Transcriptional analysis of wheat seedlings inoculated with Fusarium culmorum under continual exposure to disease defence inductors.

A facultative parasite of cereals, Fusarium culmorum is a soil-, air- and seed-borne fungus causing foot and root rot, fusarium seedling blight, and especially Fusarium head blight, a spike disease leading to decreased yield and mycotoxin contamination of grain. In the present study, we tested changes in expression of wheat genes (B2H2, ICS, PAL, and PR2) involved in defence against diseases. We first compared expression of the analysed genes in seedlings of non-inoculated and artificially inoculated wheat (variety Bohemia). The second part of the experiment compared expression of these genes in seedlings grown under various treatment conditions. These treatments were chosen to determine the effects of prochloraz, sodium bicarbonate, ergosterol, aescin and potassium iodide on expression of the analysed defence genes. In addition to the inoculated and non-inoculated cultivar Bohemia, we additionally examined two other varieties of wheat with contrasting resistance to Fusarium sp. infection. These were the blue aleurone layer variety Scorpion that is susceptible to Fusarium sp. infection and variety V2-49-17 with yellow endosperm and partial resistance to Fusarium sp. infection. In this manner, we were able to compare potential effects of inductors upon defence gene expression among three varieties with different susceptibility to infection but also between inoculated and non-inoculated seedlings of a single variety. The lowest infection levels were detected in the sodium bicarbonate treatment. Sodium bicarbonate had not only negative influence on Fusarium growth but also positively affected expression of plant defence genes. Expression of the four marker genes shown to be important in plant defence was significantly affected by the treatments. The greatest upregulation in comparison to the water control was identified under all treatments for the B2H2 gene. Only expression of PAL under the ergosterol and prochloraz treatments were not statistically significant.

Introduction

Fusarium culmorum is a ubiquitous soil-borne fungus with a highly competitive saprophytic capability. As a facultative parasite, it can cause foot and root rot [1]. Fusarium culmorum is also seed-borne and causes fusarium seedling blight when infected seed is used in sowing. Seedling blight can cause extensive damage to growing seedlings [2] that can lead to reduced plant establishment, number of heads per square meter, and also grain yield [3]. Fusarium head blight (FHB) is one of the most severe diseases responsible for decrease in grain yield and quality. Furthermore, presence of mycotoxins produced by this fungus (deoxynivalenol, nivalenol, zearalenone, and many others) can harm human and animal health. FHB in wheat is mainly caused by Fusarium graminearum, F. culmorum, and F. poae. Fusarium culmorum infection is dominant in colder regions, such as north, east, and central Europe [1]. The major reservoirs of Fusarium sp. inoculum are crop residues on the soil surface. The fungus can survive on a wide range of living plant species (wheat, corn, barley, soybean, and rice) (see Bai and Shaner for a review [4]).

There are several means to fight this disease: use of fungicides, cultural practices, resistant cultivars, and biological agents [5]. Although seed treatment is used to control soil-borne infection caused by Fusarium spp. [6], there is no definite way to defeat this complex of Fusarium diseases. Efficacy of fungicide treatments against FHB is only 15–30% [7]. Fully resistant cultivars are not available to date, but some cultivars have useable levels of partial resistance that limit yield loss and mycotoxins accumulation [8]. FHB resistance has a quantitative nature and identification of responsible genes is difficult. Even though numerous quantitative trait loci have been described to date (see Duba et al. for a review [9]), just a few such genes have been definitively identified, sequenced, and their causal mutations determined. Kage et al. [10] identified an FHB resistance gene on chromosome 2DL as the TaACT gene encoding agmatine coumaroyl transferase. They suggest that several single nucleotide polymorphisms (SNPs) and two inversions may be important for gene function. The second identified gene, Fhb1, confers resistance in variety Sumai 3. It is pore-forming toxin-like (PFT) gene [11]. Further, a number of pathogenicity and virulence factors have been characterized [11, 12, 13].

The expression of defence-related genes also can be important in the plant’s reaction against pathogens. PR-1, PR-2 (glucanases), PR-3 (chitinase), PR-4 (thaumatin-like proteins), PR-5, and peroxidase have been shown to be induced in both resistant and susceptible cultivars after point inoculation [14]. These proteins were detected as early as 6 to 12 h after inoculation and peaked after 36 to 48 h. Earlier and greater expression of PR-4 and PR-5 transcripts were observed, however, in resistant cultivar Sumai 3 than in susceptible cultivar Wheaton [14]. Larger amounts of β-1,3-glucanase and chitinase enzymes also have been detected in resistant cultivar Sumai [15]. The overexpression of defence response genes in wheat could enhance FHB resistance in both greenhouse and field conditions.

