad).

RNA immunoprecipitation (RIP) assay

As previously described,14 Magna RIP RNA‐Binding Protein Immunoprecipitation Kit was applied (Millipore) to perform RNA immunoprecipitation (RIP) assays. Cell extracts were incubated with antibodies against Ago2 (Cell Signaling). Normal mouse IgG was regarded as negative control.

Immunofluorescent staining assay

Blocking buffer (5% normal goat serum, 0.1% Triton‐X 100 in PBS and 3% bovine serum albumin) was used to incubate EOC cells for 60 minutes. Anti‐SOX4 antibody (1:500; Abcam), Anti‐vimentin antibodies (1:200; Abcam), Anti‐PCNA antibody (1:500; Abcam), Anti‐E‐cadherin antibody (1:200; Abcam) and Anti‐Slug antibody (1:150; Abcam) were then used to incubate the cells overnight. PBST was used to wash cells for three times for 5 minutes, and secondary antibodies (Invitrogen) were used to incubate cells at room temperature for 2 hours. DAPI was used to counterstain cell nuclei (Burlingame, CA). We applied a Nikon Ti inverted fluorescence microscope to acquire photos.

Statistical analysis

SPSS 21.0 software was used to perform analysis on statistical variations. Experimental results were shown as mean ± SD. One‐way ANOVA or Student's t test was applied to conduct comparison of 2 or multiple groups. Correlations were analysed with Pearson's correlation. P‐value < .05 was deemed to be significant difference.

RESULTS

FEZF1‐AS1 was overexpressed in EOC

FEZF1AS1 expression in 52 EOC specimens and the para‐carcinoma tissues were detected by qRT‐PCR. Compared with para‐carcinoma tissues, FEZF1AS1 expression was notably increased in EOC specimens (P < .001, Figure 1A). Moreover, serum levels of FEZF1AS1 were dramatically up‐regulated in EOC patients than healthy controls (n = 52, P = .0036, Figure 1B). Most importantly, the expression levels of FEZF1AS1 in serum were correlated with those in EOC tissues positively (P = .001, r 2 = .5273, Figure 1C). Furthermore, overexpressed FEZF1AS1 was found in EOC cell lines compared with IOSE 80 cell line (Figure 1D).
Figure 1

FEZF1‐AS1 expression in serum of EOC patients, EOC tissues and cell lines. A, the expression of FEZF1‐AS1 was increased in EOC tissue compared with para‐carcinoma control tissue. B, the expression of FEZF1‐AS1 was up‐regulated in EOC serum samples compared with healthy controls. C, correlation of FEZF1‐AS1 expression in EOC serum and tissues. D, expression of FEZF1‐AS1 in EOC cell lines. E, patients with high FEZF1‐AS1 expression had lower OS than those in group with low FEZF1‐AS1 expression. F, FEZF1‐AS1 was an isolated prognostic marker for OS in EOC patients. G, ROC curve analysis was used to detect the diagnostic role of FEZF1‐AS1. H, serum FEZF1‐AS1 expression level was down‐regulated compared with pre‐operative samples. *P < .05, **P < .01

FEZF1AS1 expression in serum of EOC patients, EOC tissues and cell lines. A, the expression of FEZF1AS1 was increased in EOC tissue compared with para‐carcinoma control tissue. B, the expression of FEZF1AS1 was up‐regulated in EOC serum samples compared with healthy controls. C, correlation of FEZF1AS1 expression in EOC serum and tissues. D, expression of FEZF1AS1 in EOC cell lines. E, patients with high FEZF1AS1 expression had lower OS than those in group with low FEZF1AS1 expression. F, FEZF1AS1 was an isolated prognostic marker for OS in EOC patients. G, ROC curve analysis was used to detect the diagnostic role of FEZF1AS1. H, serum FEZF1AS1 expression level was down‐regulated compared with pre‐operative samples. *P < .05, **P < .01

