Literature DB >> 32010467

Conserved Roles of MonA in Fungal Growth and Development in Aspergillus Species.

Ye-Eun Son1, Hee-Soo Park1.   

Abstract

MonA is a subunit of a guanine nucleotide exchange factor that is important for vacuole passing and autophagy processes in eukaryotes. In this study, we characterized the function of MonA, an orthologue of Saccharomyces cerevisiae Mon1, in the model fungus Aspergillus nidulans and a toxigenic fungus A. flavus. In A. nidulans, the absence of AnimonA led to decreased fungal growth, reduced asexual reproduction, and defective cleistothecia production. In addition, AnimonA deletion mutants exhibited decreased spore viability, had reduced trehalose contents in conidia, and were sensitive to thermal stress. In A. flavus, deletion of AflmonA caused decreased fungal growth and defective production of asexual spores and sclerotia structures. Moreover, the absence of monA affected vacuole morphology in both species. Taken together, these results indicate that MonA plays conserved roles in controlling fungal growth, development and vacuole morphology in A. nidulans and A. flavus.
© 2019 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group on behalf of the Korean Society of Mycology.

Entities:  

Keywords:  Aspergillus flavus; Aspergillus nidulans; MonA; asexual development

Year:  2019        PMID: 32010467      PMCID: PMC6968623          DOI: 10.1080/12298093.2019.1677380

Source DB:  PubMed          Journal:  Mycobiology        ISSN: 1229-8093            Impact factor:   1.858


Introduction

Aspergillus species are widespread around humans through the air [1]. Some species in this genus have beneficial effects in medicine, the food industry, and the environment [2,3]. But others exert detrimental effects by producing toxic secondary metabolites called mycotoxins [1,4]. Among these species, A. nidulans has been a useful model system for investigating gene functions, not only of individual genes but also for elucidating networks of gene interactions [5,6]. A. flavus is an opportunistic pathogenic fungus that produces many toxic secondary metabolites, such as aflatoxin [7] and cyclopiazonic acid [8]. A vacuole is a membrane-bound organelle in eukaryotes that play important roles in the cis- or trans- transport of substances to their target organelles [9,10]. Through targeting proteins to specific membranes and fusing with other membrane-bound cellular structures, vacuoles help cells maintain their morphology and pH homeostasis and conduct functions such as autophagy or degradation of misfolded proteins [11]. These functions involve various proteins including SNARE (soluble N-ethylmaleimide-sensitive fusion protein attachment protein receptor), Rab GTPase Ypt7p, and class C VPS/HOPS (class C vacuole protein sorting/homotypic fusion and protein sorting) [12-15]. Among multiplex proteins, Mon1 is a member of the guanine nucleotide exchange factor (GEF) family and interacts with Ccz1 in Saccharomyces cerevisiae. This Mon1-Ccz1 complex converts GDP to GTP form to activate Ypt7p on late endosomes and regulate endosomal maturation [16-18]. The orthologs of Mon1 related to the Cvt (cytoplasm to vacuole targeting) and autophagy pathways have been studied in plant and in human pathogenic fungi, including Magnaporthe oryzae, Fusarium graminearum, and Cryptococcus neoformans. In these species, this protein is associated with fungal development and pathogenicity [19-21]. However, Mon1 has not yet been studied in Aspergillus species despite its important vacuolar functions, such as survival, morphology, and transport. To investigate the roles of MonA, the Mon1 ortholog in Aspergillus spp. related to survival and morphology, we tested its functions. Mon1 orthologs in A. nidulans (AniMonA) and A. flavus (AflMonA) influence proper growth, asexual development, and the formation of normal sexual structures. In addition, MonA increases spore viability in both strains. However, only AniMonA significantly affects tolerance to thermal stress. Thus, MonA is essential for fungal growth and development.

