Literature DB >> 32078630

Target Of Rapamycin pathway in the white-rot fungus Phanerochaete chrysosporium.

Duy Vuong Nguyen1, Thomas Roret1, Antonio Fernandez-Gonzalez1, Annegret Kohler1, Mélanie Morel-Rouhier1, Eric Gelhaye1, Rodnay Sormani1.   

Abstract

The Target Of Rapamycin (TOR) signaling pathway is known to regulate growth in response to nutrient availability and stress in eukaryotic cells. In the present study, we have investigated the TOR pathway in the white-rot fungus Phanerochaete chrysosporium. Inhibition of TOR activity by rapamycin affects conidia germination and hyphal growth highlighting the conserved mechanism of susceptibility to rapamycin. Interestingly, the secreted protein content is also affected by the rapamycin treatment. Finally, homologs of the components of TOR pathway can be identified in P. chrysosporium. Altogether, those results indicate that the TOR pathway of P. chrysosporium plays a central role in this fungus.

Entities:  

Year:  2020        PMID: 32078630      PMCID: PMC7032718          DOI: 10.1371/journal.pone.0224776

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The Target Of Rapamycin (TOR) signaling pathway is highly conserved among eukaryotes and regulates essential cellular processes including protein synthesis, ribosome biogenesis, autophagy, and cytoskeleton organization [1]. In fungi, the TOR pathway is involved in the response to nutrient resources availability, this being true for carbon and especially sugar and nitrogen [2,3]. TOR is also involved in the stress responses, such as osmotic and oxidative stresses [4-6]. The serine/threonine-protein kinase TOR, firstly identified in Saccharomyces cerevisiae [7] is the central component of the TOR signaling pathway. This kinase interacts with other partners to form two multiprotein complexes named TORC1 and TORC2. Both complexes regulate their targets by phosphorylation. Of these two complexes, only TORC1 is sensitive to rapamycin [8,9]. Rapamycin binds to FK506 Binding Protein 12 (FKBP12) and the FK506 Rapamycin Binding (FRB) domain of TOR resulting in the inhibition of the TOR kinase activity and cell growth arrest. The sensitivity to rapamycin has permitted to decipher the TOR signaling pathway in numerous organisms. In fungi, the yeast models S. cerevisiae and Schizosaccharomyces pombe have been extensively studied even if the first report of the antifungal activity of rapamycin has been obtained with the human pathogenic fungus Candida albicans [10]. Since, rapamycin has been successfully tested either with pathogenic fungi such as Cryptococcus neoformans [11], Botrytis cinerea [12], Mucor circinelloides [13], Fusarium graminearum [14], or soft rot fungi [15]. Sensitivity to rapamycin has been observed in all fungal lineages tested underlying conservation of the targets: TOR complexes and the mechanism of action, the TOR signaling pathway [16]. Most studies on fungal TOR signaling pathways have been conducted in ascomycetes, while data on basidiomycetes other than C. neoformans are scarce [13,16]. In Pleurotus ostreatus for instance, the TOR gene is duplicated and orthologs of the TOR pathway are present suggesting a conservation of that signaling pathway. Recently, a link between SLT2-MAPK, involved in the cell wall integrity signaling, and the TOR pathway has been reported in the edible mushroom and medicinal fungus Ganoderma lucidum [17]. In that case, TOR signaling is involved in the regulation of chitin and β-1,3-glucan synthesis and hence of cell wall thickness in a SLT2-MAPK dependent manner [17]. Among basidiomycetes, white rot fungi are very interesting ecological models because of their ability to grow on dead wood and to mineralize it. Wood is considered as a very specific ecological niche: indeed it contains recalcitrant carbon sources, low nitrogen content and potentially a highly toxic environment due to the presence of wood extractives [18]. To adapt to this environment, white rot fungi secrete a large set of enzymes involved in the degradation of wood polymers (cellulose, hemicelluloses and lignin) and possess an extended intracellular detoxification network [19-22]. These two complex machineries require a fine and coordinated regulation system that is up to date largely unknown in particular due to the lack of genetic tools for white-rot basidiomycetes. To test whether the TOR pathway could be involved in regulating the secretion of enzymes involved in lignocellulose decomposition, we tested the effect of rapamycin on Phanerochaete chrysosporium growth and secretome composition. By combining genome mining, structure modeling, we identified in this study the TOR signaling pathway of P. chrysosporium and highlighted its role in regulating the extracellular secreted protein composition.

Material and methods

Fungal strain

The homokaryotic strain P. chrysosporium RP78 was used in this study. This is the most widely used strain of P. chrysosporium in studies posterior to 2000, especially after its genome sequence was published in 2004 [23]. A version 2.0 of genomic database is available on https://genome.jgi.doe.gov/Phchr2/Phchr2.home.html. The mycelium is maintained on solid malt extract agar medium (20g.L-1 and 30g.L-1 respectively).

Growth curve measurement

Germination of P. chrysosporium RP78 conidia was measured using a nephelometric reader (NEPHELOstar Galaxy, BMG Labtech, Offenburg, Germany). For inocula, suspensions of spores were obtained from 8 day-old mycelia grown on sporulation medium (Glucose (10 g.L-1), malt extract (10 g.L-1), peptone from potato (2 g.L-1); yeast extract (2 g.L-1), asparagine (1 g.L-1), KH2PO4 (2 g.L-1), MgSO4.7H2O (1 g.L-1), thiamine HCl (1 mg.L-1), Agar (30 g.L-1), all chemicals used were purchased from Sigma Aldrich. Spores were collected with gentle scraping of the agar plates and filtration through Miracloth. The number of spores per 1 mL of suspension was determined with optical density (OD) measurement at 650 nm, and calculated as previously described [24]. For each microplate well, 200 μl of sample were prepared: 10,000 spores were resuspended in 198 μL of malt 1% and 2 μL of rapamycin (LC laboratories, R-5000) were added for treatment or 2 μl of DMSO as mock for control. Equipment was set up with the following parameters: temperature of incubation was 37°C, cycle time 1 hour and the sum of cycles was 72 hours. Relative nephelometric unit (NRU) values were calculated as previously described [25].

Sample preparation for experiments on extracellular proteins

4×105 fungal spores were inoculated in 10 mL Tien & Kirt medium (with and without 1% glucose) and incubated at 37°C with shaking (120 rpm). After 4 days incubation, the fungal biomass was transferred to a new 10 mL of Tien & Kirk medium with 10 μL of DMSO for control, or where 10 μL rapamycin dissolved in DMSO (2 mg.ml-1) was added. Samples were then incubated at 37°C with shaking during 48 hours. Supernatants were harvested and stored at -20°C for further measurements. For each condition, 6 replicates were prepared. Fungal biomasses were dried for 48 hours under vacuum at -85°C with a lyophilizer (VirTis BenchTop Pro freeze dryers) and weighed just after drying.