Correlation between clinicopathological parameters and the expression of FEZF1‐AS1

According to the expression of FEZF1AS1 detected by qRT‐PCR, EOC patients were classified as high (n = 30, > twofold of normal tissues) and low FEZF1AS1 expression group (n = 22). Patients in high FEZF1AS1 expression group have worse lymphatic metastasis (P < .001), deeper invasion (P = .004), distant metastasis (P = .021), advanced TNM Classification of Malignant Tumours (TNM) stage (P < .001) and FIGO Stage (P = .008). Nevertheless, no significant association was found between FEZF1AS1 expression level and age, differentiation or menopause (Table 1).

Poor prognosis was associated with induced FEZF1‐AS1 expression in EOC patients

Kaplan‐Meier analysis showed that compared with patients in high FEZF1AS1 expression group, the 5‐year overall survival (OS) was remarkably higher in low expression of FEZF1AS1 group (P = .005, Figure 1E). Univariate analysis results demonstrated that invasion depth (P = .021), lymph node metastasis (P = .030), FEZF1AS1 expression levels (P = .001), distant metastasis (P = .003), TNM stage (P < .001) were closely related to OS (Table 2). Moreover, multivariate analyses showed that the expression of FEZF1AS1 (P = .014), depth of invasion (P = .003), TNM stage (P < .001), and lymph node metastasis (P = .022) were independent indicators for OS prognosis in EOC patients (Figure 1F). ROC curve analysis found that serum FEZF1AS1 level distinguished EOC patients from normal controls (AUC = 0.9483, 95% CI: 0.915‐0.998, P < .001, Figure 1G). Therefore, FEZF1AS1 could serve as a critical indicator (cut‐off value = 2.41, sensitivity: 87.4%, specificity: 76.2%). In addition, serum FEZF1AS1 level in post‐surgery EOC tissues decreased significantly compared with pre‐surgery tissues (P < .001; Figure 1H).
Table 2

Univariate and multivariable Cox proportional hazard regression analyses for OS in EOC patients

VariableUnivariate analysisMultivariate analysis
HR95% CI P‐valueHR95% CI P‐value
Depth of invasion2.0231.903‐2.426.0232.1141.905‐2.403.003
Lymph node metastasis1.8631.382‐2.054.0352.0001.758‐2.336.022
Distant metastasis1.6541.436‐1.732.020   
TNM stage1.8741.683‐2.407<.0012.3101.763‐2.453<.001
FEZF1‐AS12.7412.437‐3.102.0012.8842.509‐3.412.014
Univariate and multivariable Cox proportional hazard regression analyses for OS in EOC patients

Silencing of FEZF1‐AS1 inhibited cell proliferation of EOC cell lines

Three siFEZF1‐AS1s and si‐NC were transfected into COC1 and SKOV‐3 cells, and qRT‐PCR was performed to verify the transfection efficiencies. The transfection of siFEZF1AS1‐1 and siFEZF1AS1‐2 had higher interference efficiencies and was used for further experiments (P < .01, Figure 2A). MTT assay showed that compared with si‐NC group, cell proliferative rate was remarkably repressed in groups transfected with siFEZF1AS1‐1/2 (P < .01, Figure 2B). Colony formation assay showed that relative to si‐NC group, cell colony number in groups transfected with siFEZF1AS1‐1/2 was obviously lower (P < .05, Figure 2C). Flow cytometric analysis manifested that by comparison to si‐NC group, the cell apoptotic rate in siFEZF1AS1‐1/2 groups was significantly higher (P < .05, Figure 2D). Moreover, the expressions of apoptotic related genes were increased after FEZF1AS1 knock‐down (Figure 2E). Together, silencing of FEZF1AS1 promoted cell apoptosis and repressed cell proliferation in EOC cells.
Figure 2

