Literature DB >> 31929567

Upregulation of long non-coding RNA ROR1-AS1 promotes cell growth and migration in bladder cancer by regulation of miR-504.

Qingke Chen1, Lingmin Fu2.   

Abstract

BACKGROUND: Increasing evidence has suggested that multiple long non-coding RNAs (lncRNAs) act key regulatory functions in the pathogenesis of bladder cancer. This study aimed to determine the expression and clinical significance of lncRNA ROR1 antisense RNA 1 (ROR1-AS1) from patients with bladder cancer, and to explore the potential role and mechanism underlying ROR1-AS1-related cancer progression.
METHODS: Real time quantitative PCR (RT-qPCR) was conducted to detected the expression levels of ROR1-AS1 and miR-504 in bladder cancer samples and cell lines. Chi-square test was used for correlation analysis. 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) and wound scratch assays were applied to assesses the effects of ROR1-AS1 overexpression and knockdown on bladder cancer cell growth and migration in vitro, respectively. The prognosis of bladder cancer patients was evaluated by survival curves with Kaplan-Meier method. The regulatory mechanism of ROR1-AS1 on miR-504 was confirmed by bioinformatics analysis and luciferase reporter gene assay.
RESULTS: ROR1-AS1 levels were obviously upregulated in bladder cancer tissues than matched normal bladder tissues. High expression of ROR1-AS1 was remarkably correlated with higher histological grade, advanced tumor stage, and positive lymph node metastasis. High ROR1-AS1 expression was markedly correlated with shorter overall survival of bladder cancer patients. Moreover, knockdown of ROR1-AS1 notably repressed T24 and 5637 cell growth and migration. ROR1-AS1 directly bound with miR-504 and act as a molecular sponge to decrease miR-504 expression. Silencing of miR-504 partly abrogated ROR1-AS1 knockdown-induced inhibitory effects on bladder cancer cell growth and migration.
CONCLUSIONS: Our data demonstrated that increased ROR1-AS1 promotes cell growth and migration of bladder cancer via regulation of miR-504, indicating ROR1-AS1 may be used as a prognostic biomarker and therapeutic target for bladder cancer.

Entities:  

Year:  2020        PMID: 31929567      PMCID: PMC6957147          DOI: 10.1371/journal.pone.0227568

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Bladder cancer is the fourth most common diagnosed malignancy, and is one of the most expensive malignancies to treatment in men worldwide [1]. According to the Global Cancer Statistics in 2017, approximately 440,000 new cases are diagnosed with bladder cancer, and among those patients about 130,000 cases died of cancer [2]. Patients with invasive bladder cancer are commonly treated with radical cystectomy and urinary diversion; however, those patients usually have a poor prognosis [3,4]. At present, because of the poor understanding of pathological mechanisms in the progression of bladder cancer, the effective treatment for this cancer is very limited [5,6]. Therefore, it’s essential to identify new sensitive and promising therapeutic targets for bladder cancer. Long non-coding RNA (lncRNA) is a class of non-coding RNA which surpasses 200 nucleotides in length, usually exhibiting little or no coding potential [7]. Increasing data have demonstrated that lncRNAs play a crucial role in modulating various cellular biological processes, including growth and differentiation, apoptosis, malignant metastasis, and epithelial-mesenchymal transition [8-10]. According to their location on the human genome, lncRNAs can be placed into five broad categories: sense, antisense, bidirectional, intronic, and intergenic. Recent studies have identified that some antisense lncRNAs participate in the tumorigenesis and carcinogenesis of diverse human cancers, these lncRNAs can also be used as potential and effective biomarkers for cancer therapies [11,12]. For instance, ABHD11 antisense RNA1 acts as an oncogene and a potential target for antitumor therapies in ovarian cancer [13]. Long intergenic non-protein coding RNA 1133 inhibits breast cancer cell invasion and metastasis by negatively regulating SRY-box transcription factor 4 expression via enhancer of zeste 2 polycomb repressive complex 2 subunit [14]. SMAD5 antisense RNA 1 functions as a miR-106a-5p sponge to promote epithelial mesenchymal transition in nasopharyngeal carcinoma [15]. Additional, DLX6 antisense RNA 1 promotes cell growth and invasiveness in bladder cancer via modulating the miR-223-HSP90B1 axis [16]. ROR1 antisense RNA 1 (ROR1-AS1) is a novel found lncRNA, which locates at human genome 1p31.3 position. Hu and his team [17] in 2017 reported that ROR-AS1 is involved in regulation of gene transcription via associating with polycomb repressive complex 2 complex, and may serve as a new biomarker in patients with mantle cell lymphoma. Recently, several studies indicated that ROR1-AS1 can enhance colorectal cancer metastasis and tumorigenesis [18,19]. MicroRNAs (miRs) act as tumor suppressive or oncogenic factors and are major posttranscriptional gene regulators in diverse cancers. LncRNAs can associate with miRs to impact cell biological behaviors by acting as ceRNAs by competitively binding common miRs [19]. Despite the above-mentioned knowledge, how ROR1-AS1 participated in the progression of bladder cancer remains unclear. The present study aimed to explore the functional role and downstream target miRs of ROR1-AS1 in the progression of bladder cancer. We firstly analyzed the expression and clinical significances of ROR1-AS1 in patients with bladder cancer. Then, we performed in vitro loss-of-function and gain-of-function experiments to determine the potential function of ROR1-AS1 in bladder cancer cell growth and migration. Finally, luciferase reporter gene assay and rescue experiments were applied to confirm the regulatory mechanism of ROR1-AS1 on miR-504. Our study highlighted a key role of ROR1-AS1/miR-504 axis in the progression of bladder cancer.