β-glucosidase activity assay

This enzymatic assay is based on the release of methylumbelliferone (MU) via cleavage of compound MU-β-D-glucopyranoside (MU-G) as the substrate of β-glucosidase (EC3.2.1.3). The stock solutions of the substrate (5 mM) and calibration (25 mM) were prepared in 2-methoxyethanol and were kept at -20°C in the dark. All chemicals were purchased from Sigma Aldrich Chemicals. The working solution of the substrate was prepared by dilution with sterile ultrapure water to the final concentration of 500 μM. The fluorogenic assay was prepared in a black 96-well microplate. The reaction mixture in each well included 50 μL of sodium acetate buffer (100 mM), 50μl of culture supernatant and 50 μL of working solution of the substrate. The plate also included calibration wells to obtain fluorescene signals for concentration of released MU, which was calculated from the resulting regression line. The plate was then incubated at 25°C and shaken at 600 rpm. 100 μL of stopping buffer (Tris 2.5M, pH 11) was added into mixture of reaction after 15, 30, 45 and 60 minutes of incubation to stop reaction. Measurements were performed in Victor3 microplate reader (Perkin-Elmer life sciences, France) with excitation wavelength set to 360 nm and emission wavelength set to 450 nm.

Sample preparation and protein quantification

After 20 minutes of centrifugation at 3,000 rpm (model 5810/5810 R, Eppendorf) to remove remaining fungal cells, supernatants from 6 replicates were mixed together and vaporized to remove all liquid under vacuum, at -85°C with a lyophilizer (VirTis BenchTop Pro freeze dryers). Pellets were dissolved with ultrapure sterile water in 0.5 volume of the initial volume. 1 mL of this new supernatant was purified for protein quantification. For purification, proteins were precipitated by mixing 1 mL of secreted sample with 200 μl saturated TCA and incubated overnight at -20°C. Samples were centrifuged at 13,400 rpm at 4°C for 20 minutes. Supernatants were discarded and the pellets were washed twice with cold acetone. The Interchim Protein Quantification BC assay kit was used for protein quantification. Purified proteins were dissolved with 50 μL of 0.2% SDS before adding the working solution of the provider. Reaction mixtures were incubated at 37°C for 30 minutes and at cold room or in a fridge for 5 minutes. To determine protein content, the OD was measured at 562 nm with a spectrophotometer Cary50 (Varian).

Proteomic analyses

Samples were produced from the supernatants of 6 replicates mixed together for each condition tested. Pellet of 20μg of protein were resuspended in 20 μL Urea, 6 M, Tris, 50 mM, pH 8.0 and samples were processed as follows: Cysteine residues were reduced by addition of 4 mM DTT for 45 minutes, alkylated by addition of iodoacetic acid (IAA) at 40 mM for another 45 min and IAA was blocked by addition of excess DTT (40 mM) for 10 minutes. 180 μL of a solution containing Tris-HCl, 50 mM pH 8.0, CaCl2, 1 mM were added together with 1/100th (weight trypsin/weight protein extract) sequencing grade trypsin and digestion was allowed to occur overnight at 37°C. Samples were then acidified by addition of 10 μL TFA 10%. Samples were fractionated by NanoHPLC on an Ultimate3000 system equipped with a 20 μL sample loop, a pepMap 100 C18 desalting precolumn and a 15 cm pepMap RSLC C18 fractionation column (all from Dionex). Samples (6.4 μL) were injected using the μlpickup mode and eluted by a 2 to 45% acetonitrile gradient over 60 minutes at 300 nL.min-1. Fractions (340, 9 seconds each) were collected with a ProteineerFcII (Bruker) over 51 minutes and eluted fractions were directly mixed on MTP-1536 BC target (Bruker) spots with α-cyano-4-hydroxycinnamic acid (Bruker). LC-MALDI runs dedicated to peptide identification were processed using dedicated automatic methods piloted by WARP-LC software on an Autoflex speed MALDI-TOF/TOF mass spectrometer (Bruker), first in MS mode in the 700–3,500 mass range, using next-neighbour external calibration for all MALDI spots. Thereafter, masses with S/N > 6 were processed for MS/MS analysis in LIFT mode. Peptide assignments were performed from TOF/TOF spectra by Mascot interrogation (Matrix Science) of the P. chrysosporium database piloted in Mascot and compiled by Proteinscape with a mass tolerance of 50 ppm in TOF mode and 0.8 Da in TOF/TOF mode, with optional cysteine carbamidomethylation, methionine oxidation and without enzyme cut. The minimal mascot score for peptides was set to 20 and that for proteins was set to 80. Results were cross-validated by interrogating an irrelevant database using the same criteria. Proteins were considered found in a given sample only if identified with a score above 80. When confronted to the random decoy strategy, this score resulted in a false discovery rate < 1%. The other way around, proteins were considered missing only if they were not identified at all. We could not calculate the effective lack of discovery rate in this specific experiment, but in other, technically similar contexts, such proteins exhibited levels at least 20-fold lower than those identified with a score of 80, with less than 2% errors.

PCR isolation and sequencing of the PcFkbp12 gene and FRB domains coding sequences

Genomic DNA extractions were performed from 3-day old liquid cultures of WT using QIAGEN DNeasy plant kit according to the manufacturer’s instruction. To analyze the sequences of Fkbp12 and of the FRB domain coding sequences, a first step of PCR was done using primers: 5’ACTCAGTCCAACCGTACCTG3’ (forward) and 5’CGAATGACCCGTCGACAATC3’ (reverse) for Fkbp12 and 5’TCAGTCGAGAGCTCATCAGG3’ (forward) and 5’ACGGCCAACTGAAGATTACG3’ (reverse) to amplify the FRB domain sequences. The PCR reactions were performed using Gotaq Flexi DNA polymerase (Promega) and equipment Mastercycler Nexus41 of Eppendorf. PCR products were visualized on agarose gel then purified using PCR DNA and Gel Band Purification kit (GE Healthcare, UK). Plasmid pGEMt was used for the ligation of purified PCR products according to manufacturer’s protocol (Promega A1360, USA). The reaction mixture includes 5μl of buffer 2X, 1μl of plasmid pGEMt, 3μl of PCR products and 1 μL of T4 DNA ligase. This mixture was incubated overnight at 4°C and used to transform Escherichia coli DH5α. Plasmid purification was performed using PureYield ™ Plasmid Miniprep system kit (Promega) following instructions of the provider. Purified plasmids were stored at -20°C before being sent to sequencing using T7p and SP6 universal primers (GENEWIZ, UK).

3D modeling of the Fkbp12-rapamycin-Tor complex in P. chrysosporium

The models of Fkbp12 and the FRB domain of Tor 3D from P. chrysosporium were generated by homology modeling. The models used were the FK506-binding protein 1A from Aspergillus fumigatus (73% identity; pdb entry:5hwb) for Fkbp12 and the serine/threonine-protein kinase TOR from human (63% identity; pdb entry:4jsp) for Tor. Then, the Fkbp12-rapamycin-Tor complex was built by superimposition with the crystal structure of the human complex (pdb entry: 1fap) for Tor1 and Tor2. The side chain and rotamers were optimized using YASARA’s refinement protocol [26].