A large number of organic and inorganic compounds have previously been described as affecting plant defence mechanisms [16, 17]. For example, such plant or fungal-derived compounds as monoterpenes or ergosterol can induce plant defence [18, 19].

Our study is focused upon comparing expression of different genes in non-inoculated and inoculated varieties and under various treatment conditions. The first part of the experiment compares expression of the genes β-1,3-glucanase (PR2), chitinase (B2H2), phenylalanine ammonia-lyase (PAL), and isochorismate synthase (ICS) (the last two being genes from the salicylate pathway) in healthy seedlings versus seedlings of Triticum aestivum var. Bohemia artificially inoculated with F. culmorum. The second part of the experiment focused on how expression of these genes is influenced by different treatment solutions (based upon prochloraz, aescin, ergosterol, sodium bicarbonate and potassium iodide) within which seedlings were grown. Prochloraz, potassium iodide and sodium bicarbonate were chosen for their antifungal effects in preliminary in vitro experiments (S1 Fig) and aescin and ergosterol because of their expected effect on plant triggered immunity. How these treatments influence expression of the aforementioned genes is compared with a water control in inoculated and healthy seedlings of Bohemia as well as in the moderately Fusarium-resistant yellow endosperm variety V2-49-17 and the susceptible blue aleurone layer variety Scorpion. The originality of this research consists in using artificially infected seeds during anthesis of mother plants and continuous exposure of seedlings to potential inductors.

Materials and methods

Plant material

Inoculated and non-inoculated (healthy) groups of wheat seeds (var. Bohemia) were used for the first part of the experiment. Inoculated and healthy seeds were acquired from plants grown under field conditions during the 2017 season. Inoculated seeds were collected from plants that had been sprayed during mid-anthesis phase by F. culmorum (tribe KM16902) macroconidia at concentration 5 × 105 conidia ml−1. A previous study had shown a high level of virulence and strong production of deoxynivalenol (DON) by this tribe [20]. The seeds from inoculated and healthy variants were collected and stored at room temperature and low humidity. The plant material further consisted of two bread wheat cultivars differing in grain colour and in susceptibility to F. culmorum infection (V2-49-17 –yellow kernels, medium resistant to infection; Scorpion–blue aleurone layer, highly susceptible to infection).

Growth chamber test under controlled conditions

Growth chamber test of 50 kernels of all three cultivars (Bohemia–inoculated and healthy; Scorpion, and V2-49-17) were laid with 1 cm separation distance into two layers of filtrate paper and rolled up. The rolls were immersed into the treatment solutions. Four replications (200 kernels in total) were made for each combination of cultivar and treatment solution. The treatment solutions consisted of 25 μg ml−1 solution of ergosterol, 25 μg ml−1 solution of aescin, 1 μg ml−1 solution of prochloraz, 1% solution of potassium iodide and 0.1 M solution of sodium bicarbonate. The sodium bicarbonate solution was boiled at 120°C for half an hour. During boiling, the sodium bicarbonate gradually decomposed to sodium carbonate, water and carbon dioxide. This reaction led to alkalization of pH. Distilled water was used as a control solution.

Seedlings were cultivated under controlled conditions (20°C/18°C, 12/12 h of light/dark) until the two-leaves growth stage. At this stage, the whole leaves were collected from three plants representing three biological replicates. The leaves showed no signs of F. culmorum infection. Symptoms of F. culmorum infection were visible only on the lower parts of plants and around the seeds (Fig 1). The leaves were immediately frozen in liquid nitrogen and preserved at −80°C until RNA isolation. The numbers of infected seeds and seeds with no sign of infection were counted and the results were statistically analysed by ANOVA (Statistica 12 software).

Fig 1

Inoculated and non-inoculated seedlings of cv. Bohemia under different treatment conditions.

(A) non-inoculated seedlings in water, (B) inoculated seedlings in water, (C) inoculated seedlings in prochloraz, (D) inoculated seedlings in potassium iodide, (E) inoculated seedlings in sodium bicarbonate. Pink–white coloration around kernels and dark discoloration of coleoptiles and stem bases are symptoms of F. culmorum infection.