Materials and methods

Clinical specimens and cell culture

This research was approved by the Ethics Committee of the First Affiliated Hospital of Nanchang University (Approval No. 2018070), and the written informed consents were received from all patients in accordance with the 1964 Helsinki declaration and its later amendments. This retrospective study included 65 cases of bladder cancer patients who underwent surgery at Department of Urology, First Affiliated Hospital of Nanchang University between 09/2011 and 05/2017. Human bladder tissues and adjacent matched normal bladder tissues (≥ 3 cm away from the edge of cancer) from all patients were collected between 09/2011 and 05/2017, and instantly frozen in liquid nitrogen after operation until further use. The clinicopatholigcal information were recorded and summarized by patient’s attending physician. The grade of bladder cancer was assessed according to the World Health Organization 2004 Grading System [20] and the stage was classified according to the modified tumor–node–metastasis (TNM) cancer staging system (UICC, 2002) [21]. The research was carried out at First Affiliated Hospital of Nanchang University during 01/2018-08/2019. Five human bladder cancer cells (T24, 5637, J82, 253J and RT4) and a normal bladder epithelial cell (SV-HUC-1) were directly purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in DMEM medium (Thermo Fisher Scientific, Waltham, MA, USA) and 10% FBS (HyClone, Logan, UT, USA) with an incubator containing 5% CO2 at 37°C. The SV-HUC-1 cell were cultured in F-12K medium (Thermo Fisher Scientific) plus 10% FBS and antibiotics (100 U/ml penicillin and 100 μg/ml streptomycin).

RNA isolation and real time quantitative PCR (RT-qPCR)

Total RNA from bladder cancer tissues (size at 2 mm3) or cells (number at 2 × 106) was obtained by using TRIzol reagent (Thermo Fisher Scientific). Each RNA (1 μg) was reversed transcribed to complementary DNA by utilizing a PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Beijing, China), following the manufacturer’s instructions. After that, qPCR was performed with a SYBR Premix ExTaq II kit (Takara) on an ABI 7900 Real Time PCR system (Applied Biosystems, Foster City, CA, USA) to quantify the relative the expression of ROR1-AS1 and miR-504. The qPCR cycling conditions: one denaturation step of 10 min at 95°C; 40 cycles, with one cycle consisting of 10 sec at 95°C, 30 sec at 58°C, and 30 sec at 72°C. The primer sequences were shown in Table 1. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and small nuclear RNA U6 (U6) genes were served as the internal controls. The 2-ΔΔCt method was utilized to analyze the data and calculate the relative expression of each gene [22]. The experiments were performed in triplicate and repeated three times.
Table 1

The primer sequences used for real time quantitative PCR (RT-qPCR).

Gene symbolForward (5’-3’)Reverse (5’-3’)
ROR1-AS1GACGAAACACTGGAAGTCTGATTTGGTAGCTT
GAPDHCCAAAATCAAGTGGGGCTGATGGCATGGACTGTGGT
miR-504GCTGCTGTTGGGAGACCGCCCTCTGTATGGGAAAC
U6CTCGCTTCGGCAGCACATAACGCTTCACGAATTTGCGT

Transfection

The specific short hairpin RNA (shRNA) targeting ROR1-AS1 (shRNA-ROR1-AS1, 5’-GUAGGGAAGUACAAUUUUUGAGUUA-3’) and the corresponding non-specific shRNA (shRNA-NC, 5’-UGCAUCCUACTAGAUGGCCUGUAA-3’) were obtained from GenePharma Biotechnology (Suzhou, China). The miR-504 inhibitor (5’-CAGACGUGAGAUAGACAUAAGAA-3’) and inhibitor NC (5’-AUUCCCGAAUCCAAUAGUGCAU-3’) were synthesized in RiboBio Biotechnology (Guangzhou, China). T24 and 5637 cells were cultured in 6-well plates to get 80% confluence and then transfected with the indicated amounts of shRNA-ROR1-AS1 or shRNA-NC and miR-504 inhibitor or inhibitor NC by using lipofectamine 2000 transfection reagent (Thermo Fisher Scientific), according to the specific instructions. The transfection efficiency was analyzed after 48 h transfection by RT-qPCR.

MTT assay

MTT (3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl tetrazolium bromide) assay was applied to detect cell proliferation ability. T24 and 5637 cells were seeded into 96-well culture plate 24 h prior to transfection with shRNA-ROR1-AS1 or shRNA-NC and miR-504 inhibitor or inhibitor NC. After 0, 24, 48 or 72 h transfection, 12 μl of MTT solution (TIANGEN Biotechnology, Beijing, China) at 5 mg/ml concentration was added to each well, and incubated for 3 h at 37°C. Then, the supernatants were discarded, and 120 μl of DMSO (TIANGEN Biotechnology) was used to solubilize the crystals for 20 min at 37°C. Data of absorbance were measured at a wavelength of 480 nm (with 590 nm as the reference wavelength) using a Synergy™ HT Multi-Mode Microplate Reader (Biotek, Winooski, VT, USA) at the indicated time points.

Wound scratch assay

Wound scratch assay was performed to evaluate cell migration capacity. Briefly, T24 and 5637 cells transfected with shRNA-ROR1-AS1 or shRNA-NC and miR-504 inhibitor or inhibitor NC were seeded into six-well culture plates and cultured with DMEM medium and 10% FBS to form a tight monolayer. Scraped lines were created with 100 μl sterile pipette tips, and the cell debris was removed with PBS and the remaining cells were incubated for 24 h at 37°C with no serum-containing DMEM medium. The migrated distances of the growing edge on the monolayer were observed by using a ECLIPSE TS100 light microscope (Nikon Corporation, Tokyo, Japan) under a 200× microscope field at 0~24 h after being wounded.