Results and discussion

P. chrysosporium is sensitive to rapamycin

In the model yeast S. cerevisiae, the Tor kinase pathway is the central regulator of the cellular response to nutrient limitation and stresses. Rapamycin treatment that inactivates Tor leads to various effects at different levels and results in cell growth arrest. This prompted us to investigate the effect of rapamycin on P. chrysosporium growth. First, various amounts of rapamycin were applied to P. chrysosporium spores, and conidia germination rates were analyzed using nephelometric experiments (Fig 1A). In the tested conditions, controls without rapamycin displayed a three-step growth curve, with a lag phase (t = 0h to 7.33h ± 0.5), followed by an exponential phase (t = 7.33h ± 0.5 to 30.9h ± 2.7) and then a stationary phase (after t = 30.9h ± 2.7). The lowest tested concentration of rapamycin (100 ng.mL-1) induced an increase both of the lag (37.7h ± 2.5 instead of 7.33h ± 0.5), and exponential (more than 30 hours instead of 20 hours) phases. Higher concentrations of rapamycin (200 and 500 ng.mL-1) induced a similar growth pattern, increasing the lag phase and decreasing the measured growth rates during the exponential phase. At 1 μg.mL-1 and 2 μg.mL-1, rapamycin completely inhibited germination.
Fig 1

Effect of rapamycin on P. chrysosporium growth.

A. Growth curve measured after germination of conidia from P. chrysosporium RP78 in liquid medium using nephelometric measurement with different concentrations of rapamycin. Those curves represent means ± SD of n = 3 replicates. B. Effect of rapamycin on hyphae growth in solid medium (agar plate). Rapamycin dissolved in DMSO was loaded on Whatman filter paper dots, DMSO was used as control, and both were used as in a disk diffusion test. Movie of the corresponding experiment is provided in S1 Movie.

Effect of rapamycin on P. chrysosporium growth.

A. Growth curve measured after germination of conidia from P. chrysosporium RP78 in liquid medium using nephelometric measurement with different concentrations of rapamycin. Those curves represent means ± SD of n = 3 replicates. B. Effect of rapamycin on hyphae growth in solid medium (agar plate). Rapamycin dissolved in DMSO was loaded on Whatman filter paper dots, DMSO was used as control, and both were used as in a disk diffusion test. Movie of the corresponding experiment is provided in S1 Movie. The effects of rapamycin were also tested on P. chrysosporium growing on solid medium. Three different amounts of rapamycin dissolved in DMSO were dropped on Whatman paper dots placed near P. chrysosporium growing mycelia to perform a diffusion test (Fig 1B). During that experiment, growth was observed on control with DMSO but even the lowest amount of rapamycin tested (1 μg) led to growth inhibition (Fig 1B, S1 Movie).

Effect of TOR inhibition on the protein secretion in P. chrysosporium

The secretion of extracellular proteins plays an important role P. chrysosporium in for the degradation of lignocellulosic material and toxic compounds. As TOR is known to control various cellular processes through sensing nutritional factors such as sugar availability, the function of PcTor as a regulator of extracellular protein content was evaluated with or without glucose and rapamycin. A first experiment was performed to obtain secreted proteins in liquid culture. A wild-type strain was grown for 4 days on synthetic medium with 1% glucose. Then, the mycelium was transferred for 48 hours into fresh medium containing 1% or 0% of glucose, with or without 2 μg.mL-1 of rapamycin. Analysis of dry weights of collected mycelia shows an effect of glucose on fungal growth. Rapamycin inhibits growth in both cases, but this effect was more pronounced with glucose (Fig 2A). Quantitatively, the effect of sugar is not visible on extracellular protein content and with or without glucose there is a decrease due to rapamycin treatment in both tested nutritional conditions (Fig 2B). The β-glucosidase activity was also tested on those samples. With glucose, a decrease of β glucosidase activity can be seen (Fig 2C). Glucose deprivation leads to an increase of that activity and rapamycin could counter act that induction (Fig 2C). Taken together, those results indicate that in these experimental conditions sugar deprivation is perceived, a response occurs and rapamycin acts on the three tested parameters.
Fig 2

Rapamycin affects the secretome in P. chrysosporium.

Five days old liquid cultures of P. chrysosporium were transferred to fresh liquid medium for 48 hours with or without glucose and with or without rapamycin. A. Effect of glucose and rapamycin on dry weight of fungus cultivated in liquid medium. Represented values are means ± SD with n = 6. B. Effect of glucose and rapamycin on the concentration of proteins secreted in the liquid medium as measured using Bradford assays. Values represented are means ± SD with n = 3 C. Beta-glucosidase activity observed in the liquid culture medium containing the secreted enzymes. The activity has been measured using fluorogenic assay. Values represented are means ± SD with n = 6. Two asterisks (**) denote the statistical difference of the added rapamycin medium compare with the control medium (p< 0.05) as determined by the two sample t-test at (A) and (B). Three asterisks (***) and two of them (**) represent (p<0.001) and (p<0.01) as determined by the two sample t-test at (C), respectively. D. Representative Coomassie blue stained SDS-PAGE of the proteins secreted by P. chrysosporium in the conditions described above. 13 μg of proteins were loaded for each condition. Asterisk marks highlighted the major change observed (S1 Raw Image). E. Venn diagram representing the number of common and specific proteins found in the four different conditions analyzed. The list of proteins found in each class is provided in S1 Table.

Rapamycin affects the secretome in P. chrysosporium.

Five days old liquid cultures of P. chrysosporium were transferred to fresh liquid medium for 48 hours with or without glucose and with or without rapamycin. A. Effect of glucose and rapamycin on dry weight of fungus cultivated in liquid medium. Represented values are means ± SD with n = 6. B. Effect of glucose and rapamycin on the concentration of proteins secreted in the liquid medium as measured using Bradford assays. Values represented are means ± SD with n = 3 C. Beta-glucosidase activity observed in the liquid culture medium containing the secreted enzymes. The activity has been measured using fluorogenic assay. Values represented are means ± SD with n = 6. Two asterisks (**) denote the statistical difference of the added rapamycin medium compare with the control medium (p< 0.05) as determined by the two sample t-test at (A) and (B). Three asterisks (***) and two of them (**) represent (p<0.001) and (p<0.01) as determined by the two sample t-test at (C), respectively. D. Representative Coomassie blue stained SDS-PAGE of the proteins secreted by P. chrysosporium in the conditions described above. 13 μg of proteins were loaded for each condition. Asterisk marks highlighted the major change observed (S1 Raw Image). E. Venn diagram representing the number of common and specific proteins found in the four different conditions analyzed. The list of proteins found in each class is provided in S1 Table. We used these experimental parameters to assess qualitatively the extracellular protein contents. From the four treatments, the protein pattern of the secretomes on SDS-PAGE gels exhibited differences in presence of rapamycin for both glucose and glucose-deprived conditions (Fig 2D). Proteomic analyses of the secretomes have been performed for each of the four conditions plus or minus glucose in presence or absence of rapamycin. Samples analyzed were obtained from 6 biological repeats for each treatment. A set of 64 proteins has been identified in those experiments (Fig 2E and S1 Table). These results highlight four points: i. there is a set of 16 proteins found in all four conditions. One of the most abundant proteins found in each case is a copper radical oxidase (AGR57_1123) involved in hydrogen peroxide generation [27] and two GMC oxidoreductases (AGR57_4013 and AGR57_9770). ii. Sugar deprivation increases extracellular protein diversity. Interestingly, four proteins are annotated as protease (AGR57_12626, AGR57_14965, AGR57_1477, AGR57_12049), three are glycoside hydrolases (AGR57_11735, AGR57_12854, AGR57_2053) and an amylase (AGR57_990) can also be found. iii. Proteins identified in point ii are not found in response to rapamycin treatment and iv. more surprisingly we found specific proteins secreted in response to rapamycin and one of them, AGR57_8308, was identified as Fkbp12 (S1 Table).