RNA isolation and qPCR

Leaves were homogenized in a TissueLyser II (Qiagen) for 2 minutes at 27 Hz. Caution was taken during homogenization to avoid sample melting. The homogenized samples were immediately placed into liquid nitrogen. The RNA was isolated using the RNeasy Plant Mini Kit (Qiagen) while following the manufacturer’s instructions. DNA was removed during the RNA purification using the RNase-Free DNase Set (Qiagen). The isolated RNA was stored at −80°C. cDNA was synthesized using the Transcriptior High Fidelity cDNA Synthesis Kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions with 1 μg of total RNA and anchored-oligo (dT) primers. The concentration of cDNA was measured with Qubit (Thermo Fisher Scientific) and cDNA was diluted to concentration 10 ng μl−1. The expression analysis of the chosen plant defence genes (chitinase (B2H2), β-1,3-glucanase (PR2), isochorismate synthase (ICS), and phenylalanine ammonia-lyase (PAL)) was performed using the CFX96TM Real-Time PCR Detection System (Bio-Rad). The qPCR mix consisted of 1× SYBR Green (Top Bio), 0.2 μM forward and reverse primers (Table 1), 15 ng cDNA, and water to final volume 15 μl. The reference gene was glyceraldehyde-3-phosphate dehydrogenase (GAPDH) according to Travella et al. (2006) [21] and Sun et al. (2014) [22]. The control sample consisted of equal amounts of cDNA from all three replicates of healthy, untreated Bohemia seedlings diluted to 10 ng μl−1. The primers specificity and presence of primer dimers were verified by melting analysis. The data were analysed using the 2–ΔΔCq method with CFX Manager 3.0 software (Bio-Rad, USA). Three biological as well as three technical replicates were run.

Table 1

Primer pairs used in the study.

Names, sequences of forward and reverse primers, publication sources of primer pairs, and gene functions are listed.

Gene name	Forward primer	Reverse primer	Publication	Function
B2H2	TCTATCGAAACGCCATTGTTACA	AGAGGCCGTTCGCATAGTCA	[42]	chitinase
PR2	CCGCACAAGACACCTCAAGATA	CGATGCCCTTGGTTTGGTAGA	[43]	β-1,3-glucanase
PAL	TTGATGAAGCCGAAGCAGGACC	ATGGGGGTGCCTTGGAAGTTGC	[44]	salicylate pathway
ICS	AGAAATGAGGACGACGAGTTTGAC	CCAAGTAGTGCTGATCTAATCCCAA	[44]	salicylate pathway
GAPDH	TTAGACTTGCGAAGCCAGCA	AAATGCCCTTGAGGTTTCCC	[22]	reference gene

Results

Determination of Fusarium infection level in growth chamber test

Inoculated and healthy seeds of wheat cv. Bohemia were treated with different solutions: water, prochloraz, aescin, ergosterol, sodium bicarbonate and potassium iodide. Inoculated seeds contained high levels of F. culmorum DNA (analysed by qPCR, S1 File), the mean of three replications being 5,048 μg kg−1 of DON (analysed by ELISA, S1 File). No F. culmorum DNA was detected in the non-inoculated seeds, and their DON content (if any) was under the detection limit. The plants were visually inspected at the two-leaves stage for presence of Fusarium infection. The number of infected seeds under every treatment was compared to that for the control (treated only with water). The presence of Fusarium infection was detectable by pink–white mycelia growing around kernels and dark discoloration of the coleoptile and stem (Fig 1).

In the variant without inoculation there were no infected seeds. On the contrary, the inoculated seeds that had been submerged in water showed high level of infection (Fig 1). This level of infection was decreased under every treatment except for that of potassium iodide. The level of infection in the potassium iodide treatment group was even increased in comparison to the water-treated inoculated seeds. In evaluating the 200 seeds from each combination, significant differences were detected between individual groups. The results suggest that the lowest level of infection in inoculated seeds was detected in the sodium bicarbonate treatment, followed (in order from lowest to highest) by prochloraz, ergosterol, aescin, water, and potassium iodide (Fig 2). Thus, the treatment with 0.1M sodium bicarbonate was more potent in suppressing fungal growth than was the treatment with 1 μg ml−1 prochloraz.

Fig 2

Percentage of F. culmorum-infected plants in different treatments with cultivar Bohemia.

Two hundred inoculated seeds were evaluated for each treatment solution (water [control], ergosterol, aescin, sodium bicarbonate, prochloraz and potassium iodide). Error bars indicate 95% confidence intervals around the mean.

Expression levels of four genes involved in plant–pathogen interaction in wheat seedlings

The expression of four important plant defence genes (B2H2, ICS, PAL, and PR2) against Fusarium infection was detected. These genes were analysed in three technical and biological replications of each studied variety under each treatment. The fold differences (FDs) in their expression levels were first compared among the reference (water control) and other experimental conditions (ergosterol, aescin, sodium bicarbonate, prochloraz, and potassium iodide) of all studied varieties (Table 2). In this manner, the efficiency of different treatments in enhancing expression of plant defence genes with and without pathogen infection was examined. The treatments did not influence expression of the genes in an even manner, as expression was stronger in some genes and weaker in others. Only insignificant changes were detected in inoculated Bohemia under the ergosterol treatment (ICS, PAL) as well as in Scorpion under the aescin treatment (PAL).

Table 2

Expression levels of four chosen genes in leaves of healthy and inoculated plants of wheat variety Bohemia and healthy V2-49-17 and Scorpion varieties.