FEZF1‐AS1 modulated EOC cells proliferation and apoptosis. A, the interference efficiencies of three FEZF1‐AS1 siRNA sequences. B, cell growth activity was assessed in SKOV‐3 as well as COC1 cells after FEZF1‐AS1 transfection using MTT assay. C, FEZF1‐AS1 knock‐down inhibited colony formation in SKOV‐3 and COC1 cells. D, flow cytometry was applied to examine cell apoptosis analysis. E, expressions of apoptotic related markers were detected by Western blot. *P < .05, **P < .01

FEZF1AS1 modulated EOC cells proliferation and apoptosis. A, the interference efficiencies of three FEZF1AS1 siRNA sequences. B, cell growth activity was assessed in SKOV‐3 as well as COC1 cells after FEZF1AS1 transfection using MTT assay. C, FEZF1AS1 knock‐down inhibited colony formation in SKOV‐3 and COC1 cells. D, flow cytometry was applied to examine cell apoptosis analysis. E, expressions of apoptotic related markers were detected by Western blot. *P < .05, **P < .01

Silencing of FEZF1‐AS1 hindered cell invasion and migration in EOC cells

Transwell assay results suggested that silencing of FEZF1AS1 hindered the cell migration and invasion of SKOV‐3, COC1 and PEO1 cells in vitro (P < .01, Figure 3A,B). Similarly, wound healing assay showed that compared with si‐NC group, reduced cell migration ability was found in COC1, SKOV‐3 and PEO1 cells after silencing FEZF1AS1 (P < .01, Figure 3C,D).
Figure 3

The function of FEZF1‐AS1 on EOC cell migration, invasion and wound healing. A, B, the impact of knocking FEZF1‐AS1 down on cell migrative and invasive ability in SKOV‐3 and COC1 cells by Transwell assays. C, D, wound healing abilities were determined in SKOV‐3 and COC1 cells after si‐FEZF1‐AS1 treatment. **P < .01

The function of FEZF1AS1 on EOC cell migration, invasion and wound healing. A, B, the impact of knocking FEZF1AS1 down on cell migrative and invasive ability in SKOV‐3 and COC1 cells by Transwell assays. C, D, wound healing abilities were determined in SKOV‐3 and COC1 cells after siFEZF1AS1 treatment. **P < .01

The scanning and certification of candidate miRNAs

The candidate miRNAs which could directly bind to FEZF1AS1 were indentified with online bioinformatics instruments, miRcode (http://www.mircode.org/) and Targetscan (http://www.targetscan.org/vert_72/). It was showed that the miR‐130a‐5p expression was the most up‐regulated by FEZF1AS1 knock‐down among the candidate miRNAs (Figure 4A; P < .01). To verify the binding site of FEZF1AS1 to miR‐130a‐5p, wt‐FEZF1AS1 and mut‐FEZF1AS1 3′‐UTR luciferase reporter vector were constructed and transfected into the SKOV‐3 cell (Figure 4B). Luciferase activity results showed that wt‐FEZF1AS1 3′‐UTR was dramatically attenuated via being transfected with miR‐130a‐5p‐mimic and notably increased by transfecting with miR‐130a‐5p‐inhibitor (P < .01). Nevertheless, no significant difference of mut‐FEZF1AS1 reporter was shown in miR‐130a‐5p‐inhibitor nor miR‐130a‐5p‐mimics transfected groups (P < .01).
Figure 4

Scanning, verification of candidate miRNAs as well as its correlation with FEZF1‐AS1. A, B, FEZF1‐AS1 targeted miR‐130a‐5p via direct binding. C, miR‐130a‐5p expression was remarkably increased after FEZF1‐AS1 knock‐down. D, FEZF1‐AS1 expression was greatly down‐regulated after miR‐130a‐5p overexpression, whereas up‐regulated after miR‐130a‐5p knock‐down. E, F, si‐FEZF1‐AS1 and/or miR‐130a‐5p‐inhibitor was transfected into SKOV‐3 and COC1 cells. G, H, FEZF1‐AS1 was remarkably decreased in si‐FEZF1‐AS1 groups relative to si‐NC group, which was reversed by miR‐130a‐5p knock‐down. *P < .05, ** P < .01