Materials and methods

Strains, media, and culture conditions

The Aspergillus strains used in this study are listed in Table 1. For general purposes, all A. nidulans strains were grown on solid or liquid minimal media with 1% glucose (MMG) for 5–7 days [22]. For sexual development in A. nidulans, wild type (WT) and mutant strains were grown on solid sexual medium (SM) at 37 °C for 7 days. For A. flavus strains, MMG with 0.1% yeast extract (MMGY) was used for general purposes [23].
Table 1.

Aspergillus strains used in this study.

Strain nameRelevant genotypeReferences
FGSC4A. nidulans wild type, veA+FGSCa
RJMP1.59pyrG89; pyroA4; veA+[25]
TNJ36pyrG89; AfupyrG+; pyroA4; veA+[32]
TYE8.1 ∼ 3pyrG89; pyroA4; ΔAnimonA:: AfupyrG+; veA+This study
NRRL 3357A. flavus wild typeFGSCa
NRRL 3357.5A. flavus pyrG-[33]
TYE9.1 ∼ 3pyrG-; ΔAflmonA::AfupyrG+This study

Fungal Genetic Stock Center.

Aspergillus strains used in this study. Fungal Genetic Stock Center.

Generation of the MonA mutant strains

Oligonucleotides used in the present study are listed in Table 2. To generate the monA deletion (ΔmonA) cassettes, double-joint PCR (DJ-PCR) was used as previously described [24]. The 5′ and 3′ flanking regions of the AnimonA gene were amplified using the primer pairs OHS091/OHS092 and OHS093/OHS094, respectively, from A. nidulans FGSC4 genomic DNA. The pyrG marker was amplified from A. fumigatus AF293 genomic DNA with the primer pair OHS089/OHS090. The final deletion cassette was amplified with the primer pair OHS095/OHS096 and introduced into RJMP1.59 protoplasts generated by the VinoTaste® Pro (Novozymes, Blagsvaerd, Denmark) [25,26]. Multiple transformants were selected on MMG medium without uracil and uridine and confirmed by PCR and restriction enzyme digestion.
Table 2.

Oligonucleotides used in this study.

NameSequence (5′ → 3′)aPurpose
OHS091TAGCCAGACTCTTCGCGTCC5′ flanking region of AnimonA
OHS094CTGGCTTGTCTACCTGCAGG3′ flanking region of AnimonA
OHS093TTTGGTGACGACAATACCTCCCGAC CAACTGGTCAGGTCCATCGC5′ AnimonA with AfupyrG tail
OHS092GGCTTTGGCCTGTATCATGACTTCA TAGTTGGGGCGGAGAAGCTC3′ AnimonA with AfupyrG tail
OHS095TAACGCTCCGCATGAACGGC5′ nested of AnimonA
OHS096TGGAGCATCATCGGCCAGAG3′ nested of AnimonA
OHS089GCTGAAGTCATGATACAGGCCAAA5′ AfupyrG marker
OHS090ATCGTCGGGAGGTATTGTCGTCAC3′ AfupyrG marker
OHS435CAGGTAAGCCAGCACTCC5′ flanking region of AflmonA
OHS438GCTCCACGATCAGTGCAG3′ flanking region of AflmonA
OHS437TTTGGTGACGACAATACCTCCCGAC GCTGCTGCATAACCTCATCC5′ AflmonA with AfupyrG tail
OHS436GGCTTTGGCCTGTATCATGACTTCA CCTAGTACAGTAGCGACGTGG3′ AflmonA with AfupyrG tail
OHS439GTCACACCACCAACCTTGATC5′ nested of AflmonA
OHS440CCAGTCTATGCACGGACATACG3′ nested of AflmonA

Tail sequences are shown in italics.