Luciferase reporter gene assay

A target prediction tool, starBase v2.0 (http://starbase.sysu.edu.cn/starbase2/), was used to predict potential miRs target of ROR1-AS1, and we found ROR1-AS1 could potentially bind with miR-504 sequence. The ROR1-AS1 transcript 1 containing the binding sites and non-binding sites for miR-504 sequence were synthesized and inserted into a psiCHECK2 reporter vector (Promega, WI, USA) to get the ROR1-AS1-WT and ROR1-AS1-MUT reporter vectors, respectively. Subsequently, bladder cancer cells were seeded into 24-well plates and transfected with the ROR1-AS1-WT and ROR1-AS1-MUT vector, together with miR-504 inhibitor or inhibitor NC using Lipofectamine 2000, according to the manufacturer’s instructions. 24 h after the cell transfection, the luciferase activity was determined by using a dual-luciferase reporter assay (Promega, WI, USA). The relative Renilla luciferase activities were normalized to Firefly luciferase activities, which was served as an internal control for transfection efficiency.

Statistical analysis

The statistical analyses were performed using SPSS 19.0 (SPSS Inc., Chicago, IL, USA). Data were presented as mean ± SD (standard deviation) from the three independent experiments. The expression differences between bladder cancer tissues and adjacent matched normal bladder tissues were analyzed using paired student’s t-test. Chi-square test was used for correlation analysis. Kaplan-Meier method was utilized for analysis of prognosis. CCK-8 assay were analyzed using ANOVA analysis followed by post hoc testing. P values were two-sided and a two-tailed value of p<0.05 was considered to be a statistically significant difference.

Results

ROR1-AS1 expression is upregulated in patients with bladder cancer and associates with malignant clinicopatholigcal features

The relative expression levels of ROR1-AS1 was determined by RT-qPCR in a total of 65 cases of bladder cancer patients. Compared with adjacent matched normal bladder tissues, the ROR1-AS1 levels were notably upregulated in bladder cancer tissues (Fig 1A, p<0.05). Subsequently, we analyzed the expression levels of ROR1-AS1 in multiple bladder cancer cell lines (T24, 5637, J82, 253J and RT4). ROR1-AS1 expression was also increased significantly in the five bladder cancer cells compared with the normal bladder epithelial cell (SV-HUC-1) (Fig 1B, p<0.05). Furthermore, the correlations between ROR1-AS1 expression and clinicopathologic variables was evaluated. The 65 pairs of bladder cancer patients were divided into two groups based on the median value of relative ROR1-AS1 expression level: low (n = 33) and high (n = 32) ROR1-AS1 expression groups. As shown in Table 2, the high ROR1-AS1 expression was notably correlated with advanced tumor stage (p = 0.005), higher tumor grade (p = 0.045), and positive lymph node metastasis (p = 0.015). But not correlated with patient’s sex (p = 0.097), age (p = 0.199), smoking status (p = 0.590) and tumor size (p = 0.505). Moreover, patients with high ROR1-AS1 expression had a significantly shorter survival times compared with those patients with low ROR1-AS1 expression (Fig 2, p<0.05). These data indicated that upregulation of ROR1-AS1 may be involved in the progression of bladder cancer.
Fig 1

The expression of lncRNA ROR1-AS1 is upregulated in bladder cancer samples and cell lines.

(A) Real time quantitative PCR (RT-qPCR) analysis of ROR1 antisense RNA 1 (ROR1-AS1) expression in 65 cases of pairs bladder cancer tissues and adjacent matched normal bladder tissues. (B) ROR1-AS1 expression was determined by RT-qPCR in five bladder cancer cell lines (T24, 5637, J82, 253J and RT4) and a normal bladder epithelial cell line (SV-HUC-1). Data were expressed as the mean ± SD (n = 3). *p < 0.05.

Table 2

Correlation between ROR1 antisense RNA 1 (ROR1-AS1) expression and different clinicopathologic features in 65 cases of bladder cancer patients.

Clinicopathologic featuresNo.ROR1-AS1p
High (n, %)Low (n, %)
Age (years)0.199
<55197 (10.8)12 (18.5)
≥554625 (38.5)21 (32.3)
Sex0.097
Male3822 (33.8)16 (24.6)
Female2710 (15.4)17 (26.2)
Smoking status0.590
No146 (9.2)8 (12.3)
Yes5126 (40.0)25 (38.5)
Size0.505
<3 cm2511 (16.9)14 (21.5)
≥3 cm4021 (32.3)19 (29.2)
Grade0.045*
G1-G2227 (10.8)15 (23.1)
G34325 (38.5)18 (27.7)
Stage0.005*
T1-T2215 (7.7)16 (24.6)
T34427 (41.5)17 (26.2)
Lymph node metastasis0.015*
No268 (12.3)18 (27.7)
Yes3924 (36.9)15 (23.1)

*p<0.05.

Fig 2

Kaplan-Meier overall survival curves by ROR1-AS1 expression.

Patients with high ROR1-AS1 expression exhibited a significantly shorter survival times compared with those patients with low ROR1-AS1 expression.

The expression of lncRNA ROR1-AS1 is upregulated in bladder cancer samples and cell lines.