Scanning, verification of candidate miRNAs as well as its correlation with FEZF1AS1. A, B, FEZF1AS1 targeted miR‐130a‐5p via direct binding. C, miR‐130a‐5p expression was remarkably increased after FEZF1AS1 knock‐down. D, FEZF1AS1 expression was greatly down‐regulated after miR‐130a‐5p overexpression, whereas up‐regulated after miR‐130a‐5p knock‐down. E, F, siFEZF1AS1 and/or miR‐130a‐5p‐inhibitor was transfected into SKOV‐3 and COC1 cells. G, H, FEZF1AS1 was remarkably decreased in siFEZF1AS1 groups relative to si‐NC group, which was reversed by miR‐130a‐5p knock‐down. *P < .05, ** P < .01

Correlation of miR‐130a‐5p and FEZF1‐AS1 in EOC cells

qRT‐PCR result indicated that compared with the group transfected with si‐NC, the expression of miR‐130a‐5p was dramatically increased after silencing FEZF1AS1 (Figure 4C; P < .01). Also, the expression of FEZF1AS1 mRNA was notably attenuated by miR‐130a‐5p overexpression while increased by miR‐130a‐5p suppression (P < .01, Figure 4D). Inhibitory effect of siFEZF1AS1 on EOC cell growth was partly restored by miR‐130a‐5p suppression (Figure 4E,F; P < .01). Similar effect was detected in cell MTT assay (Figure 4G,H; P < .01). Therefore, it was concluded that FEZF1AS1 might induce carcinogenesis and growth via inhibiting the activity of miR‐130a‐5p in EOC.

SOX4 accelerated EOC cell progression

Compared with surrounding healthy tissues, SOX4 expression was notably promoted in EOC tissues (Figure 5A,B; P < .01). Additionally, SOX4 expression level was dramatically decreased by FEZF1AS1 knock‐down in vitro (P < .01, Figure 5C,D). Furthermore, compared with si‐NC group, the immunofluorescence of SOX4 staining was attenuated by FEZF1AS1 knock‐down (P < .01; Figure 5E,F). FEZF1AS1 mRNA expression was obviously reduced by silencing SOX4 in EOC cell lines (P < .01; Figure 5G). We transfected the plasmids of cDNA (pcDNA)‐3.1/SOX4 into EOC cell lines (Figure 5H; P < .01). MTT assay revealed that the cell proliferation of EOC cells was significantly attenuated by FEZF1AS1 knock‐down and was increased by SOX4 overexpression. However, these inhibitory effects were partly restored by SOX4 overexpression (P < .0; Figure 5I). Taken together, FEZF1AS1 modulated cell proliferation of EOC cells through targeting SOX4.
Figure 5

Relative to surrounding control tissues, correlation of FEZF1‐AS1 and SOX4. A, B, SOX4 were remarkably up‐regulated in EOC tissue samples. C, D, SOX4 expressions were greatly decreased after FEZF1‐AS1 knock‐down. E, F, SOX4 levels were remarkably decreased after FEZF1‐AS1 knock‐down detected by immunofluorescence assay. G, FEZF1‐AS1 mRNA expression was greatly decreased after SOX4 knock‐down. H, pcDNA3.1/SOX4 was transfected into SKOV‐3 and COC1 cell lines. I, cell growth inhibited by FEZF1‐AS1 knock‐down was restored by SOX4 overexpression revealed by MTT assay. *P < .05, **P < .01