Oligonucleotides used in this study. Tail sequences are shown in italics. For A. flavus, the 5′ and 3′ flanking regions of the AflmonA gene were amplified using the primer pairs OHS435/OHS436 and OHS437/OHS438, respectively, from A. flavus NRRL3357 genomic DNA. The pyrG marker was amplified from A. fumigatus AF293 genomic DNA with the primer pair OHS089/OHS090. The AflmonA deletion cassette was amplified with the primer pair OHS439/OHS440 and introduced into the recipient strain AFL 3357.5 [24]. Multiple candidates were isolated on MMGY medium without uracil and uridine and confirmed by PCR and restriction enzyme digestion.

Spore viability test

Spore viability was tested as described previously [27]. Briefly, fresh conidia from 2-day-old or 10-day-old cultures of wild-type and mutant strains were collected and counted. Approximately 100 conidia were inoculated onto solid MMG or MMGY and incubated at 37˚C for 48 h in triplicate. Survival rates were calculated as the ratio of the number of viable colonies to the number of spores inoculated in triplicates.

Trehalose analysis

The amount of trehalose (α-d-glucopyranosyl α-d-glucopyranoside) in conidia was measured as previously described [28,29]. Briefly, 108 conidia were suspended in 200 μl of ddH2O and incubated at 95 °C for 20 min. The supernatant was separated by centrifugation. Fifty microliters of supernatant were transferred to a new tube, mixed with an equal volume of 0.2 M sodium citrate (pH 5.5), and incubated with or without (as a negative control) trehalose (Sigma-Aldrich, St. Louis, MO, USA) at 37 °C for 8 h to generate glucose. After incubation, the amount of glucose generated from the trehalose was assayed with a Glucose Assay Kit (Sigma-Aldrich, St. Louis, MO, USA).

Heat stress response test

Heat stress response test was carried out as previously described [28,29]. Suspensions containing 103 conidia were incubated for 15 or 30 min at 37 °C before adding 900 μl of ddH2O. Approximately 100 conidia were spread onto solid MMG or MMYG. After incubation at 37 °C for 48 h, colony numbers were counted and survival was calculated as the ratio of colonies from treated versus untreated controls (in triplicate).

Microscopy

Colony photographs were taken with a Pentax MX-1 digital camera. Photomicrographs were taken with a Zeiss Lab.A1 microscope equipped with AxioCam 105c and AxioVision (Rel. 4.9) digital imaging software.

Staining of vacuoles

For vacuoles staining, WT and mutants conidia were inoculated in the YG (0.5% yeast extract, 1% glucose) media and culture for 24 h. The culture hyphae were stained with 10 μM CMAC (7-amino-4-chloromethylcoumarin) (Invitrogen, Carlsbad, CA, USA) for 30 min. The stained hyphae were washed fresh YG media for 30 min. The fluorescence of CMAC was observed using Nikon eclipse 80i microscope with 353 nm as the excitation wavelength and 466 nm as the emission wavelength.

Statistical analysis

Statistical differences between WT and mutant strains were evaluated by Student’s unpaired t-test. Mean ± standard deviation (SD) are shown. A value of P < 0.05 was considered statiscally significant.

Results

MonA in Aspergillus spp

The Mon1 gene is conserved in most Ascomycota and Basidiomycota [21]. To identify the S. cerevisiae Mon1 orthologs in Aspergillus spp., the S. cerevisiae Mon1 (ScMon1) protein sequence was blasted against genomes of 19 Aspergillus species in the AspGD database (www.aspgd.org). All Aspergillus species contain Mon1 orthologs that contain a trafficking protein MonA domain (Pfam03164) in their C-terminal regions (Figure 1(A)). The AnimonA gene (AN2093) encodes a 635-amino acid protein and AflmonA (AFLA_035140) gene encodes a 630-amino acid protein (418 a.a.) (Figure 1(B)). The MonA domain is highly conserved among Aspergillus species. To study the functions of AniMonA and AflMonA, three independent strains of monA deletion mutants in A. nidulans and A. flavus were generated (Supplementary Figure S1).
Figure 1.