(A) Real time quantitative PCR (RT-qPCR) analysis of ROR1 antisense RNA 1 (ROR1-AS1) expression in 65 cases of pairs bladder cancer tissues and adjacent matched normal bladder tissues. (B) ROR1-AS1 expression was determined by RT-qPCR in five bladder cancer cell lines (T24, 5637, J82, 253J and RT4) and a normal bladder epithelial cell line (SV-HUC-1). Data were expressed as the mean ± SD (n = 3). *p < 0.05.

Kaplan-Meier overall survival curves by ROR1-AS1 expression.

Patients with high ROR1-AS1 expression exhibited a significantly shorter survival times compared with those patients with low ROR1-AS1 expression. *p<0.05.

ROR1-AS1 knockdown suppresses the proliferation and migration of bladder cancer cells

To examine the potential roles of ROR1-AS1 in the proliferation and migration of bladder cancer, T24 and 5637 cells were chose and treated with shRNA-ROR1-AS1 or shRNA-NC using MTT and wound scratch assays. As presented in Fig 3A, ROR1-AS1 siRNA transfected T24 cells significantly decreased ROR1-AS1 expression levels, and knockdown of ROR1-AS1 inhibited T24 cell growth and migration (p<0.05). Meanwhile, shRNA-ROR1-AS1 treated cells downregulated ROR1-AS1 expression in 5637 cells, and arrested 5637 cell proliferation and migration (Fig 3B, p<0.05). These data demonstrated that ROR1-AS1 contributes to cell proliferation and migration in bladder cancer.
Fig 3

The effects of ROR1-AS1 knockdown on bladder cancer cells proliferation and migration.

(A) The T24 cells were transfected with shRNA-ROR1-AS1 or shRNA-NC, and ROR1-AS1 expression levels were analyzed by RT-qPCR after 48 h transfection. 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) and wound scratch assays were applied to determine T24 cells growth and migration in vitro. (B) shRNA-ROR1-AS1 treated cells downregulated ROR1-AS1 expression in 5637 cells. ROR1-AS1 knockdown obviously suppressed 5637 cell proliferation and migration. Data from at least three independent experiments, shown as the mean ± SD. *p < 0.05.

The effects of ROR1-AS1 knockdown on bladder cancer cells proliferation and migration.

(A) The T24 cells were transfected with shRNA-ROR1-AS1 or shRNA-NC, and ROR1-AS1 expression levels were analyzed by RT-qPCR after 48 h transfection. 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) and wound scratch assays were applied to determine T24 cells growth and migration in vitro. (B) shRNA-ROR1-AS1 treated cells downregulated ROR1-AS1 expression in 5637 cells. ROR1-AS1 knockdown obviously suppressed 5637 cell proliferation and migration. Data from at least three independent experiments, shown as the mean ± SD. *p < 0.05.

ROR1-AS1 acts as a molecular sponge to decrease miR-504 expression

Using bioinformatics software starBase 2.0, we found that ROR1-AS1 contained a binding sites for miR-504 sequence. RT-qPCR found that miR-504 was markedly downregulated in bladder cancer tissues than matched normal bladder tissues (Fig 4A, p<0.05). Pearson’s correlation analysis showed that miR-504 expression was negatively correlated with ROR1-AS1 expression in bladder cancer samples (Fig 4B, p<0.05). The potential binding sites for miR-504, ROR1-AS1-WT and ROR1-AS1-MUT were constructed in luciferase reporter gene vectors (Fig 4C). Results showed that transfection of miR-504 inhibitor in T24 and 5637 cells significantly suppressed miR-504 expression (Fig 4D, p<0.05). Knockdown of miR-504 increased the luciferase activity of ROR1-AS1-WT vector, but not ROR1-AS1-MUT vector in T24 and 5637 cells (Fig 4E, p<0.05). Transfection of shRNA-ROR1-AS1 into bladder cancer cells showed upregulation of miR-504 expression, but co-transfection with shRNA-ROR1-AS1 and miR-504 inhibitor reversed these effects (Fig 4F, p<0.05). These findings indicated that ROR1-AS1 bind with miR-504 and acts as a molecular sponge to decrease miR-504 expression.
Fig 4

The regulatory effects of ROR1-AS1 on miR-504.

(A) RT-qPCR analysis of miR-504 expression in 65 cases of bladder cancer samples. (B) The correlation of miR-504 and ROR1-AS1 expression in bladder cancer samples was evaluated by Pearson’s correlation analysis. (C) Sequences of ROR1-AS1 binding sites within the miR-504. (D) The miR-504 expression in T24 and 5637 cells was detected by RT-qPCR after transfection with miR-504 inhibitor or inhibitor NC. (E) Luciferase assay was measured 24 h post transfection in bladder cancer cells, which were co-transfected with ROR1-AS1-WT and ROR1-AS1-MUT vectors, together with miR-504 inhibitor or inhibitor NC. (F) Transfection of shRNA-ROR1-AS1 into bladder cancer cells showed upregulation of miR-504 expression, but co-transfection with shRNA-ROR1-AS1 and miR-504 inhibitor reversed these effects. Data were presented as the mean ± SD (n = 3). *p < 0.05.

The regulatory effects of ROR1-AS1 on miR-504.

(A) RT-qPCR analysis of miR-504 expression in 65 cases of bladder cancer samples. (B) The correlation of miR-504 and ROR1-AS1 expression in bladder cancer samples was evaluated by Pearson’s correlation analysis. (C) Sequences of ROR1-AS1 binding sites within the miR-504. (D) The miR-504 expression in T24 and 5637 cells was detected by RT-qPCR after transfection with miR-504 inhibitor or inhibitor NC. (E) Luciferase assay was measured 24 h post transfection in bladder cancer cells, which were co-transfected with ROR1-AS1-WT and ROR1-AS1-MUT vectors, together with miR-504 inhibitor or inhibitor NC. (F) Transfection of shRNA-ROR1-AS1 into bladder cancer cells showed upregulation of miR-504 expression, but co-transfection with shRNA-ROR1-AS1 and miR-504 inhibitor reversed these effects. Data were presented as the mean ± SD (n = 3). *p < 0.05.