Identification of Tor and Fkbp12 in P. chrysosporium

In previously studied organisms, rapamycin effect is due to its interaction with two partners: FKBP12 and the FRB domain of TOR [28] (Fig 3B), that leads to the inhibition of the TOR kinase activity. These rapamycin interacting proteins have been searched in the available P. chrysosporium strain RP78 genome [23]. A homolog of Fkbp12 was detected by BLASTp using Fkbp12 sequence from S. cerevisiae as bait (ScFKBP12, SGDID: S000005079). The identified protein PcFkbp12, coded by the gene AGR57_8308 and located at Scaffold 8:545501–546137, exhibits 63.2% of identity with ScFkbp12.
Fig 3

P. chrysosporium possesses two FRB domains that can interact with rapamycin and form TORFRB-Rapamycin-FKBP12 complex.

A. Sequence alignment of the two FRB domains of P. chrysosporium with the FRB domain of HsTOR (protein ID: P42345.1), the 2 FRB domains of S. cerevisiae (Tor1 SGDID:S000003827 and Tor2: SGDID:S000001686), S. pombe (Tor1: SPBC30D10.10c and Tor2: SPBC216.07c from https://www.pombase.org/), P. ostreatus (https://mycocosm.jgi.doe.gov/pages/search-for-genes.jsf?organism=PleosPC15_2, TOR ID: 1113153 and TOR2 ID: 1051426). B. Crystal structure of HsFKBP12-HsFRB-rapamycin ternary complex (pdb entry:1fap). C. 3D model of the predicted structure for P. chrysosporium FKBP12-rapamycin-FRB complexes. FKBP12, FRB and PcFRB1 are colored in blue, purple and green, respectively. Substitutions occurring between PcFRB1 and PcFRB2 are highlighted as yellow sticks. Secondary structures are shown in ribbon representation and the rapamycin is shown as white sticks. D-F. Close-up views of the rapamycin binding site in the human FKBP12-rapamycin-FRB complex (D) and in P. chrysosporium involving PcFRB1 (E) and PcFRB2 (F). Hydrogen bonded residues to the rapamycin are named in black. W93 and F100 aromatic residues are pointed in red, their positions are given from the beginning of the FRB domain.

P. chrysosporium possesses two FRB domains that can interact with rapamycin and form TORFRB-Rapamycin-FKBP12 complex.

A. Sequence alignment of the two FRB domains of P. chrysosporium with the FRB domain of HsTOR (protein ID: P42345.1), the 2 FRB domains of S. cerevisiae (Tor1 SGDID:S000003827 and Tor2: SGDID:S000001686), S. pombe (Tor1: SPBC30D10.10c and Tor2: SPBC216.07c from https://www.pombase.org/), P. ostreatus (https://mycocosm.jgi.doe.gov/pages/search-for-genes.jsf?organism=PleosPC15_2, TOR ID: 1113153 and TOR2 ID: 1051426). B. Crystal structure of HsFKBP12-HsFRB-rapamycin ternary complex (pdb entry:1fap). C. 3D model of the predicted structure for P. chrysosporium FKBP12-rapamycin-FRB complexes. FKBP12, FRB and PcFRB1 are colored in blue, purple and green, respectively. Substitutions occurring between PcFRB1 and PcFRB2 are highlighted as yellow sticks. Secondary structures are shown in ribbon representation and the rapamycin is shown as white sticks. D-F. Close-up views of the rapamycin binding site in the human FKBP12-rapamycin-FRB complex (D) and in P. chrysosporium involving PcFRB1 (E) and PcFRB2 (F). Hydrogen bonded residues to the rapamycin are named in black. W93 and F100 aromatic residues are pointed in red, their positions are given from the beginning of the FRB domain. The second partner binded by Fkbp12-Rapamycin is Tor. The organization of Tor primary sequence is conserved in all eukaryotic organisms, with the presence of several domains from the N terminal part to the C-terminal part: a HEAT repeat domain, a FAT domain, a FRB domain, the Kinase domain and then a FATC domain. The corresponding gene has been found duplicated in fungal lineages (Fig 3A) [16]. Using the sequences from S. cerevisiae as bait, two sequences were detected in the genome of P. chrysosporium using BLASTp. A first sequence encoded by the gene AGR57_15312 is located on Scaffold 42: 6500–13402 (-). The sequence coding for the FRB domain (PcFRB1) is located between the position 11126 and 11579 of this gene. We found a second hit located on scaffold_20:36724–33343. This sequence returned one transcript sequence AGR57_14232TO. From this gene, the 3’ part of the gene, with the sequence of the FRB domain, was missing from the genomic sequence and the transcript. PcFRB domain sequence was amplified by PCR from genomic DNA from P. chrysosporium RP78 using the identified sequence coding for PcFRB1 to design primers and subsequently cloned. Sequencing of individual clones revealed the presence of two distinct sequences: the sequence encoded by the gene AGR57_15312 (PcFRB1) and another sequence exhibiting 86.8% of identity at nucleotide level and named PcFRB2. Previous transcriptomic data of P. chrysosporium were used [29] (NCBI GEO GSM3381937-39) focusing on the sequencing reads covering the FRB sequence at Scaffold 42. Alignment of those reads revealed the presence of potential SNPs suggesting the presence of two distinct sequences. Using CAP3 sequence assembly program [30], two contigs were obtained, one strictly similar with the sequence coded by AGR57_15312 on scaffold 42 and the other one containing all the mismatches observed in the cloning experiment. Alignment of FRB sequences from human, S. cerevisiae, S. pombe and the basidiomycete P. ostreatus with PcFRB1 and PcFRB2 from P. chrysosporium revealed a high level of conservation (Fig 3). Amino acids required for interaction with rapamycin (W93 and F100) are conserved in those phylogenetically distant species. Residues involved in phosphatidic acid binding in TOR (L24, F31 and Y97) are also conserved. S28, the mutation that is involved in rapamycin resistance in mammalian cells can also be found in all the FRB tested even in both PcFRB (Fig 3A). The Fkbp12-rapamycin-Tor complexes involving FRB1 or FRB2 from P. chrysosporium was generated by homology modeling using a human complex (pdb entry:1fap) followed by an energy minimization (Fig 3B and 3C). The total energy obtained from the YASARA Energy Minimization Server [26] were -32, 174 kcal/mol (score: -0.12) and -32, 257 kcal/mol (score: -0.12) for the refined complexes involving PcFRB1 or PcFRB2, respectively. None of the 4 different residues between PcFRB1 (F29, H71, V86 and K91) and PcFRB2 (Y29, I71, I86 and R91) are involved in complex formation and closed to the rapamycin binding site. Rapamycin is hydrogen bonded to the D38, G54, K55, I57 and Y83 residues from PcFkbp12 (Fig 3D–3F) and also interacts through close contacts with aromatic residues as already described [28]. Among these aromatic residues, W93 and F100 residues from both FRB domains (Fig 3E and 3F) are required for interaction with rapamycin. This suggests that rapamycin can interact with the two PcFRB domains.