The MonA in Asperillus spp. (A) A phylogenetic tree of MonA proteins from A. oryzae RIB40 (XP_023089908.1), A. terreus NIH2624 (XP_001215181.1), A. clavatus NRRL 1 (XP_001272699.1), A. flavus NRRL3357 (RMZ46160.1), A. zonatus (XP_022584673.1), A. carbonarius ITEM 5010 (OOF98920.1), A. fumigatus Af293 (Q4WHL1.2), A. sydowii (OJJ64521.1), A. versicolor (OJI98619.1), A. wentii DTO 134E9 (OJJ30605.1), A. aculeatus ATCC 16872 (XP_020058629.1), A. glaucus CBS 516.65 (XP_022402549.1), A. nidulans FGSC4 (CBF86164.1), A. niger CBS 513.8 8 (XP_001394465.2), A. brasiliensis CBS 101740 (OJJ77853.1), A. tubingensis CBS 134.48 (OJI82919.1), A. luchuensis (GAT22443.1), and A. kawachii IFO 4308 (GAA83795.1) was made with MEGA 7 software (http://www.megasoftware.net/) program neighbor-joining method with 1000 bootstrap replicates of phylogenetic relationships. The positions of the C-terminal trafficking domains of MonA in Aspergillus spp are shown (right); (B) Alignment of MonA in S. cerevisiae S228C (NP011391.2), A. nidulans FGSC4 (CBF86164.1), A. flavus AFL3357 (RMZ46160.1), and A. fumigatus AF293 (Q4WHL1.2). Bioedit and ESPript3 (http://espript.ibcp.fr/ESPript/ESPript/) were used for the alignment.

The MonA in Asperillus spp. (A) A phylogenetic tree of MonA proteins from A. oryzae RIB40 (XP_023089908.1), A. terreus NIH2624 (XP_001215181.1), A. clavatus NRRL 1 (XP_001272699.1), A. flavus NRRL3357 (RMZ46160.1), A. zonatus (XP_022584673.1), A. carbonarius ITEM 5010 (OOF98920.1), A. fumigatus Af293 (Q4WHL1.2), A. sydowii (OJJ64521.1), A. versicolor (OJI98619.1), A. wentii DTO 134E9 (OJJ30605.1), A. aculeatus ATCC 16872 (XP_020058629.1), A. glaucus CBS 516.65 (XP_022402549.1), A. nidulans FGSC4 (CBF86164.1), A. niger CBS 513.8 8 (XP_001394465.2), A. brasiliensis CBS 101740 (OJJ77853.1), A. tubingensis CBS 134.48 (OJI82919.1), A. luchuensis (GAT22443.1), and A. kawachii IFO 4308 (GAA83795.1) was made with MEGA 7 software (http://www.megasoftware.net/) program neighbor-joining method with 1000 bootstrap replicates of phylogenetic relationships. The positions of the C-terminal trafficking domains of MonA in Aspergillus spp are shown (right); (B) Alignment of MonA in S. cerevisiae S228C (NP011391.2), A. nidulans FGSC4 (CBF86164.1), A. flavus AFL3357 (RMZ46160.1), and A. fumigatus AF293 (Q4WHL1.2). Bioedit and ESPript3 (http://espript.ibcp.fr/ESPript/ESPript/) were used for the alignment.

Role of AniMonA during asexual development in Aspergillus nidulans

To study the functions of AniMonA in A. nidulans, WT and AnimonA deletion mutant strains were inoculated onto MMG and fungal growth and development were compared (Figure 2(A)). Deletion of AnimonA leads to decreased colony diameters during growth in dark conditions (Figure 2(B)). The ΔAnimonA mutant strains exhibit decreased conidial production under both light and dark conditions (Figure 2(C)). In addition, the ΔAnimonA mutants produce light green conidia, a phenotype that differs from the conidia of WT strains (Figure 2(A)). To test whether AnimonA is also associated with sexual development, WT and ΔAnimonA mutants were inoculated on SM and sexual fruiting bodies were examined. As shown Figure 2(D,E), the cleistothecia of ΔAnimonA mutants are much smaller than those of WT. These results demonstrate that AniMonA is essential for proper growth, asexual and sexual development.
Figure 2.