The expression of four genes (B2H2, ICS, PAL, and PR2) were detected in healthy and inoculated Bohemia, V2-49-17 variety with yellow endosperm, and cv. Scorpion with blue aleurone layer in different treatment conditions (ergosterol, aescin, sodium bicarbonate, prochloraz and potassium iodide) and indicated as a fold difference (FD) to control (treatment water).

Variant	Gene	Ergosterol		Aescin		Sodium bicarbonate		Prochloraz		Potassium iodide
Healthy Bohemia	B2H2	-0,99	***	10,16	****	838,05	****	72,96	****	7370,13	****
	ICS	-0,76	***	3,76	****	2,71	***	4,53	****	-0,39	***
	PAL	-0,83	**	0,94	**	5,99	****	5,06	****	4,98	****
	PR2	-0,84	**	3,97	****	1,07	**	0,42	**	20,75	****
Inoculated Bohemia	B2H2	2,29	**	2,80	**	0,95	**	5,20	****	7,45	****
	ICS	-0,27		1,33	***	0,41	**	-0,85	***	-0,57	**
	PAL	2,10	**	1,98	**	4,99	****	7,12	****	3,86	****
	PR2	1,30	***	3,11	****	1,96	***	1,31	***	30,80	****
V2-49-17 variety with yellow endosperm	B2H2	42,73	****	46,67	****	1060,53	****	2040,09	****	1362,64	****
	ICS	1,21	****	8,27	****	6,26	****	12,29	****	-0,33	***
	PAL	8,57	***	4,39	***	57,79	****	82,05	****	-1,00	*
	PR2	23,42	****	58,49	****	25,16	****	20,09	****	48,52	****
Scorpion with blue aleurone layer	B2H2	-0,98	****	-0,98	****	122,92	****	-0,42	***	44,48	****
	ICS	1,22	****	-0,69	***	-0,87	***	1,59	****	-0,09	*
	PAL	5,85	***	-0,02		14,02	****	43,83	****	-1,00	***
	PR2	4,08	****	2,73	****	20,16	****	21,71	****	49,85	****

Significant fold differences between water control and experimental treatments are indicated by asterisks (P < 0.05 (*); P < 0.01 (**); P < 0.001 (***); P < 0.0001 (****). The statistical analyses were carried out separately within each gene and treatment.

B2H2 expression was upregulated by almost all treatments in all studied varieties (Table 2). The highest expression level of this gene was achieved under the sodium bicarbonate (V2-49-17) treatment followed by the prochloraz (V2-49-17) and potassium iodide (healthy Bohemia) treatments. It was downregulated just under the ergosterol (healthy Bohemia and Scorpion), aescin (Scorpion), and prochloraz (Scorpion) treatments. This gene achieved the largest FD (up to 7,370; potassium iodide) in comparison to the other genes. The FD was lowest in inoculated Bohemia. The FD of B2H2 was in some cases near to 1,000 in comparison to the water control. This high FD was not achieved solely in the inoculated Bohemia and the Scorpion variety. In inoculated Bohemia, for example, the FD ranged from 0.95 under the sodium to 7.45 under the iodide treatment. In healthy Bohemia, the expression ranged from −0.99 to 7,370 FD in comparison to the water control. A similarly large increase of expression in comparison to the water control as in healthy Bohemia was identified also in V2-49-17. The V2-49-17 variety showed significant increase of B2H2 expression in comparison to healthy Bohemia while the expression of all other genes was lower.

The ICS gene manifested the smallest fold increase under almost all analysed treatments. Its expression was often downregulated under some experimental treatments in some analysed varieties (Table 2). The largest fold difference was detected in the V2-49-17 variety under the prochloraz treatment, the smallest in inoculated Bohemia under the prochloraz treatment. Under the iodide treatment, all FDs were in negative values for all analysed varieties.

FDs for PAL expression were increased under almost every treatment. These increases were not to such large extent as seen for B2H2. The largest FDs were achieved under prochloraz (82.05 FD) and sodium bicarbonate (57.79 FD) treatments in the V2-49-17 variety. Downregulation of PAL expression in comparison to the water control was identified under the ergosterol treatment in healthy Bohemia, under potassium iodide treatment in V2-49-17, and under potassium iodide and aescin treatments in the Scorpion variety (Table 2). The lowest FD was detected under iodide in the yellow variety.

The FDs for PR2 expression in comparison to the water control were elevated under almost all treatments and in all analysed varieties except for the ergosterol treatment in healthy Bohemia. The largest FD was seen in the V2-49-17 variety under all treatments except for prochloraz and iodide, in which cases the FDs were greater in the Scorpion variety. The largest FD for PR2 was observed under the iodide treatment (from 20.75 to 49.85 FD). The lowest FD in almost all cases was found in healthy Bohemia (Table 2).