Conservation of the TOR pathway in P. chrysosporium

In the fungal kingdom, the TOR pathway has been extensively studied in model yeast S. cerevisiae, S. pombe, and the pathogenic Candida albicans. In other fungal lineages, ortholog proteins involved in the TOR pathway have been identified by gene homology and for the Basidiomycota lineage, only data for P. ostreatus were available presently [16]. The TOR pathway can be divided into three parts, the TOR complexes called TORC1 and TORC2, an upstream part composed of proteins involved in signal transduction and a downstream part including direct targets of the TOR kinase activity. Orthologs identified in P. chrysosporium by gene homology for these three parts are summarized in Tables 1, 2 and 3 respectively.
Table 1

Identified elements of TOR complexes of Phanerochaete chrysosporium in comparison with elements of TOR complexes of Saccharomyces cerevisiae and Schizosaccharomyces pombe.

S. cerevisiae or S. pombeP. chrysosporium
complexStandard nameSGD Systematic nameSGD IDPombaseProposed nameGene IDLocationProtein length% of identity% of similarity
TORC1/C2Lst8YNL006WS000004951PcLst8AGR57_579SC001:1196227-1197784(+)32658.174.2
Wat1/Pop3SPBC21B10.05c61.576.5
TORC1Kog1YHR186CS000001229PcKog1AGR57_11672SC013:163355-168458(-)156130.445.3
Kog1SPAC57A7.1133.349.5
Tco89YPL180WS000006101SPCC162.12Not detected
TORC2Bit2YBR270CS000000474AGR57_12865SC015:519331–521649 (+)53413.922.4
SPAC6B12.03c12.721.3
Bit61YJL058CS000003594AGR57_12865SC015:519331–521649 (+)53413.324.0
SPCC777.08c14.424.2
Avo1YOL078WS000005438PcAvo1AGR57_5388SC005:594533–598186 (-)90819.231.6
Sin1SPAPYUG7.02c22.437.8
Avo2YMR068WS000000895Not detected
Avo3/Tsc11YER093CS000000895PcAvo3AGR57_8271SC008:473094-478330(-)133418.637.1
Ste20SPBC12C2.02c30.250.9

Saccharomyces cerevisae data from https://www.yeastgenome.org/

Shizosaccharomyces pombe data from https://www.pombase.org/

Blast done at http://fungidb.org/fungidb/

% of identity and similarity at https://www.ebi.ac.uk/Tools/psa/emboss_needle/

Table 2

Identified upstream elements of the TOR signaling pathway of Phanerochaete chrysosporium in comparison with upstream elements of TOR pathway of Saccharomyces cerevisiae and Schizosaccharomyces pombe.

S. cerevisiae or S. pombeP. chrysosporium
complexeStandard nameSGD Systematic nameSGD IDPombaseProposed nameGene IDLocationProtein length% of identity% of similarity
Tsc1/Tsc2Tsc1SPAC22F3.13PcTsc1AGR57_528SC001:1108704-1111851(-)92520.836.6
Tsc2SPAC630.13cPcTsc2AGR57_9302SC008:783034-788376(+)176318.832.1
Rhb1YCR027CS000000622PcRhb1AGR57_1568SC002:138810–139648(+)19440.163.2
SPBC428.16c56.671.4
Gtr1/Gtr2Gtr1YML121WS000004590PcGtr1AGR57_793SC001:1652706-1653971(+)34840.757.3
SPBC337.13c45.664.8
Gtr2YGR163WS000003395PcGtr2AGR57_4381SC004:781482-783110(+)43525.743.7
SPCC777.0531.444.6
Ego1/Meh1YKR007WS000001715Not detected
Ego3/Slm4YBR077CS000000281Not detected
Vam6YDL077CS000002235PcVam6AGR57_7116SC007:84318-88231(-)103817.330.0
SPAC23H4.1423.3
SEACITNpr2YEL062WS000000788PcNpr2AGR57_425SC001:882467-884614(-)63218.229.8
SPAC23H3.03c23.238.1
Npr3/Rmd11YHL023CS000001015PcNpr3AGR57_4386SC004:792751-795311(-)78116.529.4
SPBC543.0420.536.8
YJR138WS000003899PcIml1AGR57_11382SC012:775902-781246(-)163924.041.7
SPBC26H8.04c26.442.1
SEACATSeh1YGL100WS000003068PcSeh1AGR57_5195SC005:129083-130804(+)43030.545.4
SPAC15F9.0229.647.0
Sec13/Anu3YLR208WS000004198PcSec13AGR57_14171SC019:388062-389213(+)33251.664.8
SPBC215.1553.668.3
Sea2/Rtc1YOL138CS000005498PcSea2AGR57_7036SC006:1979960-1984607(-)129916.428.4
SPAC4F8.1119.230.9
Sea4YBL104CS000000200PcSea4AGR57_6153SC006:62362-66094(-)112322.936.6
SPAC12G12.01c24.438.2
Sea3/Mtc5YDR128WS000002535PcSea3AGR57_731SC001:1518472-1523186(+)123826.039.9
SPAC11E3.0523.837.4
Lst4/Lst7Lst4YKL176C/S000001659SPAC30C2.07Not detected
Lst7/ Bhd1YGR057C/S000003289SPBC24C6.08cNot detected
Snf1YDR477WS000002885PcSnf1AGR57_13796SC018:113339–115564 (+)60736.850.8
Ssp235.449.2

Saccharomyces cerevisiae data from https://www.yeastgenome.org/

Shizosaccharomyces pombe data from https://www.pombase.org/

Blast done at http://fungidb.org/fungidb/

% of identity and similarity at https://www.ebi.ac.uk/Tools/psa/emboss_needle/

Table 3

Identified downstream elements of the TOR signaling pathway of Phanerochaete chrysosporium in comparison with downstream elements of TOR pathway of Saccharomyces cerevisiae and Schizosaccharomyces pombe.

S. cerevisiae or S. pombeP. chrysosporium
Target ofStandard nameSGD Systematic nameSGD IDPombaseProposed nameGene IDLocationProtein length% of identity% of similarity
TORC1Tap42YMR028WS000004630PcTap42AGR57_809SC001:1683869–1685426 (-)38924.142.7
SPCC63.0527.143.0
TORC1Sit4YDL047WS000002205PcSit4AGR57_15090SC027:124552–125781 (+)30555.975.9
SPCC1739.1258.279.1
TORC1Sch9YHR205WS000001248PcSch9AGR57_2503SC002:2055146–2058000 (+)67534.646.0
SPAC1B9.02c36.347.9
TORC2Ypk1YKL126WS000001609PcYpk1-2 or PcGad8AGR57_11425SC012:862786-864920(+)44.355.9
AGR57_8253SC008:439512-441528(+)56.670.3
TORC2Ypk2YMR104CS000004710PcYpk1-2 or PcGad8AGR57_11425SC012:862786-864920(+)54741.953.7
AGR57_8253SC008:439512-441528(+)54939.953.8
TORC1/2Gad8SPCC24B10.07PcYpk1-2 or PcGad8AGR57_8253SC008:439512-441528(+)54951.764.0
AGR57_11425SC012:862786-864920(+)54753.668.3
TORC2Pkc1YBL105CS000000201AGR57_14288SC020: 136736–140671 (+)36.851.5