Phenotypes of ΔmonA mutants in A. nidulans. (A) Colony photographs of WT (TNJ36) and ΔAnimonA (TYE8.1) strains. WT and mutants were point inoculated onto solid MMG and incubated at 37 °C for 5 days in light and dark conditions; (B) Conidial diameter of conidiospores in WT and ΔAnimonA (TYE8.1) mutants; (C) Conidia were measured 5 days after incubation on MMG plates under the light or dark conditions. The number of conidia per plate was counted in triplicate; (D) WT (TNJ36) and ΔAnimonA (TYE8.1) strains were point inoculated onto solid SM and incubated at 37 °C for 7 days in dark condition. Panels below represent magnified images from the middle of each plate; (E) Colonies of WT and ΔAnimonA (TYE8.1) mutants were washed with 100% ethanol to enable the visualization of cleistothetia. Bottom panel shows diameter of cleistothetia in WT and ΔAnimonA (TYE8.1) mutants grown in SM for 7 days. Error bars represent standard deviation (differences between the AnimonA mutants and WT strains. ***p < .001). Statistical analysis was performed using the Student’s t-test.

Phenotypes of ΔmonA mutants in A. nidulans. (A) Colony photographs of WT (TNJ36) and ΔAnimonA (TYE8.1) strains. WT and mutants were point inoculated onto solid MMG and incubated at 37 °C for 5 days in light and dark conditions; (B) Conidial diameter of conidiospores in WT and ΔAnimonA (TYE8.1) mutants; (C) Conidia were measured 5 days after incubation on MMG plates under the light or dark conditions. The number of conidia per plate was counted in triplicate; (D) WT (TNJ36) and ΔAnimonA (TYE8.1) strains were point inoculated onto solid SM and incubated at 37 °C for 7 days in dark condition. Panels below represent magnified images from the middle of each plate; (E) Colonies of WT and ΔAnimonA (TYE8.1) mutants were washed with 100% ethanol to enable the visualization of cleistothetia. Bottom panel shows diameter of cleistothetia in WT and ΔAnimonA (TYE8.1) mutants grown in SM for 7 days. Error bars represent standard deviation (differences between the AnimonA mutants and WT strains. ***p < .001). Statistical analysis was performed using the Student’s t-test.

Role of AniMonA in Aspergillus nidulans conidia

To test the functions of AniMonA in asexual spores, we evaluated the viability of conidia. WT and ΔAnimonA mutant conidia from 2- and 10-day old culture plates were isolated and inoculated onto MMG media. The conidia of ΔAnimonA mutant strains exhibit defects in spore viability (Figure 3(A)). Previous studies demonstrated that trehalose in conidia is crucial for spore viability and stress tolerance in Aspergillus spp [28]. Therefore, we then examined the trehalose content in WT and mutant conidia. As shown in Figure 3(B), the amount of trehalose in ΔAnimonA mutant conidia is lower than in WT conidia. We then examined whether the absence of AnimonA could cause increased sensitivity of the spores to heat stress. The ΔAnimonA mutant conidia from 10-day old culture plates are more sensitive to thermal stress than those from equivalent WT cultures (Figure 3(C)). Taken together, these results demonstrate that AniMonA is required for conidia maturation.
Figure 3.

The roles of monA in A. nidulans conidia. (A) Viability of conidia collected from WT (TNJ36) and ΔAnimonA (TYE8.1) strains grown at 37 °C for 10 days (triplicate measurements); (B) Trehalose in WT (TNJ36) and ΔAnimonA (TYE8.1) strain conidia; (C) Tolerance of WT (TNJ36) and ΔAnimonA (TYE8.1) conidia against thermal stress. All strains were grown for 2 days and 102 conidia per strain were heated at 50 °C for 0, 15, and 30 min (triplicate measurements). Error bars represent standard deviation (differences between the AnimonA mutants and WT strains. ***P < 0.001; **P < 0.01; *P < 0.05). Statistical analysis was performed using the Student’s t-test.