Inhibition of miR-504 partly abrogates ROR1-AS1 knockdown-induced inhibitory effects on bladder cancer cell growth and migration

Due to the negatively regulation of ROR1-AS1 on miR-504 in bladder cancer cells, we speculated that the role of ROR1-AS1 in regulating bladder cancer cell proliferation and migration was mediated by sponging miR-504 expression. We transfected miR-504 inhibitor or inhibitor NC into the shRNA-ROR1-AS1 treated T24 and 5637 cells, and functional rescue experiments were performed. Interesting, we found that ROR1-AS1 knockdown mediated inhibitory effects on bladder cancer cell proliferation and migration were partially reversed by co-transfection with shRNA-ROR1-AS1 and miR-504 inhibitor (Fig 5A and 5B, p<0.05).
Fig 5

ROR1-AS1 promotes bladder cancer cells proliferation and migration by sponging miR-504.

(A) MTT and wound scratch assays were applied to determine T24 cells growth and migration in vitro after co-transfection with shRNA-ROR1-AS1 and miR-504 inhibitor or inhibitor NC. (B) Transfection of miR-504 inhibitor partly abrogated ROR1-AS1 knockdown-induced inhibitory effects on 5637 cell growth and migration. Data were expressed as the mean ± SD (n = 3). *p < 0.05.

ROR1-AS1 promotes bladder cancer cells proliferation and migration by sponging miR-504.

(A) MTT and wound scratch assays were applied to determine T24 cells growth and migration in vitro after co-transfection with shRNA-ROR1-AS1 and miR-504 inhibitor or inhibitor NC. (B) Transfection of miR-504 inhibitor partly abrogated ROR1-AS1 knockdown-induced inhibitory effects on 5637 cell growth and migration. Data were expressed as the mean ± SD (n = 3). *p < 0.05.