Relative to surrounding control tissues, correlation of FEZF1AS1 and SOX4. A, B, SOX4 were remarkably up‐regulated in EOC tissue samples. C, D, SOX4 expressions were greatly decreased after FEZF1AS1 knock‐down. E, F, SOX4 levels were remarkably decreased after FEZF1AS1 knock‐down detected by immunofluorescence assay. G, FEZF1AS1 mRNA expression was greatly decreased after SOX4 knock‐down. H, pcDNA3.1/SOX4 was transfected into SKOV‐3 and COC1 cell lines. I, cell growth inhibited by FEZF1AS1 knock‐down was restored by SOX4 overexpression revealed by MTT assay. *P < .05, **P < .01

FEZF1‐AS1 acted as a ceRNA to miR‐130a‐5p through targeting SOX4

The wt‐SOX4 or mut‐SOX4′‐UTR luciferase reporter vectors and inhibitor‐NC/miR‐130a‐5p‐inhibitor or mimics‐NC/miR‐130a‐5p‐mimics were applied to co‐treat SKOV‐3 cells, separately. Compared with the mimics‐NC group, the wt‐SOX4 3′UTR vector activity was notably decreased in the miR‐130a‐5p‐mimics group (P < .01, Figure 6A,B). The miR‐130a‐5p expression was obviously down‐regulated in EOC tissue samples relative to that in the adjacent normal tissue (Figure 6C, P < .01). In addition, SOX4 expression was decreased by miR‐130a‐5p overexpression and increased by miR‐130a‐5p suppression in EOC cell lines (Figure 6D‐G, P < .01). The expression of SOX4 protein was decreased by siFEZF1AS1 transfection, but up‐regulated by miR‐130a‐5p‐inhibitor transfection in EOC cell lines (P < .01, Figure 6H,I).
Figure 6

FEZF1‐AS1 interacted with miR‐130a‐5p and promoted EOC progression by targeting SOX4. A, SOX4 was forecasted to be a target of miR‐130a‐5p by TargetScan. B, miR‐130a‐5p regulated SOX4 expression detected by luciferase assay. C, miR‐130a‐5p expression was dramatically decreased in EOC tissues compared with control tissues. D, E, qRT‐PCR showed that SOX4 expressions were down‐regulated by miR‐130a‐5p overexpression while up‐regulated by miR‐130a‐5p inhibition in SKOV‐3 and COC1 cell lines. F, G, SOX4 expressions were inhibited after miR‐130a‐5p overexpression while enhanced after miR‐130a‐5p knock‐down in SKOV‐3 and COC1 cell lines by Western blot. H, I, the suppressive role of FEZF1‐AS1 knock‐down on SOX4 protein level was partially recovered via inhibiting miR‐130a‐5p. *P < .05, **P < .01

FEZF1AS1 interacted with miR‐130a‐5p and promoted EOC progression by targeting SOX4. A, SOX4 was forecasted to be a target of miR‐130a‐5p by TargetScan. B, miR‐130a‐5p regulated SOX4 expression detected by luciferase assay. C, miR‐130a‐5p expression was dramatically decreased in EOC tissues compared with control tissues. D, E, qRT‐PCR showed that SOX4 expressions were down‐regulated by miR‐130a‐5p overexpression while up‐regulated by miR‐130a‐5p inhibition in SKOV‐3 and COC1 cell lines. F, G, SOX4 expressions were inhibited after miR‐130a‐5p overexpression while enhanced after miR‐130a‐5p knock‐down in SKOV‐3 and COC1 cell lines by Western blot. H, I, the suppressive role of FEZF1AS1 knock‐down on SOX4 protein level was partially recovered via inhibiting miR‐130a‐5p. *P < .05, **P < .01