The roles of monA in A. nidulans conidia. (A) Viability of conidia collected from WT (TNJ36) and ΔAnimonA (TYE8.1) strains grown at 37 °C for 10 days (triplicate measurements); (B) Trehalose in WT (TNJ36) and ΔAnimonA (TYE8.1) strain conidia; (C) Tolerance of WT (TNJ36) and ΔAnimonA (TYE8.1) conidia against thermal stress. All strains were grown for 2 days and 102 conidia per strain were heated at 50 °C for 0, 15, and 30 min (triplicate measurements). Error bars represent standard deviation (differences between the AnimonA mutants and WT strains. ***P < 0.001; **P < 0.01; *P < 0.05). Statistical analysis was performed using the Student’s t-test.

Conserved role of AflMonA in Aspergillus flavus

Since AniMonA plays an important role in growth and development, we evaluated the role of MonA in another Aspergillus species, A. flavus. AflmonA deletion (ΔAflmonA) mutant strains were generated. WT and ΔAflmonA mutant strains were inoculated onto MMGY and cultured under both light and dark conditions (Figure 4(A)). Reduced colony growth, similar to that seen in ΔAnimonA strains, is observed with ΔAflmonA mutant strains (Figure 4(B)) as well as decreased conidial production (Figure 4(C)) under the light and dark conditions. When WT and ΔAflmonA mutant strains were cultured under dark conditions for 7 days, WT strains produce sclerotia, whereas the ΔAflmonA mutant strains do not produce sclerotia (Figure 4(D,E)). Because AniMonA is required for spore viability and heat stress, the role of AflMonA in conidia was examined. Decreased spore viability is seen in ΔAflmonA mutant strains (Figure 4(F)). Overall, these results demonstrate that MonA has conserved roles in fungal growth, differentiation, and spore viability in Aspergillus spp.
Figure 4.

Phenotypes of ΔmonA mutants in A. flavus. (A) Colony photographs of WT (NRRL3357) and ΔAflmonA (TYE9.1) strains. WT and ΔAflmonA (TYE9.1) mutant strains were point inoculated onto solid MMGY and incubated at 37 °C for 5 days in light and dark conditions; (B) Conidial diameter of WT and ΔAflmonA (TYE9.1) mutants was measured 5 days after incubation on MMY plates under light or dark conditions; (C) The number of conidia per plate was counted for WT and ΔAflmonA (TYE9.1) mutant strains; (D) WT and ΔAflmonA (TYE9.1) strains were point inoculated onto solid MMYG, incubated at 37 °C for 7 days in dark condition. Panels below represent colonies of WT and ΔAflmonA (TYE9.1) mutant after washing with 100% ethanol to enable the visualization of sclerotia; (E) Number of sclerotia in WT (NRRL3357) and ΔAflmonA (TYE9.1) strains; (F) Viability of conidia collected from WT (NRRL3357) and ΔAflmonA (TYE9.1) strains grown at 37 °C for 10 days (triplicate measurements). Error bars represent standard deviation (differences between the AflmonA mutants and WT strains. ***P < 0.001; **P < 0.01; *P < 0.05). Statistical analysis was performed using the Student’s t-test.