Discussion

As an emerging hotspot in the investigation of human cancer, disregulation of lncRNAs in bladder cancer have been well studied. Some lncRNAs in bladder cancer can be utilized as potential therapeutic targets [23,24]. For example, Li et al [25] found that deleted in lymphocytic leukemia 1 is upregulated in bladder cancer tissues and patients with high DLEU1 expression exhibits a shorter survival time, and DLEU1 increases cell proliferation, invasion, and cisplatin resistance of bladder cancer cells. Miao et al [26] showed that long intergenic non-protein coding RNA 612 facilitates the proliferation and invasion capacity of bladder cancer cells, suggesting that the lncRNA may act as a potential biomarker and therapeutic target. Gao et al [27] revealed that ZEB1-AS1/miR-200b/FSCN1 axis may serve as a potential target for molecular therapies of bladder cancer. Though there are many researches focusing on the regulation of lncRNAs on bladder cancer, there are still some potential mechanism need to be explored. To the best of our knowledge, this is the first report to illustrate the role of ROR1-AS1 in bladder cancer. Moreover, we demonstrated that increased ROR1-AS1 promotes the proliferation and migration of bladder cancer by sponging miR-504, and suggesting ROR1-AS1 may be used as a prognostic biomarker and therapeutic target for bladder cancer treatment. Previous studies have indicated that antisense lncRNAs including those located antisense to cancer-related genes were participated in complicate and accurate gene-net of human cancers [28]. ROR1-AS1 is a novel antisense lncRNAs, which was first identified in mantle cell lymphoma, and could mediate tumor growth by histone modification through enhancer of zeste 2 polycomb repressive complex 2 subunit [17]. Recent studies have demonstrated that deregulation of ROR1-AS1 contributes to carcinogenesis. In colorectal cancer, Wang et al [29] found that ROR1-AS1 promotes cell metastasis and proliferation via inducing Wnt/β-catenin signaling pathway. However, the function and molecular mechanism of ROR1-AS1 in bladder cancer are largely unknown until now. In this study, we identified that ROR1-AS1 expression was increased in bladder cancer tissues and cell lines. Furthermore, the high ROR1-AS1 expression levels were closely correlated with higher histological grade, advanced tumor stage, and positive lymph node metastasis in patients with bladder cancer, indicating that upregulation of ROR1-AS1 represents an aggressive phenotypes of bladder cancer. More importantly, series of functional experiments further showed that knockdown of ROR1-AS1 expression inhibited cell growth and migration of bladder cancer cells in vitro. These results are consistent with prior reports suggesting a oncogenic role of ROR1-AS1 in the progression of bladder cancer. A better understanding of the mechanisms underlying the pathogenesis of bladder cancer is key for improvement of anticancer therapy. Increasing evidence has exhibited that lncRNAs compete for miRNAs response elements (MREs) with the driver genes strongly relevant to tumor progression by acting as a ceRNA [30]. To further identify the potential mechanism of ROR1-AS1 affects bladder cancer cell proliferation and migration, we predicted and chose miR-504 as a potential sponge of ROR1-AS1 using bioinformatic analysis. Recently, investigations demonstrated the tumor-suppressive role of miR-504 in hypopharyngeal squamous cell carcinoma and liver cancer [31,32]. Additional, Ye et al [33] showed that miR-504 is downregulated in non-small cell lung cancer tissues and can inhibit cell proliferation, invasion, and epithelial-mesenchymal transition by targeting lysyl oxidase like 2 expression. Similarly, Liu et al [34] found that miR-504 represses mesenchymal phenotype of glioblastoma by directly targeting the frizzled class receptor 7-mediated Wnt-β-catenin signaling pathway. However, role of miR-504 in bladder cancer is still unknown. In the present study, we first identified the relationship between miR-504 and ROR1-AS1 in bladder cancer samples. Results revealed that miR-504 expression was downregulated and negatively correlated with ROR1-AS1 expression. Moreover, luciferase reporter gene assay demonstrated that ROR1-AS1 acts as a molecular sponge to decrease miR-504 expression. Functional rescue experiments confirmed that ROR1-AS1 promotes cell growth and migration of bladder cancer via regulation of miR-504. Consistent with previous findings, we have validated that downregulated miR-504 acts as a tumor suppressor in bladder cancer. In conclusion, our data suggested that upregulation of ROR1-AS1 promotes bladder cancer cells proliferation and migration by regulating miR-504. Our findings contribute to a better understanding of the importance of ROR1-AS1/miR-504 axis in bladder cancer progression, and provide a promising of lncRNA-based targeted approach for bladder cancer treatment. Further researches should also be conducted to illustrate the detailed molecular mechanism of ROR1-AS1 in other urinary tumors. 13 Dec 2019 PONE-D-19-31968 Upregulation of Long Non-Coding RNA ROR1-AS1 Promotes Cell Growth and Migration in Bladder Cancer by Regulation of MiR-504 PLOS ONE Dear Mr Chen, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We would appreciate receiving your revised manuscript by Jan 27 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Wen-Jun Tu Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. We noticed you have some minor occurrence(s) of overlapping text with the following previous publication(s), which needs to be addressed: https://doi.org/10.1016/j.canlet.2016.01.051 https://doi.org/10.18632/oncotarget.17956 In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the Methods section. Further consideration is dependent on these concerns being addressed. 3. In the ethics statement in the manuscript and in the online submission form, please provide additional information about the patient samples used in your retrospective study, including the date range (month and year) during which patients' samples were accessed by the authors. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Whether the RT-qPCR experiment was repeated 3 times? the author needs to indicate in the method. 2.The sequences of shRNA-ROR1-AS1, shRNA-NC, miR-504 inhibitor and inhibitor NC should be added in the method. 3.The reason for choosing T24 and 5637 for functional assays, why not used J82, 253J and RT4 4.The scale bar should added in the images of wound scratch assay. 5.In discussion, they should discuss the role of ROR1-AS1 in other cancers and summarize them. 6.LncRNAs is very basic and information about the classification criteria is lacking. Therefore, it is suggested to mention and to add the corresponding references. 7.Please specifiy de size range of tissues used for RNA extraction. 8.There are some grammatical and wording errors in the paper. It is recommended that professionals revise it. Reviewer #2: Increasing evidences showed that multiple long non-coding RNAs (lncRNAs) act crucial regulatory functions in the pathogenesis of bladder cancer. This study aimed to determine the expression and clinical significance of ROR1 antisense RNA (ROR1-AS1) from patients with bladder cancer, and to identify the potential role and mechanism underlying ROR1-AS1-related cancer progression. The results showed that increased ROR1-AS1 promotes cell growth and migration of bladder cancer via regulation of miR-504, and ROR1-AS1 may be used as a prognostic biomarker and therapeutic target for bladder cancer. This study is interesting and clinically relevant, however there are a number of grammatical errors and issues regarding data collection that should be addressed. Comments 1. The grammar needs to be edited throughout. 2. The introduction section, the aim of this study and more detailed research background should be presented. 3. “This research was approved by the Ethics Committee of the First Affiliated Hospital of Nanchang University’ the approval no should be present. 4. How many patients and bladder tissues were collected? 5. Human bladder tissue and tumor-adjacent normal bladder tissues were matched? Matched what? 6. Discussion: should be focused on the own results, It is written general and seems to be vague. 