We further compared the expression of all four genes between the inoculated and healthy Bohemia under all treatments. The strongest B2H2 expression in inoculated Bohemia was identified under potassium iodide treatment and the weakest under the control. The strongest B2H2 expression in healthy Bohemia was identified under potassium iodide treatment followed by that for sodium bicarbonate (Fig 3). The expression of B2H2 was increased in inoculated Bohemia under all treatments.

Fig 3

Expression profiles of B2H2, ICS, PAL, and PR2 in leaves of inoculated and healthy plants of wheat variety Bohemia under different treatment conditions (A, B, C, D).

Expression levels were relative to healthy cv. Bohemia seeds and were normalized with the wheat reference gene GAPDH. Expression levels shown are mean values and standard deviation for three replications. Statistically significant differences between healthy and inoculated cv. Bohemia plants are indicated by asterisks above every treatment (P < 0.05 (*); P < 0.01 (**); P < 0.001 (***); P < 0.0001 (****).

Expression of ICS was significantly downregulated in inoculated Bohemia under almost all treatments, the exception being the ergosterol treatment, in which case the difference was not statistically significant (Fig 3). The strongest ICS expression was detected under the prochloraz treatment in healthy Bohemia. The weakest was under the iodide and ergosterol treatments.

Comparison of healthy versus inoculated Bohemia showed increase of PAL expression in inoculated Bohemia under all treatments. The strongest expression of PAL in healthy Bohemia was identified under the sodium bicarbonate treatment. The greatest expression in inoculated Bohemia was identified under the prochloraz and sodium bicarbonate treatments (Fig 3).

PR2 expression was elevated in all treatments other than the aescin treatment in inoculated Bohemia. The difference between healthy and inoculated Bohemia under the aescin treatment was not statistically significant. The expression of PR2 in inoculated Bohemia was elevated under the iodide (in comparison to healthy Bohemia), and ergosterol treatments with high significance. Small increases were detected under the water and sodium bicarbonate treatments (Fig 3).

Discussion

In current study was tested the expression of chosen marker genes of wheat seedlings after various treatments by potential plant defence inductors. The effect of plant defence inductors was previously widely studied [18, 19] and their effect on defence genes expression was taken to the account. Effect of chitinase genes in increasing plant resistance to fungal diseases has been observed in previous studies (see Fahmy et al. for a review [23]). Transgenic wheat with barley chitinase II was shown to be resistant against powdery mildew, leaf rust pathogens, and F. graminearum [24, 25, 26]. Chitinase from wheat, barley, and maize kernels has been shown to inhibit hyphal elongation of the fungi [27]. In the present study, expression of the chitinase gene in the V2-49-17 variety was greater than was its expression in healthy Bohemia under the control variant (water) as well as under the experimental treatments. This higher value of chitinase expression can be connected to partial resistance of the yellow variety to Fusarium sp. infection. Higher chitinase levels in resistant cultivars already have been detected in previous studies [28, 29]. The largest fold increase for B2H2 expression in healthy Bohemia was detected under the potassium iodide treatment. This 7,000 FD could be explained by the negative effect of this treatment on seedlings growth. This retardation of growth was connected to increase of F. culmorum infection in potassium iodide-treated varieties regardless of variety or presence of Fusarium infection. However, more than 1,000 FD [1,363] in comparison to the water control was detected just in V2-49-17. The growth retardation of seedlings under iodide treatment in our experiment is substantiated by the previous study of Brenchley [30], who reported a negative effect of high concentration of potassium iodide on germination of barley seeds and even of low concentration on the survival of barley seedlings. Iodine at concentration 10 ppm was observed to be toxic to barley. Nevertheless, a concentration 0.5–1 ppm had a positive effect on barley plants [31]. The iodine is most toxic in its iodide form [32]. This is the form we used in our experiments at 10,000 ppm concentration. Used concentration inhibited F. culmorum growth in preliminary in vitro test (S1 Fig). The observed toxicity of potassium iodide for wheat seedlings is thus understandable and such a high concentration suppress natural plant immunity, thus allowing us to see the effect of immunity on the intensity of the pathogen development (Fig 1). The strong expression of B2H2 is just a result of this treatment and does not reflect an effect of potassium iodide’s increasing resistance in the plant. This inhibitory effect was more potent than the effects of sodium bicarbonate and prochloraz. Significant increase of B2H2 expression could be seen also in the sodium bicarbonate treatment. This increase exceeded those under the prochloraz treatments. It can be seen across all analysed varieties with the exception of the inoculated Bohemia. Our results imply that sodium bicarbonate is significantly effective in enhancing expression of defence genes. Contrary to potassium iodide, sodium bicarbonate has no negative effect on wheat seedlings’ growth. Comparison of all treatments in inoculated wheat showed that the lowest numbers of seedlings with detectable Fusarium infection at the three-leaves stage were under the prochloraz and sodium bicarbonate treatments. This suggests that sodium bicarbonate has potential for increasing plant resistance. The addition of sodium bicarbonate to experimental treatments was conditioned by its alkaline pH. This was in accordance with studies showing inhibition of TRI genes expression in Fusarium by alkaline pH [33, 34, 35]. TRI genes expression is important for synthesis of DON, which is known to be a virulent factor aiding in the establishment and propagation of Fusarium infection within the spikes [36, 37]. In preliminary experiments, the sodium bicarbonate showed potential for inhibiting Fusarium growth in vitro (S1 Fig). Indeed, the sodium bicarbonate showed great potential also in planta (Fig 1). Sodium bicarbonate had not only a negative influence on Fusarium growth but also a positive effect on expression of plant defence genes. The sodium bicarbonate has been shown to be potent in inhibiting growth also of other Fusarium species [38, 39].