DISCUSSION

FEZF1AS1 is located on chromosome 7 on the opposite strand of FEZF1. FEZF1AS1 acts as an oncogene in gastric cancer by activating Wnt signalling pathway or suppressing p21 expression.11, 15 The oncogenic roles of FEZF1AS1 were also observed in colorectal cancer and lung cancer.16, 17 Also, LncRNA FEZF1AS1 has been revealed as potential therapeutic target, its expression was significantly associated with the overall survival of patients with hepatocellular carcinoma.18 Similarly, in this study, FEZF1AS1 was found as oncogenic lncRNA, which was significantly increased in both serums and EOC tissues. Kaplan‐Meier analysis found that higher FEZF1AS1 expression was related to adverse clinical pathological parameters as well as poor survival rate, such as lymph node metastasis, higher pathological T stage, invasion and distant metastasis. Furthermore, the present study suggested that serum FEZF1AS1 level was capable of differentiating EOC patients from the healthy controls. Furthermore, the study revealed that FEZF1AS1 was promising to be taken as an important diagnostic as well as prognostic predictor for those with EOC. Functional experiments found that silencing of FEZF1AS1 remarkably suppressed cell colony formation, proliferation, migrative and invasive abilities, whereas enhanced cell apoptosis of EOC. This is for the first time uncovered the function of FEZF1AS1 expression in EOC patients, potentiating that FEZF1AS1 promoted tumour formation in EOC metastasis as well as progression. miR‐130a‐5p has been indicated to be expressed in different kind of tumours, which played a inhibitory role in modulating cell proliferation and apoptosis of cancer cells. Xian et al19 reported that miR‐130a‐5p regulated CB1R expression through the Wnt/β‐catenin signalling pathway. Moreover, Xu et al demonstrated that HOXA11‐AS exerted its oncogenic functions in glioma cells by epigenetically suppressing miR‐130a‐5p.20 Consistently, we observed notably increased miR‐130a‐5p expression after silencing of FEZF1AS1 in COC1, SKOV‐3 and PEO1 cells. Meanwhile, a negative correlation was found between the expression of miR‐130a‐5p and FEZF1AS1 in EOC tissues. Furthermore, a luciferase assay detected that FEZF1AS1 directly bound with miR‐130a‐5p. miR‐130a‐5p inhibition reversed the suppressive effects of FEZF1AS1 knock‐down on EOC tumour proliferation as well as distant metastasis. Taken together, FEZF1AS1 inhibited miR‐130a‐5p by regulating its downstream targets in EOC. Sox4, a transcription factor of the member of the Sry‐related high mobility group box (Sox) family, was recognized a master mediator in cancer stemness and tumorigenicity.21 SOX4 has been revealed to promote tumorigenesis in diverse cancers, including prostate cancer, gastric cancer and liver cancer.22, 23, 24 A recent study demonstrated that Sox4 was regulated by lncBRM via competitively binding miR‐204.25 The present study found the overexpression of SOX4 both in EOC cell lines and tissues. Furthermore, expression of SOX4 protein in COC1, SKOV‐3 and PEO1 cells was significantly reduced after silencing of the FEZF1AS1. In addition, the overexpression of SOX4 partially restored the suppressive impact of sifezf1as1 on the growth of cells after being cotransfected with siFEZF1AS1 and SOX4 overexpression plasmids into EOC cell lines. It was proved that FEZF1AS1 may regulate the proliferation of EOC cells via modulating SOX4 expression. The apoptosis rates of EOC cells increased significantly by FEZF1AS1 knock‐down. Besides, the expressions of Bcl‐2 family members and cleaved caspase3 were up‐regulated by silencing of FEZF1AS1. For some miRNAs, SOX4 has been identified as a target site. For instance, by targeting SOX4, miR‐130a‐5p served as a tumour inhibitor in gastric cancer.3 Interestingly, in vitro studies showed that SOx4 expression was repressed by overexpression of miR‐130a‐5p and enhanced by blocking of miR‐130a‐5p. miR‐130a‐5p‐5p was verified to directly bind with SOX4 in EOC, and further it was confirmed that FEZF1AS1 interacted with SOX4 to regulate cell migration, proliferation, and invasion of EOC. Therefore, it could be concluded that FEZF1AS1 regulated SOX4 via miR‐130a‐5p. Mechanistic study showed that the suppressive effect of FEZF1AS1 knock‐down on SOX4 expression was partially restored with miR‐130a‐5p inhibition (Figure 7). All these data further confirmed that FEZF1AS1 regulated SOX4 through miR‐130a‐5p. However, there are still several limitations in this study. Even though we showed that knock‐down of FEZF1AS1 significantly inhibited proliferation and invasion of EOC cell lines, whether overexpression of FEZF1AS1 can enhance those processes remains to be explored. In addition, further studies still needed to explore the functional of FEZF1AS1 in regulating the progression of EOC in a larger cohort.
Figure 7