Saccharomyces cerevisiae data from https://www.yeastgenome.org/

Shizosaccharomyces pombe data from https://www.pombase.org/

Blast done at http://fungidb.org/fungidb/

% of identity and similarity at https://www.ebi.ac.uk/Tools/psa/emboss_needle/

Saccharomyces cerevisae data from https://www.yeastgenome.org/ Shizosaccharomyces pombe data from https://www.pombase.org/ Blast done at http://fungidb.org/fungidb/ % of identity and similarity at https://www.ebi.ac.uk/Tools/psa/emboss_needle/ Saccharomyces cerevisiae data from https://www.yeastgenome.org/ Shizosaccharomyces pombe data from https://www.pombase.org/ Blast done at http://fungidb.org/fungidb/ % of identity and similarity at https://www.ebi.ac.uk/Tools/psa/emboss_needle/ Saccharomyces cerevisiae data from https://www.yeastgenome.org/ Shizosaccharomyces pombe data from https://www.pombase.org/ Blast done at http://fungidb.org/fungidb/ % of identity and similarity at https://www.ebi.ac.uk/Tools/psa/emboss_needle/ TORC1 is known to control translation at different steps and its activity is sensitive to rapamycin treatment while TORC2 is insensitive to rapamycin and coordinate growth with plasma membrane production and cell wall integrity [8,9,31]. TORC1 and TORC2 have 2 proteins in common: the kinase Tor and a binding partner called Lst8 in S. cerevisiae or Wat1 in S. pombe. An ortholog, PcLst8, can be found in P. chrysosporium (Table 1) with 58% of identity with ScLst8 and 61.5% of identity with SpWat1. TORC1 is also defined by the presence of Kog1. Interacting with Tor, Kog1 recruits targets for TOR kinase activity. The functional homolog of Kog1 in plant and animal cells is RAPTOR [1]. In P. chrysosporium, an ortholog called PcKog1 could be identified, this protein exhibiting 30.4% of identity with ScKog1 and 33.3% with SpKog1. Tco89 is TORC1 specific and can be found in yeasts S. cerevisiae and S. pombe, but could not be identified in P. chrysosporium. This is probably due to the low sequence conservation of that protein: SpTco89 and ScTco89 share 11.7% of identity and 19.9% of similarity. In S. cerevisiae, in addition to Tor and Lst8, TORC2 is composed of Bit61, Bit2, Avo1, Avo2 and Avo3. Bit61 and Bit2 are paralogs and their sequence share 42.9% of identity and 59.7% of similarity. On the other hand, Bit61 ortholog exists in S. pombe but ScBit61 and SpBit61 sequences share 17% of sequence identity and 29.5% of similarity. That low level of sequence homology could explain why those sequences lead to the identification of the same gene (AGR57_12865) in P. chrysosporium. For Avo2, which has no known ortholog, no match has been found while searching the P. chrysosporium database. PcAvo1 has been identified by its homology with Avo1 but also Sin1 from S. pombe. Finally, PcAvo3 could also been retrieved based on its sequence homology with Avo3 and Ste20 from S. pombe. Concerning the upstream part of the TOR pathway, in S. pombe and animal cells, TSC1 and TSC2 (Tuberous Sclerosis Complex 1 and 2) form a complex that negatively regulates the GTPase-activity of Rheb (Ras homolog enhanced in brain) to activate TORC1. TSC1 and TSC2 orthologs were identified in all fungal species examined to date with the exception of S. cerevisiae [16]. As expected, orthologs named PcTsc1 and PcTsc2 have been detected and also a potential PcRhb1 (Table 2). In S. cerevisiae, TORC1 integrates different signals reflecting its regulation by different upstream regulators [32]. On the one hand, TORC1 is regulated by RAG GTPases Gtr1/Gtr2 in complex with Ego1/Ego2/Ego3. This complex is regulated by the GTP exchange factor Vam6. As orthologs for Gtr1, Gtr2 and Vam6 can be found in other fungal lineages [16], we were able to find, in P. chrysosporium, genes coding for orthologs of Gtr1, Gtr2 and Vam6 but not for Ego1 and Ego3. Gtr1 is also regulated by SEACIT (Seh1 –associated subcomplex inhibiting TORC1) which is bound and negatively regulated by SEACAT (Seh1 –associated subcomplex activating TORC1). SEACIT is composed of Npr2, Npr3 and Iml1 and SEACAT of Sec13, Seh1, Sea2, Sea3, SeA4 (Gonzalez and Hall, 2017). Orthologs of those components can be retrieved in P. chrysosporium (Table 2). On the other hand, Gtr2 activity is regulated by Lst4/Lst7 but no orthologs have been found by sequence homology. Finally, TORC1 activity is regulated by Snf1 in response to cytosolic glucose starvation and an ortholog exists in P. chrysospoiurm. For the downstream part of the TOR pathway in S. cerevisiae, the best known targets of TORC1 are the PP2A phosphatase Sit4, which forms a complex with Tap42 as regulatory subunit and Sch9, an AGC kinase with functional homology to the p70S6 Kinase in animal cells [33]. In P. chrysosporium, we were able to find orthologs for those proteins (Table 3). This result is in accordance with results previously obtained in P. ostreatus but we were also able to find two orthologs for another target of TORC2, Ypk2, while none of them were found in P. ostreatus [16]. The same orthologs were found for Ypk1 and interestingly, the two identified orthologs have an even better identity with Gad8, the target of TORC1 and TORC2 in S. pombe than with Ykp1 (Table 3). Finally, an ortholog has been identified for the TORC2 target Pkc1. All together, these results suggest that TOR pathway from P. chrysosporium is more closely related to S. pombe than S. cerevisiae.

Conclusion

With this study, we found that the TOR pathway play a central role in P. chrysosporium. Using rapamycin, we show that the TOR pathway is involved in conidia germination, vegetative growth and the secreted protein composition. Interestingly, rapamycin treatment leads to the identification of proteins secreted in response to rapamycin. One of them is PcFKBP12 which is an unusual location for this protein. In A. fumigatus, change in localization of AfFKBP12 has been observed in response to the immunosuppressant FK506 but not its secretion [34]. Due to amino acid conservation, the FRB domain of TOR and FKBP12 from P. chrysosporium can interact with rapamycin. The other components of the TOR pathway in P. chrysosporium have been identified and more components are related to the TOR pathway from S. pombe relative to S. cerevisiae.

The effect of rapamycin on P. chrysosporium growth during a diffusion test.

(AVI) Click here for additional data file.

Table of data on the proteins identified during proteomic experiment.

(XLSX) Click here for additional data file.

Unmodified picture of the Coomassie blue stained SDS-PAGE SDS PAGE presented in Fig 2D.