We analysed the SA pathway’s function in plant defence by examining expression of the two genes ICS and PAL, both of whose biosynthetic pathways are known to be involved in SA production within Arabidopsis [40]. Hao et al. [40] had previously detected that suppression of the ICS gene compromised plant resistance to F. graminearum but that similar suppression of PAL genes had no significant effect. Those authors also found that F. graminearum-inoculated plants with stronger expression of ICS were comparable to wild-type control plants [40] and that plants with ICS suppressed did not accumulate SA during pathogen infection and were more susceptible to Fusarium. In the present study, the suppression of growth and higher rate of Fusarium infection connected to lower ICS expression were detectable predominantly under the potassium iodide treatment, where ICS had negative FD in comparison to the water treatment in every analysed variety. Similarly, ICS was downregulated under all treatments in the inoculated wheat cv. Bohemia. On the other hand, ICS expression was upregulated in all other treatments except for a few exceptions in Scorpion and inoculated Bohemia. It was upregulated in V2-49-17 under all treatments other than that of potassium iodide, which can be connected to this variety’s partial Fusarium resistance. Upregulation of ICS in inoculated Bohemia in comparison to the water control was detected only under sodium bicarbonate and aescin treatments, which can indicate effects of these treatments on expression of defence genes. Hao et al. [40] have suggested that ICS plays a unique role in SA biosynthesis in barley, which, in turn, confers a basal resistance to F. graminearum by modulating the accumulation of H2O2, O2, and reactive oxygen-associated enzymatic activities. In the present study, the greatest increase in PAL expression was detected in the V2-49-17 and Scorpion varieties. We found no correlation between higher PAL expression and the level of resistance to F. culmorum, because V2-49-17 is partially resistant but Scorpion is susceptible. In healthy versus inoculated Bohemia, PAL expression was generally increased under most treatments and especially under the potassium iodide treatments. Wildermuth et al. had detected increased PAL and decreased ICS expression after F. graminearum infection [41]. They also found a difference in timing whereby earlier increase of PAL expression was detected in a partially resistant variety (Wangshuibai). They found no difference, however, between resistant and susceptible varieties in the timing of decrease in ICS expression.

Conclusion

We conclude that prochloraz and sodium bicarbonate has the greatest potential for suppression of fungal development without having a negative effect on plant growth. According to our findings, the sodium bicarbonate had not only a negative influence on Fusarium growth but also a positive effect on upregulating the expression of plant defence genes.

Confirmation of F. culmorum presence in inoculated seeds.

(DOCX)

Click here for additional data file.

Inhibitory effect of different treatments against F. culmorum growth on PDA (potato dextrose agar) on dark under 16°C for 5 days (Petri dishes diameter 90 mm).

HCl pH4 –PDA balanced to pH4 by HCl, NaOH pH10 –PDA balanced to pH10 by NaOH, IODIDE–PDA with potassium iodide (1% concentration), SODIUM–PDA with sodium bicarbonate (0.1 M), ACETATE–PDA with ammonium acetate (0.1 M), SDHI–PDA with fluxapyroxad (1 μg ml−1), QoI–PDA with picoxystrobin (1 μg ml−1), DMI–PDA with prochloraz (1 μg ml−1).

(EPS)

Click here for additional data file.

4 Nov 2019

PONE-D-19-28330

Transcriptional analysis of wheat seedlings inoculated with Fusarium culmorum under continual exposure to disease defence inductors

PLOS ONE

Dear Dr. Matusinsky,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Dec 19 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Binod Bihari Sahu, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

3. Thank you for stating the following in the Competing Interests section:

'The authors have declared that no competing interests exist.'

We note that one or more of the authors are employed by a commercial company:  Agrotest Fyto, Ltd.