7. Kaplan-Meier survival analysis was used in the results section, please showed it in the method section. 8. Figure 2. Comments and headings should be in the same direction. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 16 Dec 2019 Dear editor, Thank you very much for your attention and the referees’ valuable comments on our manuscript. We have revised the manuscript according to reviewers' comments. Enclosed please find the revised manuscript, responses to the referees as well as a list of changes. We sincerely hope this manuscript will be finally acceptable to be published on PLOS ONE. We look forward to hearing from you soon. Best regard! Yours Sincerely, Qingke Chen, Department of Urology, First Affiliated Hospital of Nanchang University, No. 17, Yongwaizheng Street, Nanchang 330006, Jiangxi Province, China. Tel.: +86-0791-88692526, E-mail: cqkurethral@126.com. When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf Response: The revised manuscript has met PLOS ONE's style requirements. 2. We noticed you have some minor occurrence(s) of overlapping text with the following previous publication(s), which needs to be addressed: https://doi.org/10.1016/j.canlet.2016.01.051 https://doi.org/10.18632/oncotarget.17956 In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the Methods section. Further consideration is dependent on these concerns being addressed. Response: We have quoted and/or rephrased any duplicated texts of the above two article in the revised manuscript. 3. In the ethics statement in the manuscript and in the online submission form, please provide additional information about the patient samples used in your retrospective study, including the date range (month and year) during which patients' samples were accessed by the authors. Response: The date range in which human subjects’ data/samples were collected and the date(s) conducted this study have been added in the revised manuscript and online submission form. Comments to the Author Reviewer #1: 1: Whether the RT-qPCR experiment was repeated 3 times? the author needs to indicate in the method. Response: Thanks for your comment. The repeated 3 times for RT-qPCR has been added in the revised manuscript. Please see it in page 7, line 144-145. 2.The sequences of shRNA-ROR1-AS1, shRNA-NC, miR-504 inhibitor and inhibitor NC should be added in the method. Response: The sequences of shRNA-ROR1-AS1, shRNA-NC, miR-504 inhibitor and inhibitor NC have been added in the revised manuscript. Please see it in page 7, line 149-153. 3.The reason for choosing T24 and 5637 for functional assays, why not used J82, 253J and RT4. Response: The expression levels of ROR1-AS1 in T24 and 5637 cells were higher than that in the 253J and RT4 cells, and were chosen for further functional experiments. 4.The scale bar should added in the images of wound scratch assay. Response: The scale bars have been added in the revised Fig. 3 and Fig. 5. 5.In discussion, they should discuss the role of ROR1-AS1 in other cancers and summarize them. Response: Thanks for your kind advice. Just like your suggestion, the roles of ROR1-AS1 in colorectal cancer and mantle cell lymphoma have been summarized and added in the Discussion. Please see it in page 15, line 316-322. 6.LncRNAs is very basic and information about the classification criteria is lacking. Therefore, it is suggested to mention and to add the corresponding references. Response: The classification criteria for lncRNAs and the corresponding references have been added in Introduction. Please see it in page 4, line 72-74. 7.Please specifiy de size range of tissues used for RNA extraction. Response: Tissue RNA was extracted from tissues (size at 2 mm3) or cells (number at 2 × 106). Please see it in page 6, line 132. 8.There are some grammatical and wording errors in the paper. It is recommended that professionals revise it. Response: We sorry for the these errors in the original manuscript. The errors have been corrected with assistance from Elsevier Language Editing Services with appropriate research background. Reviewer #2: Increasing evidences showed that multiple long non-coding RNAs (lncRNAs) act crucial regulatory functions in the pathogenesis of bladder cancer. This study aimed to determine the expression and clinical significance of ROR1 antisense RNA (ROR1-AS1) from patients with bladder cancer, and to identify the potential role and mechanism underlying ROR1-AS1-related cancer progression. The results showed that increased ROR1-AS1 promotes cell growth and migration of bladder cancer via regulation of miR-504, and ROR1-AS1 may be used as a prognostic biomarker and therapeutic target for bladder cancer. This study is interesting and clinically relevant, however there are a number of grammatical errors and issues regarding data collection that should be addressed. Comments 1. The grammar needs to be edited throughout. Response: Thanks for your comment. We sorry for the these errors in the original manuscript. The errors have been corrected with assistance from Elsevier Language Editing Services with appropriate research background. 2. The introduction section, the aim of this study and more detailed research background should be presented. Response: The aim of this study and detailed research background have been added in the revised manuscript. Please see it in page 5, line 96-104. 3. “This research was approved by the Ethics Committee of the First Affiliated Hospital of Nanchang University’ the approval no should be present. Response: The approval no. (Approval No. 2018070) has been added in the revised manuscript. Please see it in page 5, line 109. 4. How many patients and bladder tissues were collected? Response: This retrospective study included 65 cases of bladder cancer patients who underwent surgery at Department of Urology, First Affiliated Hospital of Nanchang University between 09/2011 and 05/2017. 65 human bladder tissue and tumor-adjacent normal bladder tissues from all patients were collected between 09/2011 and 05/2017. Please see it in page 6, line 111-122. 5. Human bladder tissue and tumor-adjacent normal bladder tissues were matched? Matched what? Response: Yes. Tumor tissues matched normal tissues. 6. Discussion: should be focused on the own results, It is written general and seems to be vague. Response: This is an excellent advice. The Discussion has been revised according the comment. Please see it in Discussion. 7. Kaplan-Meier survival analysis was used in the results section, please showed it in the method section. Response: Kaplan-Meier survival analysis has been deleted in the Results section, and added in the Method section. Please see it in page 10, line 205-206. 8. Figure 2. Comments and headings should be in the same direction. Response: The Fig.2 has been revised according the suggestion. Submitted filename: Response to Reviewers.docx Click here for additional data file. 23 Dec 2019 Upregulation of Long Non-Coding RNA ROR1-AS1 Promotes Cell Growth and Migration in Bladder Cancer by Regulation of MiR-504 PONE-D-19-31968R1 Dear Dr. Chen, We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication. Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. With kind regards, Wen-Jun Tu Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The problems raised in a previous round were reviewed and corrected by the authors carefully. And the English language has be revised and corrected . As a result, I think the current revised manuscript is suitable for publication. Reviewer #2: The Authors had thoroughly revised the manuscript and addressed requested changes and improvements。 No further comments. Thanks ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No 30 Dec 2019 PONE-D-19-31968R1 Upregulation of Long Non-Coding RNA ROR1-AS1 Promotes Cell Growth and Migration in Bladder Cancer by Regulation of MiR-504 Dear Dr. Chen: I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. For any other questions or concerns, please email plosone@plos.org. Thank you for submitting your work to PLOS ONE. With kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Wen-Jun Tu Academic Editor PLOS ONE
  34 in total