(PDF) Click here for additional data file. 26 Nov 2019 PONE-D-19-29130 Target Of Rapamycin pathway in the white-rot fungus Phanerochaete chrysosporium PLOS ONE Dear Dr sormani, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We were able to secure only one review. Accordingly, the decision is based on that reviewer's comments and my own reading of the manuscript. I generally concur with the reviewer's points, particularly the clarity of the proteomic methods and analysis.  Please consider revising these sections and, in addition to the reviewer's suggestions, clearly describe the experimental details. For example, precisely how many replicates were processed? I understand that the data may not lend itself for quantitative (statistical) analyses, but an explanation of the scoring (Table 2S) would be helpful to many readers. Consider footnotes to the supplemental table. In addition to the reviewer, please also consider these minor suggestions: Line 54. Replace with ref #17 Line 150. This is confusing.  What "rap mutants"? Line 168. "fumigate"? Line 227. Consider colored highlighting of AGR57_3808 in table S2. Line 334. Consider "more closely related to" Line 354. Consider "S. pombe relative to S. cerevisiae" We would appreciate receiving your revised manuscript by Jan 10 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Also, please note the journal's requirement regarding blot/gel data: PLOS ONE now requires that submissions reporting blots or gels include original, uncropped blot/gel image data as a supplement or in a public repository. This is in addition to complying with our image preparation guidelines described at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements. These requirements apply both to the main figures and to cropped blot/gel images included in Supporting Information. If the manuscript is positively reviewed, we will ask the authors to provide any missing raw image data for blot/gel results when they submit their first revision. As part of your review, please ensure that figures reporting blot or gel images comply with the journal's image preparation guidelines and that the original data are provided following the journal's request.  If you have any questions or concerns about blot/gel figures or data for this submission, please email us at plosone@plos.org before issuing a decision letter. We look forward to receiving your revised manuscript. Kind regards, Daniel Cullen Academic Editor PLOS ONE Journal Requirements: 1. When submitting your revision, we need you to address these additional requirements. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: No ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In this manuscript the authors investigate the conservation of the TOR signaling network in the white-rot fungus Phanerochaete chrysosporium. They observe that rapamycin blocks conidia germination and hyphal growth. They also provide preliminary data to suggest that the composition of proteins secreted by this organism is altered by carbon source and rapamycin. Main concern: The proteomics experiments are not well described. How quantitative are these results? What is the FDR rate? Said another way, how can one be sure that proteins observed in one condition are really only present in that condition? This point needs to be readdressed prior to acceptance. Specific comments i) line 183: Is the exponential phase really 30.9 hours? There seems to be a shift at about 25hrs. How is exponential phase defined? ii) Paragraph starting on line 211: Until line 217, I do not see how the specific numbers cited correspond to the Venn diagram in Figure 2E. Shouldn’t a main point here be that 16 proteins are secreted only in the presence of rapamycin and/or 17 are secreted only in the absence of rapamycin? iii) Why does Table S2 list sucrose as the carbon source? iv) Line 221 ACR57 should be AGR57 v) Paragraph starting on line 284 – a more current review of TORC2 functions can be found here: https://doi.org/10.3390/biom7030066 vi) Reference 16 is now outdated. Use this for ortholog searches https://www.cell.com/cell-metabolism/pdfExtended/S1550-4131(17)30422-9 From line 292 on the paragraph needs to be rewritten for comprehensibility. Note that Tco89 and Bit61 orthologs exist in S. pombe; Ego1 and Ego3 are conserved in metazoans but are difficult to detect in sequence searches. What about orthologs of SEACIT, SEACAT, Lst4/7? Tip41, Ypk1 and Ypk3? vii) Legend for figure 3 is not clearly written. Line 495 does not accurately describe figure which has structures from other organisms. Line 502 – where are W89 and F96 in the figure? Why are the red numbers in 3D so discordant with the red numbers in E and F? The species origins for each protein domain should be labelled directly in the figure. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 5 Jan 2020 Dear Pr Cullen, Dear Reviewers, You will find enclosed my revised version of our manuscript “Target Of Rapamycin pathway in the white-rot fungus Phanerochaete chrysosporium” PONE-D-19-29130. Your advices have been useful and i wish you will find this version improved compare to the previous one. Before reading the manuscript, let me answering in this letter to the different points that you raised: “….We were able to secure only one review. Accordingly, the decision is based on that reviewer's comments and my own reading of the manuscript. I generally concur with the reviewer's points, particularly the clarity of the proteomic methods and analysis. Please consider revising these sections and, in addition to the reviewer's suggestions, clearly describe the experimental details. For example, precisely how many replicates were processed? I understand that the data may not lend itself for quantitative (statistical) analyses, but an explanation of the scoring (Table 2S) would be helpful to many readers. Consider footnotes to the supplemental table.” Description of the experimental procedure has been modified to explain that 6 biological repeats have been used to prepare the samples, this information is repeated in the result part. Footnotes explaining scoring have been added at the end of the supplemental table2. Explanation of the significance has been added at the end of mat & meth (those sentences have been written under the supervision of Dr JB Vincourt which is the service provider and thanks in Acknowledgements section). “In addition to the reviewer, please also consider these minor suggestions: Line 54. Replace with ref #17” Done “Line 150. This is confusing. What "rap mutants"?” That is obviously a copy/ paste error and a default in our reviewing process. There is no rap mutant in this manuscript. “Line 168. "fumigate"?” fumigatus, changed has been done. “Line 227. Consider colored highlighting of AGR57_3808 in table S2.” Done “Line 334. Consider "more closely related to"” Done “Line 354. Consider "S. pombe relative to S. cerevisiae"” Done “5. Review Comments to the Author Main concern: The proteomics experiments are not well described. How quantitative are these results? What is the FDR rate? Said another way, how can one be sure that proteins observed in one condition are really only present in that condition? This point needs to be readdressed prior to acceptance.” To answer to your questions several modifications have been done: Description of the experimental procedure has been modified. Number of biological repeat has been added, significance of the scoring has been describe as follow: “The minimal mascot score for peptides was set to 20 and that for proteins was set to 80. Results were cross-validated by interrogating an irrelevant database using the same criteria. Proteins were considered found in a given sample only if identified with a score above 80. When confronted to the random decoy strategy, this score resulted in a false discovery rate < 1%. The other way around, proteins were considered missing only if they were not identified at all. We could not calculate the effective lack of discovery rate in this specific experiment, but in other, technically similar contexts, such proteins exhibited levels at least 20-fold lower than those identified with a score of 80, with less than 2% errors.” Information has been added in result part and footnotes have been added at the end of the supplemental data. “Specific comments i) line 183: Is the exponential phase really 30.9 hours? There seems to be a shift at about 25hrs. How is exponential phase defined?” We determine the beginning of the stationary phase when no more growth is observed, that point also determine the end of the exponential phase. “ii) Paragraph starting on line 211: Until line 217, I do not see how the specific numbers cited correspond to the Venn diagram in Figure 2E. Shouldn’t a main point here be that 16 proteins are secreted only in the presence of rapamycin and/or 17 are secreted only in the absence of rapamycin?” This paragraph has been rewritten. “iii) Why does Table S2 list sucrose as the carbon source?” Corrected, it was glucose and not sucrose. “iv) Line 221 ACR57 should be AGR57” Done “v) Paragraph starting on line 284 – a more current review of TORC2 functions can be found here: https://doi.org/10.3390/biom7030066 vi) Reference 16 is now outdated. Use this for ortholog searches https://www.cell.com/cell-metabolism/pdfExtended/S1550-4131(17)30422-9 From line 292 on the paragraph needs to be rewritten for comprehensibility. Note that Tco89 and Bit61 orthologs exist in S. pombe; Ego1 and Ego3 are conserved in metazoans but are difficult to detect in sequence searches. What about orthologs of SEACIT, SEACAT, Lst4/7? Tip41, Ypk1 and Ypk3?” Points (v) and (vi) lead us to modify tables 1,2 and 3 which have been enlarged. Corresponding paragraphs have been rewritten in accordance to those new results. “vii) Legend for figure 3 is not clearly written. Line 495 does not accurately describe figure which has structures from other organisms. Line 502 – where are W89 and F96 in the figure? Why are the red numbers in 3D so discordant with the red numbers in E and F? The species origins for each protein domain should be labelled directly in the figure.” Legend has been rewritten in accordance to reviewer comments. Figure 3 has been modified according to the comments. W89 and F96 were W93 and F100 according to Fig. 3A, this has been corrected. Numbers in 3D were given according to HsTOR sequence and in 3E according to PcFRB sequence. Numbers have been changed and homogenized with Fig. 3A. This is indicated in the legend. I wish you will agree with the revisions we have done, Best regards, Rodnay Sormani Submitted filename: Response_to_reviewers.docx Click here for additional data file. 29 Jan 2020 Target Of Rapamycin pathway in the white-rot fungus Phanerochaete chrysosporium PONE-D-19-29130R1 Dear Dr. sormani, We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication. Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. With kind regards, Daniel Cullen Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 10 Feb 2020 PONE-D-19-29130R1 Target Of Rapamycin pathway in the white-rot fungus Phanerochaete chrysosporium Dear Dr. Sormani: I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. For any other questions or concerns, please email plosone@plos.org. Thank you for submitting your work to PLOS ONE. With kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Daniel Cullen Academic Editor PLOS ONE
  33 in total