Please provide an amended Funding Statement declaring this commercial affiliation, as well as a statement regarding the Role of Funders in your study. If the funding organization did not play a role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript and only provided financial support in the form of authors' salaries and/or research materials, please review your statements relating to the author contributions, and ensure you have specifically and accurately indicated the role(s) that these authors had in your study. You can update author roles in the Author Contributions section of the online submission form.

Please also include the following statement within your amended Funding Statement.

“The funder provided support in the form of salaries for authors [insert relevant initials], but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the ‘author contributions’ section.”

If your commercial affiliation did play a role in your study, please state and explain this role within your updated Funding Statement.

2. Please also provide an updated Competing Interests Statement declaring this commercial affiliation along with any other relevant declarations relating to employment, consultancy, patents, products in development, or marketed products, etc.

Within your Competing Interests Statement, please confirm that this commercial affiliation does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: "This does not alter our adherence to  PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests) . If this adherence statement is not accurate and  there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

Please include both an updated Funding Statement and Competing Interests Statement in your cover letter. We will change the online submission form on your behalf.

Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests

Additional Editor Comments (if provided):

Please comply the concerns raised by the reviewer before it is ready for publication.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This is an interesting paper that shows the effect on Fusarium inoculation in susceptible and resistant wheat of several different treatments in an attempt to identify potential treatments that can inhibit Fusarium inoculation and DON production during wheat production. I di have several concerns about the manuscript that are discussed below.

There is little to no indication why the authors choose the specific treatments of prochloraz, sodium bicarbonate, ergosterol, aescin and potassium iodide for this research. The authors need to provide an explanation of why these specific treatments were chosen.

The heat map of expression levels in Figure 3 is frankly quite confusing. How are shades of light to dark chosen; Is there an expression range for each shade of grey to black? How do you distinguish between up and down regulation relative to the treatment? Both the figure explanation and perhaps the figure itself needs some modification to make the heat map data/results clearer to the reader.

I think the realtime QPCR and ELIZA results should be included as supplementary data.

In the results and discussion sections, it is clear that the 10,000 ppm iodide treatment had a deleterious effect on germination and seedling growth. The literature cited (31-33) document this growth inhibition. Consequently, it is not clear why the 10,000 ppm concentration was chosen. Is this the only concentration that inhibits Fusarium growth? I am not sure of the value of having potassium-iodine included as a treatment in this paper unless it is actively thought of as a potential treatment to wheat to inhibit Fusarium growth and DON production during wheat production.

The authors, in the conclusion, state that sodium bicarbonate is a possible treatment of wheat to reduce infection and growth of Fusarium. I agree with this conclusion. However, I see that prochloraz shows results very similar to sodium bicarbonate yet it is not identified as a possible treatment. I do not understand why both of these treatments are not indicated as such in the conclusion unless prochloraz has a deleterious effect on plant growth. If this is the case there is no data presented that suggests that.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

29 Nov 2019

Dear Editor and Reviewers

Thank you for your comments and for reviewing our article. Please find below our reaction to all recommendations.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id =wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

We checked PlosOne style requirements according to style formats. We made these changes:

We formatted title and subtitle. We removed ZIP and Postal Codes and street addresses from affiliations. We included departments (Department of plant breeding and genetics and Department of plant pathology) in affiliation of Agrotest. We improved email address format of corresponding author. We set the double-spacing format in whole manuscript. We used Level 1 and 2 heading for sections and subsections. We changed citation of references to square brackets. We removed funding from Acknowledgments. We included “doi” codes to the list of references.

2. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

We included data in Supporting Information files (S1 Supporting Information and S1 Figure) where necessary we removed the mentioned phrases.

3. Thank you for stating the following in the Competing Interests section:

'The authors have declared that no competing interests exist.'

We note that one or more of the authors are employed by a commercial company: Agrotest Fyto, Ltd.

We stated in the Competing Interest section that:

“The authors have declared that no competing interests exist. There are no patents, products in development or marked product to declare. This does not alter our adherence to all the PlosOne policies on sharing data and materials.”

4. Please provide an amended Funding Statement declaring this commercial affiliation, as well as a statement regarding the Role of Funders in your study. If the funding organization did not play a role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript and only provided financial support in the form of authors' salaries and/or research materials, please review your statements relating to the author contributions, and ensure you have specifically and accurately indicated the role(s) that these authors had in your study. You can update author roles in the Author Contributions section of the online submission form.

Our commercial affiliation did not play a role in our study. We included the following statement within our amended Funding Statement.

“This work and ZA, DB, PeM and PaM have been supported by the Ministry of Agriculture of the Czech Republic (project no. MZE RO1118). PaM have been supported by the Ministry of Agriculture of the Czech Republic (project no. QK1910197) and Internal Grant of Palacky University (project no. IGA_PrF_2019_004). PeM have been supported by the Ministry of Agriculture of the Czech Republic (project no. QK1910343). The funder Agrotest Fyto, Ltd provided support in the form of salaries for all authors, but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the ‘author contributions’ section.”