Phenotypes of ΔmonA mutants in A. flavus. (A) Colony photographs of WT (NRRL3357) and ΔAflmonA (TYE9.1) strains. WT and ΔAflmonA (TYE9.1) mutant strains were point inoculated onto solid MMGY and incubated at 37 °C for 5 days in light and dark conditions; (B) Conidial diameter of WT and ΔAflmonA (TYE9.1) mutants was measured 5 days after incubation on MMY plates under light or dark conditions; (C) The number of conidia per plate was counted for WT and ΔAflmonA (TYE9.1) mutant strains; (D) WT and ΔAflmonA (TYE9.1) strains were point inoculated onto solid MMYG, incubated at 37 °C for 7 days in dark condition. Panels below represent colonies of WT and ΔAflmonA (TYE9.1) mutant after washing with 100% ethanol to enable the visualization of sclerotia; (E) Number of sclerotia in WT (NRRL3357) and ΔAflmonA (TYE9.1) strains; (F) Viability of conidia collected from WT (NRRL3357) and ΔAflmonA (TYE9.1) strains grown at 37 °C for 10 days (triplicate measurements). Error bars represent standard deviation (differences between the AflmonA mutants and WT strains. ***P < 0.001; **P < 0.01; *P < 0.05). Statistical analysis was performed using the Student’s t-test.

Role of MonA in Aspergillus vacuole formation

Because MonA is involved in vacuole formation in various fungi [20,30], we examined the vacuole formation in WT and monA deletion mutants in both A. nidulans and A. flavus by CMAC staining. As shown in Figure 5, the vacuoles of WT hyphae were stained by CMAC, whereas the CMAC fluorescence was dispersed in the ΔmonA mutant hyphae in both A. nidulans and A. flavus, suggesting that MonA plays an important role in vacuole formation in A. both Aspergillus species.
Figure 5.

Vacuole morphology of ΔmonA mutants in Aspergillus spp. Hyphae of WT and ΔmonA mutant strains in A. nidulans (A) or A. flavus (B) were stained with CMAC and examined by DIC or fluorescence microscopy. Arrows indicate the vacuoles.

Vacuole morphology of ΔmonA mutants in Aspergillus spp. Hyphae of WT and ΔmonA mutant strains in A. nidulans (A) or A. flavus (B) were stained with CMAC and examined by DIC or fluorescence microscopy. Arrows indicate the vacuoles.

Discussion

Mon1 is a conserved protein that plays a vital role in eukaryotes [31]. In S. cerevisiae, Mon1 interacts with Ccz1, forms a Mon1-Ccz1 complex that activates the formation of a trans-SNARE complex, and influences subsequent vacuole fusion and autophagy [16,31]. In filamentous fungi, Mon1 orthologs are also crucial for various processes involved in vacuole formation, fungal development, virulence, and mycotoxin production [20,30]. First, Mon1 is involved in fungal growth and development. In F. graminearum, FgMON1 deletion mutants exhibit defects of conidial germination and sexual development [20]. In M. oryzae, deletion of MoMON1 causes reduced hyphal growth and decreased conidial production [30]. Second, Mon1 is required for pathogenicity in both plant and human pathogenic fungi. In human pathogenic fungi C. neoformans, deletion of Camon1 causes defects in virulence in insect and murine inhalation models [21]. Third, the Mon1 ortholog affects production of detrimental secondary metabolites. FgMon1 regulates expression of certain gene transcripts involved in trichothecene biosynthesis that control deoxynivalenol production [20]. Because Mon1 orthologs are important in development, pathogenicity, and the production of secondary metabolites in fungi, we hypothesized that MonA plays a crucial role in two Aspergillus species. AnimonA and AflmonA deletion mutant strains showed defects in the production of asexual and sexual structures, suggesting that MonA is required for proper asexual and sexual development (Figures 2 and 4). We also examined the role of MonA in mycotoxin production. However, the ΔAnimonA and ΔAflamonA mutant strains still produce sterigmatocystin and aflatoxin, respectively (data not shown). While the roles of MonA in Aspergillus spp. were studied through phenotypic analyses, detailed molecular mechanisms are unknown. In both yeast and filamentous fungi, Mon1 orthologs are required for vacuole formation, but the underlying regulatory mechanisms might be different. Because S. cerevisiae and C. neoformans produce the Ccz1 protein, a partner protein of Mon1, Mon1 can form the Mon1-Ccz1 complex that regulates vacuole formation and autophagy. However, the Ccz1 orthologs could not be found in the genome database of several filamentous fungi including Fusarium spp., Aspergillus spp., and Penecillium spp [20]. These observations imply that MonA could regulate vacuole formation in different ways. In conclusion, we confirmed that MonA is essential for growth, asexual and sexual reproduction, vacuole formation, and spore maturation in Aspergillus species. Additional studies to elucidate the role of MonA in pathogenicity and mycotoxin production in Aspergillus will increase our understanding.
  33 in total

Review 1.  The fungal vacuole: composition, function, and biogenesis.