The hypothetical diagram with indicating relationships with each parameter

The hypothetical diagram with indicating relationships with each parameter

CONCLUSIONS

In summary, it was for the first time discovered that the function of FEZF1AS1 was critical in the tumorigenesis of EOC. This study revealed that FEZF1AS1/miR‐130a‐5p/SOX4 axis was involved in tumour metastasis and proliferation of EOC cells, which will facilitate the exploration of novel treatment strategies for EOC.

CONFLICT OF INTEREST

The authors declare that they have no competing interests.

AUTHOR CONTRIBUTIONS

LXJ and SZQ designed the experiments; SZQ and GSY performed the experiment, XLL analysed the data; SZQ wrote the paper. All authors read and approved the final manuscript.
  26 in total

1.  The lncRNA HOXA11-AS promotes glioma cell growth and metastasis by targeting miR-130a-5p/HMGB2.

Authors:  C-H Xu; L-M Xiao; Y Liu; L-K Chen; S-Y Zheng; E-M Zeng; D-H Li
Journal:  Eur Rev Med Pharmacol Sci       Date:  2019-01       Impact factor: 3.507

2.  LncRNA-FEZF1-AS1 Promotes Tumor Proliferation and Metastasis in Colorectal Cancer by Regulating PKM2 Signaling.

Authors:  Zehua Bian; Jia Zhang; Jiwei Zhang; Min Li; Yuyang Feng; Xue Wang; Surui Yao; Guoying Jin; Jun Du; Weifeng Han; Yuan Yin; Shenglin Huang; Bojian Fei; Jian Zou; Zhaohui Huang
Journal:  Clin Cancer Res       Date:  2018-06-18       Impact factor: 12.531

3.  LncRNA FEZF1-AS1 enhances epithelial-mesenchymal transition (EMT) through suppressing E-cadherin and regulating WNT pathway in non-small cell lung cancer (NSCLC).

Authors:  Rong He; Fei Hu Zhang; Ning Shen
Journal:  Biomed Pharmacother       Date:  2017-09-12       Impact factor: 6.529

Review 4.  SOX4 is a potential prognostic factor in human cancers: a systematic review and meta-analysis.

Authors:  J Chen; H L Ju; X Y Yuan; T J Wang; B Q Lai
Journal:  Clin Transl Oncol       Date:  2015-08-07       Impact factor: 3.405

5.  LncRNA CCAT1/miR-130a-3p axis increases cisplatin resistance in non-small-cell lung cancer cell line by targeting SOX4.

Authors:  Baoli Hu; Haifeng Zhang; Zuopei Wang; Feng Zhang; Haitao Wei; Li Li
Journal:  Cancer Biol Ther       Date:  2017-10-11       Impact factor: 4.742

6.  LncRNAs H19 and HULC, activated by oxidative stress, promote cell migration and invasion in cholangiocarcinoma through a ceRNA manner.

Authors:  Wen-Tao Wang; Hua Ye; Pan-Pan Wei; Bo-Wei Han; Bo He; Zhen- Hua Chen; Yue-Qin Chen
Journal:  J Hematol Oncol       Date:  2016-11-03       Impact factor: 17.388

7.  Long non-coding RNA CASC2 suppresses epithelial-mesenchymal transition of hepatocellular carcinoma cells through CASC2/miR-367/FBXW7 axis.