5. Please also provide an updated Competing Interests Statement declaring this commercial affiliation along with any other relevant declarations relating to employment, consultancy, patents, products in development, or marketed products, etc.

Within your Competing Interests Statement, please confirm that this commercial affiliation does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: "This does not alter our adherence to PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests) . If this adherence statement is not accurate and there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

Please include both an updated Funding Statement and Competing Interests Statement in your cover letter. We will change the online submission form on your behalf.

We stated in the Competing Interest section that:

“The authors have declared that no competing interests exist. There are no patents, products in development or marked product to declare. This does not alter our adherence to all the PlosOne policies on sharing data and materials.”

6. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

We checked all figures by PACE and converted them to right format.

Response to Reviewers

1. Reviewer #1: This is an interesting paper that shows the effect on Fusarium inoculation in susceptible and resistant wheat of several different treatments in an attempt to identify potential treatments that can inhibit Fusarium inoculation and DON production during wheat production. I did have several concerns about the manuscript that are discussed below.

We thank reviewers for helpful comments, critical reading and the interest in improving the manuscript quality. We have processed the comments on our best. We hope that our amendments to the manuscript are suitable. All changes have been tracked using the revision mode in Word.

2. There is little to no indication why the authors choose the specific treatments of prochloraz, sodium bicarbonate, ergosterol, aescin and potassium iodide for this research. The authors need to provide an explanation of why these specific treatments were chosen.

We agree that this point was not clear enough. We have added appropriate explanation to the manuscript in Introduction part and also in Supplementary Information (S1 Figure):

“Prochloraz, potassium iodide and sodium bicarbonate were chosen for their antifungal effects in preliminary in vitro experiments (S1 Figure) and aescin and ergosterol because of their expected effect on plant triggered immunity.”

3. The heat map of expression levels in Figure 3 is frankly quite confusing. How are shades of light to dark chosen; Is there an expression range for each shade of grey to black? How do you distinguish between up and down regulation relative to the treatment? Both the figure explanation and perhaps the figure itself needs some modification to make the heat map data/results clearer to the reader.

We accepted the reviewer opinion and for a better clarity, the heat map (Figure 3) has been rearranged to the table (Table 2). Depending on these changes, we renumbered the other following figures.

4. I think the realtime QPCR and ELIZA results should be included as supplementary data.

We accepted the reviewer opinion and we moved qPCR and ELISA to the Supplementary Information section (Supplementary Information 1).

5. In the results and discussion sections, it is clear that the 10,000 ppm iodide treatment had a deleterious effect on germination and seedling growth. The literature cited (31-33) document this growth inhibition. Consequently, it is not clear why the 10,000 ppm concentration was chosen. Is this the only concentration that inhibits Fusarium growth? I am not sure of the value of having potassium-iodine included as a treatment in this paper unless it is actively thought of as a potential treatment to wheat to inhibit Fusarium growth and DON production during wheat production.

We thank the reviewer for comment regarding iodide treatment. We added explanation to the manuscript and appropriate results of in vitro preliminary test to the Supplementary Information (S1 Figure).

„Used concentration inhibited F. culmorum growth in preliminary in vitro test (S1 Figure). The observed toxicity of potassium iodide for wheat seedlings is thus understandable and such a high concentration suppress natural plant immunity, thus allowing us to see the effect of immunity on the intensity of the pathogen development (Fig 1).“

6. The authors, in the conclusion, state that sodium bicarbonate is a possible treatment of wheat to reduce infection and growth of Fusarium. I agree with this conclusion. However, I see that prochloraz shows results very similar to sodium bicarbonate yet it is not identified as a possible treatment. I do not understand why both of these treatments are not indicated as such in the conclusion unless prochloraz has a deleterious effect on plant growth. If this is the case there is no data presented that suggests that.

Indeed, the prochloraz is not in conclusions so it was corrected in the manuscript and we changed the first sentence in Conclusion to this form:

“We conclude that prochloraz and sodium bicarbonate has the greatest potential for suppression of fungal development without having a negative effect on plant growth.”

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

21 Jan 2020

Transcriptional analysis of wheat seedlings inoculated with Fusarium culmorum under continual exposure to disease defence inductors

PONE-D-19-28330R1

Dear Dr. Matusinsky,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Binod Bihari Sahu, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

24 Jan 2020

PONE-D-19-28330R1

Transcriptional analysis of wheat seedlings inoculated with Fusarium culmorum under continual exposure to disease defence inductors

Dear Dr. Matušinsky:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Binod Bihari Sahu

Academic Editor

PLOS ONE