Review 1.  Competing endogenous RNA (ceRNA) cross talk and language in ceRNA regulatory networks: A new look at hallmarks of breast cancer.

Authors:  Rasoul Abdollahzadeh; Abdolreza Daraei; Yaser Mansoori; Masoumeh Sepahvand; Mahsa M Amoli; Javad Tavakkoly-Bazzaz
Journal:  J Cell Physiol       Date:  2018-12-10       Impact factor: 6.384

2.  Long noncoding RNA SMAD5-AS1 acts as a microRNA-106a-5p sponge to promote epithelial mesenchymal transition in nasopharyngeal carcinoma.

Authors:  Ying-Juan Zheng; Jing-Yi Zhao; Tian-Song Liang; Ping Wang; Juan Wang; Dao-Ke Yang; Zhang-Suo Liu
Journal:  FASEB J       Date:  2019-09-26       Impact factor: 5.191

3.  Clinical reliability of the 2004 WHO histological classification system compared with the 1973 WHO system for Ta primary bladder tumors.

Authors:  Federico Pellucchi; Massimo Freschi; Buthaina Ibrahim; Lorenzo Rocchini; Carmen Maccagnano; Alberto Briganti; Patrizio Rigatti; Francesco Montorsi; Renzo Colombo
Journal:  J Urol       Date:  2011-10-22       Impact factor: 7.450

4.  Long non-coding RNA ROR1-AS1 enhances colorectal cancer metastasis by targeting miR-375.

Authors:  F-Z Wang; M-Q Zhang; L Zhang; M-C Zhang
Journal:  Eur Rev Med Pharmacol Sci       Date:  2019-08       Impact factor: 3.507

Review 5.  Long non-coding RNA expression in bladder cancer.

Authors:  Mohammad Taheri; Mir Davood Omrani; Soudeh Ghafouri-Fard
Journal:  Biophys Rev       Date:  2017-12-08

6.  MiR-504 inhibits cell proliferation and invasion by targeting LOXL2 in non small cell lung cancer.

Authors:  Ming-Fan Ye; Ji-Guang Zhang; Tian-Xing Guo; Xiao-Jie Pan
Journal:  Biomed Pharmacother       Date:  2017-12-14       Impact factor: 6.529

7.  ROR1-AS1 promotes tumorigenesis of colorectal cancer via targeting Wnt/β-catenin.

Authors:  T Liao; S-L-M Maierdan; C Lv
Journal:  Eur Rev Med Pharmacol Sci       Date:  2019-08       Impact factor: 3.507

Review 8.  Molecular and histopathology directed therapy for advanced bladder cancer.

Authors:  Constantine Alifrangis; Ursula McGovern; Alex Freeman; Thomas Powles; Mark Linch
Journal:  Nat Rev Urol       Date:  2019-07-09       Impact factor: 14.432

Review 9.  Emerging functional and mechanistic paradigms of mammalian long non-coding RNAs.

Authors:  Victoria A Moran; Ranjan J Perera; Ahmad M Khalil
Journal:  Nucleic Acids Res       Date:  2012-04-05       Impact factor: 16.971

10.  Long non-coding RNA ZEB1-AS1 regulates miR-200b/FSCN1 signaling and enhances migration and invasion induced by TGF-β1 in bladder cancer cells.

Authors:  Ruxu Gao; Naiwen Zhang; Jianyu Yang; Yuyan Zhu; Zhe Zhang; Jianfeng Wang; Xiaolong Xu; Zeliang Li; Xiankui Liu; Zhenhua Li; Jun Li; Chuize Kong; Jianbin Bi
Journal:  J Exp Clin Cancer Res       Date:  2019-03-01
View more
  6 in total

1.  Long Noncoding RNA CAR10 Contributes to Melanoma Progression By Suppressing miR-125b-5p to Induce RAB3D Expression.

Authors:  Jing Xie; Yanyan Zheng; Xiaomin Xu; Congcong Sun; Mingfen Lv
Journal:  Onco Targets Ther       Date:  2020-06-29       Impact factor: 4.147

2.  LncRNA ROR1-AS1 accelerates osteosarcoma invasion and proliferation through modulating miR-504.

Authors:  Xiangkun Wu; Lihua Yan; Yongxi Liu; Lilin Shang
Journal:  Aging (Albany NY)       Date:  2020-12-19       Impact factor: 5.682

Review 3.  Emerging Biomarkers for Predicting Bladder Cancer Lymph Node Metastasis.

Authors:  Chunyu Zhang; Jiao Hu; Huihuang Li; Hongzhi Ma; Belaydi Othmane; Wenbiao Ren; Zhenglin Yi; Dongxu Qiu; Zhenyu Ou; Jinbo Chen; Xiongbing Zu
Journal:  Front Oncol       Date:  2021-03-19       Impact factor: 6.244

4.  MicroRNA regulation of the proliferation and apoptosis of Leydig cells in diabetes.

Authors:  Li Hu; Shaochai Wei; Yuqi Wu; Shulin Li; Pei Zhu; Xiangwei Wang
Journal:  Mol Med       Date:  2021-09-08       Impact factor: 6.354

5.  Exosomal lncRNA ROR1-AS1 Derived from Tumor Cells Promotes Glioma Progression via Regulating miR-4686.

Authors:  Yang Chai; Hai-Tao Wu; Chuan-Dong Liang; Chun-Yue You; Ming-Xiang Xie; Shun-Wu Xiao
Journal:  Int J Nanomedicine       Date:  2020-11-10

6.  YY1-induced long non-coding RNA PSMA3 antisense RNA 1 functions as a competing endogenous RNA for microRNA 214-5p to expedite the viability and restrict the apoptosis of bladder cancer cells via regulating programmed cell death-ligand 1.

Authors:  Mingran Zhang; Yunfeng Xu; Shuai Yin; Feng Qiu
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.