1.  The Paleozoic origin of enzymatic lignin decomposition reconstructed from 31 fungal genomes.

Authors:  Dimitrios Floudas; Manfred Binder; Robert Riley; Kerrie Barry; Robert A Blanchette; Bernard Henrissat; Angel T Martínez; Robert Otillar; Joseph W Spatafora; Jagjit S Yadav; Andrea Aerts; Isabelle Benoit; Alex Boyd; Alexis Carlson; Alex Copeland; Pedro M Coutinho; Ronald P de Vries; Patricia Ferreira; Keisha Findley; Brian Foster; Jill Gaskell; Dylan Glotzer; Paweł Górecki; Joseph Heitman; Cedar Hesse; Chiaki Hori; Kiyohiko Igarashi; Joel A Jurgens; Nathan Kallen; Phil Kersten; Annegret Kohler; Ursula Kües; T K Arun Kumar; Alan Kuo; Kurt LaButti; Luis F Larrondo; Erika Lindquist; Albee Ling; Vincent Lombard; Susan Lucas; Taina Lundell; Rachael Martin; David J McLaughlin; Ingo Morgenstern; Emanuelle Morin; Claude Murat; Laszlo G Nagy; Matt Nolan; Robin A Ohm; Aleksandrina Patyshakuliyeva; Antonis Rokas; Francisco J Ruiz-Dueñas; Grzegorz Sabat; Asaf Salamov; Masahiro Samejima; Jeremy Schmutz; Jason C Slot; Franz St John; Jan Stenlid; Hui Sun; Sheng Sun; Khajamohiddin Syed; Adrian Tsang; Ad Wiebenga; Darcy Young; Antonio Pisabarro; Daniel C Eastwood; Francis Martin; Dan Cullen; Igor V Grigoriev; David S Hibbett
Journal:  Science       Date:  2012-06-29       Impact factor: 47.728

2.  Conservation, duplication, and loss of the Tor signaling pathway in the fungal kingdom.

Authors:  Cecelia A Shertz; Robert J Bastidas; Wenjun Li; Joseph Heitman; Maria E Cardenas
Journal:  BMC Genomics       Date:  2010-09-23       Impact factor: 3.969

3.  The TOR signaling pathway regulates vegetative development and virulence in Fusarium graminearum.

Authors:  Fangwei Yu; Qin Gu; Yingzi Yun; Yanni Yin; Jin-Rong Xu; Won-Bo Shim; Zhonghua Ma
Journal:  New Phytol       Date:  2014-03-28       Impact factor: 10.151

4.  The plant cell wall-decomposing machinery underlies the functional diversity of forest fungi.

Authors:  Daniel C Eastwood; Dimitrios Floudas; Manfred Binder; Andrzej Majcherczyk; Patrick Schneider; Andrea Aerts; Fred O Asiegbu; Scott E Baker; Kerrie Barry; Mika Bendiksby; Melanie Blumentritt; Pedro M Coutinho; Dan Cullen; Ronald P de Vries; Allen Gathman; Barry Goodell; Bernard Henrissat; Katarina Ihrmark; Hävard Kauserud; Annegret Kohler; Kurt LaButti; Alla Lapidus; José L Lavin; Yong-Hwan Lee; Erika Lindquist; Walt Lilly; Susan Lucas; Emmanuelle Morin; Claude Murat; José A Oguiza; Jongsun Park; Antonio G Pisabarro; Robert Riley; Anna Rosling; Asaf Salamov; Olaf Schmidt; Jeremy Schmutz; Inger Skrede; Jan Stenlid; Ad Wiebenga; Xinfeng Xie; Ursula Kües; David S Hibbett; Dirk Hoffmeister; Nils Högberg; Francis Martin; Igor V Grigoriev; Sarah C Watkinson
Journal:  Science       Date:  2011-07-14       Impact factor: 47.728

5.  Oak extractive-induced stress reveals the involvement of new enzymes in the early detoxification response of Phanerochaete chrysosporium.

Authors:  Antonio José Fernández-González; Nicolas Valette; Annegret Kohler; Stéphane Dumarçay; Rodnay Sormani; Eric Gelhaye; Mélanie Morel-Rouhier
Journal:  Environ Microbiol       Date:  2018-10-05       Impact factor: 5.491

Review 6.  Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes.

Authors:  Phil Kersten; Dan Cullen
Journal:  Fungal Genet Biol       Date:  2014-06-07       Impact factor: 3.495

7.  The GATA transcription factors GLN3 and GAT1 link TOR to salt stress in Saccharomyces cerevisiae.

Authors:  J L Crespo; K Daicho; T Ushimaru; M N Hall
Journal:  J Biol Chem       Date:  2001-07-16       Impact factor: 5.157

8.  Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast.

Authors:  J Heitman; N R Movva; M N Hall
Journal:  Science       Date:  1991-08-23       Impact factor: 47.728

9.  Role of the Botrytis cinerea FKBP12 ortholog in pathogenic development and in sulfur regulation.

Authors:  Heber Gamboa Meléndez; Geneviève Billon-Grand; Michel Fèvre; Géraldine Mey
Journal:  Fungal Genet Biol       Date:  2008-12-13       Impact factor: 3.495

Review 10.  Xenomic networks variability and adaptation traits in wood decaying fungi.

Authors:  Mélanie Morel; Edgar Meux; Yann Mathieu; Anne Thuillier; Kamel Chibani; Luc Harvengt; Jean-Pierre Jacquot; Eric Gelhaye
Journal:  Microb Biotechnol       Date:  2013-01-02       Impact factor: 5.813

View more
  1 in total

Review 1.  Interactions of FK506 and Rapamycin With FK506 Binding Protein 12 in Opportunistic Human Fungal Pathogens.

Authors:  Sandeep Vellanki; Alexis E Garcia; Soo Chan Lee
Journal:  Front Mol Biosci       Date:  2020-10-16
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.