Authors:  Yufeng Wang; Zhikui Liu; Bowen Yao; Qing Li; Liang Wang; Cong Wang; Changwei Dou; Meng Xu; Qingguang Liu; Kangsheng Tu
Journal:  Mol Cancer       Date:  2017-07-17       Impact factor: 27.401

Review 8.  LncRNA-mediated regulation of cell signaling in cancer.

Authors:  W-X Peng; P Koirala; Y-Y Mo
Journal:  Oncogene       Date:  2017-06-12       Impact factor: 9.867

Review 9.  Sox4, EMT programs, and the metastatic progression of breast cancers: mastering the masters of EMT.

Authors:  Jenny G Parvani; William P Schiemann
Journal:  Breast Cancer Res       Date:  2013       Impact factor: 6.466

Review 10.  Regulation of lncRNA and Its Role in Cancer Metastasis.

Authors:  Juan Li; Hui Meng; Yun Bai; Kai Wang
Journal:  Oncol Res       Date:  2016       Impact factor: 5.574

View more
  7 in total

1.  lncRNAHIF1A-AS2 Promotes Renal Carcinoma Cell Proliferation and Migration via miR-130a-5p/ERBB2 Pathway.

Authors:  Yunxiao Zhu; Ziyi Yang; Han Chen; Yang Pan; Lifeng Gong; Falin Chen; Xiaoxiang Jin; Shuang Wen; Yi Li; Gang Chen
Journal:  Onco Targets Ther       Date:  2020-10-01       Impact factor: 4.147

2.  Long non-coding RNA FEZF1-AS1 induced progression of ovarian cancer via regulating miR-130a-5p/SOX4 axis.

Authors:  Ziqian Sun; Shouyang Gao; Lili Xuan; Xiaojun Liu
Journal:  J Cell Mol Med       Date:  2020-03-05       Impact factor: 5.310

Review 3.  The Challenges and Opportunities of LncRNAs in Ovarian Cancer Research and Clinical Use.

Authors:  Martín Salamini-Montemurri; Mónica Lamas-Maceiras; Aida Barreiro-Alonso; Ángel Vizoso-Vázquez; Esther Rodríguez-Belmonte; María Quindós-Varela; María Esperanza Cerdán
Journal:  Cancers (Basel)       Date:  2020-04-21       Impact factor: 6.639

Review 4.  The Role of Long Non-Coding RNAs (lncRNAs) in Female Oriented Cancers.

Authors:  Faiza Naz; Imran Tariq; Sajid Ali; Ahmed Somaida; Eduard Preis; Udo Bakowsky
Journal:  Cancers (Basel)       Date:  2021-12-03       Impact factor: 6.639

5.  MicroRNA miR-23b-3p promotes osteosarcoma by targeting ventricular zone expressed PH domain-containing 1 (VEPH1)/phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) pathway.

Authors:  Liang Fan; Xing Cao; Yanrong Lei
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

Review 6.  The long and short non-coding RNAs modulating EZH2 signaling in cancer.

Authors:  Sepideh Mirzaei; Mohammad Hossein Gholami; Kiavash Hushmandi; Farid Hashemi; Amirhossein Zabolian; Israel Canadas; Ali Zarrabi; Noushin Nabavi; Amir Reza Aref; Francesco Crea; Yuzhuo Wang; Milad Ashrafizadeh; Alan Prem Kumar
Journal:  J Hematol Oncol       Date:  2022-03-02       Impact factor: 17.388

7.  Dexmedetomidine promotes apoptosis and suppresses proliferation of hepatocellular carcinoma cells via microRNA-130a/EGR1 axis.

Authors:  Lei Zhou; Juanni Li; Xing Liu; Yongzhong Tang; Tunliang Li; Huiyin Deng; Jia Chen; Xinlin Yin; Kuan Hu; Wen Ouyang
Journal:  Cell Death Discov       Date:  2022-01-19
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.