Authors:  D J Klionsky; P K Herman; S D Emr
Journal:  Microbiol Rev       Date:  1990-09

Review 2.  SNAREs--engines for membrane fusion.

Authors:  Reinhard Jahn; Richard H Scheller
Journal:  Nat Rev Mol Cell Biol       Date:  2006-08-16       Impact factor: 94.444

3.  The Mon1-Ccz1 complex is the GEF of the late endosomal Rab7 homolog Ypt7.

Authors:  Mirjana Nordmann; Margarita Cabrera; Angela Perz; Cornelia Bröcker; Clemens Ostrowicz; Siegfried Engelbrecht-Vandré; Christian Ungermann
Journal:  Curr Biol       Date:  2010-09-28       Impact factor: 10.834

Review 4.  On the safety of Aspergillus niger--a review.

Authors:  E Schuster; N Dunn-Coleman; J C Frisvad; P W M Van Dijck
Journal:  Appl Microbiol Biotechnol       Date:  2002-06-25       Impact factor: 4.813

5.  MoMon1 is required for vacuolar assembly, conidiogenesis and pathogenicity in the rice blast fungus Magnaporthe oryzae.

Authors:  Hui-Min Gao; Xiao-Guang Liu; Huan-Bin Shi; Jian-Ping Lu; Jun Yang; Fu-Cheng Lin; Xiao-Hong Liu
Journal:  Res Microbiol       Date:  2013-01-29       Impact factor: 3.992

6.  Characterization of the velvet regulators in Aspergillus flavus.

Authors:  Tae-Jin Eom; Heungyun Moon; Jae-Hyuk Yu; Hee-Soo Park
Journal:  J Microbiol       Date:  2018-10-25       Impact factor: 3.422

7.  The docking stage of yeast vacuole fusion requires the transfer of proteins from a cis-SNARE complex to a Rab/Ypt protein.

Authors:  A Price; D Seals; W Wickner; C Ungermann
Journal:  J Cell Biol       Date:  2000-03-20       Impact factor: 10.539

8.  A novel regulator couples sporogenesis and trehalose biogenesis in Aspergillus nidulans.

Authors:  Min Ni; Jae-Hyuk Yu
Journal:  PLoS One       Date:  2007-10-03       Impact factor: 3.240

9.  FgMon1, a guanine nucleotide exchange factor of FgRab7, is important for vacuole fusion, autophagy and plant infection in Fusarium graminearum.

Authors:  Ying Li; Bing Li; Luping Liu; Huaigu Chen; Haifeng Zhang; Xiaobo Zheng; Zhengguang Zhang
Journal:  Sci Rep       Date:  2015-12-10       Impact factor: 4.379

10.  Improved protocols for functional analysis in the pathogenic fungus Aspergillus flavus.

Authors:  Zhu-Mei He; Michael S Price; Gregory R Obrian; D Ryan Georgianna; Gary A Payne
Journal:  BMC Microbiol       Date:  2007-11-26       Impact factor: 3.605

View more
  1 in total

Review 1.  Cephalosporin C biosynthesis and fermentation in Acremonium chrysogenum.

Authors:  Ling Liu; Zhen Chen; Wuyi Liu; Xiang Ke; Xiwei Tian; Ju Chu
Journal:  Appl Microbiol Biotechnol       Date:  2022-09-17       Impact factor: 5.560

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.