Literature DB >> 31920269

Identification of Helicobacter pylori in Saliva of Patients with and without Gastritis by Polymerase Chain Reaction.

E V Soma Sekhar Goud1, Ranganathan Kannan2, Umadevi K Rao2, Elizabeth Joshua2, Rooban Tavaraja2, Yash Jain3.   

Abstract

AIMS AND
OBJECTIVE: The aim of this study was to identify the presence of Helicobacter pylori in saliva of patients with and without gastritis by polymerase chain reaction (PCR) method.
MATERIALS AND METHODS: The study comprised 20 patients in Group I presenting with various symptoms of gastritis and 10 asymptomatic subjects in Group II. The intestinal endoscopy antral biopsies were collected from 20 symptomatic patients with gastroduodenal disorders. The saliva specimens were taken from all patients before endoscopy. PCR was performed using genomic DNA, isolated from the saliva and the biopsies of the patients as the template to detect the presence of the 16S ribosomal RNA gene in H. pylori.
RESULTS: In Group I, 10 (50%) cases of clinical gastritis were positive for H. pylori by endoscopy biopsy and 10 (50%) were negative. Of the 10 endoscopy biopsy positive cases for H. pylori, eight were PCR positive in saliva and two were negative. Of the 10 endoscopy biopsy negative cases, three were PCR positive for H. pylori in saliva and seven were negative. In Groups II, four were symptomatic for gastritis and six were negative. Of the six gastritis negative cases, three were PCR positive, four were gastritis positive, and three were PCR positive. Sensitivity and specificity of PCR were found to be 80% and 70%, respectively. The positive predictive and negative predictive values of PCR in saliva were 72.7% and 77.7%, respectively.
CONCLUSION: PCR analysis of saliva may be handy in identification of H. pylori and serves as a noninvasive technique to diagnose and monitor the prognosis. Copyright:
© 2019 Journal of Pharmacy and Bioallied Sciences.

Entities:  

Keywords:  Endoscopy biopsy; Gastritis and 16s ribosomal RNA; Helicobacter Pylori

Year:  2019        PMID: 31920269      PMCID: PMC6896576          DOI: 10.4103/jpbs.JPBS_260_18

Source DB:  PubMed          Journal:  J Pharm Bioallied Sci        ISSN: 0975-7406


Introduction

Helicobacter pylori is a poly-flagellated, spiral, gram negative, microaerophilic, bacteria with 4–6 sheathed flagella.[1] Helicobacter pylori is often regarded as the main etiologic agent of the occurrence of gastritis,[2] peptic ulcer,[3] and gastric adenomas.[4] There is substantial evidence for invasion of H. pylori to underlying gastric mucosa and gastric lymph nodes,[5] thereby not limiting these organisms only for extracellular occurrence. The role of H. pylori in gastric cancers has been attributed to its direct virulence factors and also indirectly by initiation of chronic inflammation.[6] H. pylori exhibits extreme diversity in its prevalent species. More than hundred H. pylori species have been identified and predominant of those are found in gastric mucosa.[7] However, the presence of H. pylori is not a disease by itself, but a condition that affects the relative risk of developing various clinical disorders of the upper gastrointestinal tract.[8] It has been found that a close correlation exists between the level of acid secretion and the distribution of gastritis. This interaction is critical in the determination of outcomes of H. pylori infection. Approximately 95% of duodenal ulcers and 85% of gastric ulcers occur in the presence of H. pylori infection.[9] The gastric mucosa does not normally contain lymphoid tissue, but mucosa-associated lymphoid tissue (MALT) nearly always appears in response to colonization with H. pylori. In rare cases, a monoclonal population of B cells may arise from this tissue and slowly proliferate to form a MALT lymphoma. Numerous case-control studies, such as Song et al.[10] and Tiwari et al.,[11] have shown colonization of H. pylori in oral cavity prior to development of gastritis, whereas the other studies, Ho et al.[12] Ahmed et al.,[13] have shown contradictory findings with respect to H. pylori colonization prior to the development of gastritis, thereby questioning the transient infection of H. pylori to produce gastritis.[14] This perspective is further supported by temporarily bias hypothesis by Li et al.[15] relating H. pylori infection in childhood and their complete absence when atropy of gastric mucosa is established. Furthermore, the studies that evaluated the role of oral cavity as a reservoir for H. pylori has used various samples such as plaque, gingival crevicular fluid, and saliva as a possible agent to detect H. pylori, which has failed to produce statistically evident findings.[16] However, few studies have shown saliva as a possible tool for detection of H. pylori in oral cavity.[17] Hence, this study was conducted to evaluate the role of oral cavity as a reservoir for H. pylori using saliva-based polymerase chain reaction (PCR) as a diagnostic tool for the detection.

Material and Methods

A case-control study was performed on 30 subjects who constituted the study group. Group I comprised 20 subjects presenting with symptoms of gastrointestinal disorders attending the tertial referral center, such as Selvarangam Nursing Home and Sundaravadanam Nursing Home, for treatment of gastritis. However, Group II comprised 10 asymptomatic healthy subjects. In Group II, although all subjects were asymptomatic at the time of presentation, four of them had history of a previous diagnosis and treatment of gastritis. In Group I, the gastrointestinal endoscopic antral biopsy was performed on 20 symptomatic subjects using fiber-optic video gastro-endoscope under aseptic precautions. The gastric biopsy was fixed in 10% buffered formalin and processed and stained using modified Giemsa stain technique. Saliva samples were collected from each subject from both the groups in sterile graduated containers by spit technique for molecular diagnostic test before endoscopy in digestion buffer (100-mM sodium chloride, 10-mM Tris hydrochloride, 25-mM ethylenediaminetetraacetic acid, and 1% sodium dodecyl sulfate). The study was approved by the Institutional Review Board and written informed consent was obtained from all the participants.

Collection of Unstimulated Saliva

About 3-mL unstimulated saliva was collected from each subject by the spit technique between 7 am and 8 am in the study groups as described by Navazesh et al. (2008).[181920] At the beginning, the subjects were asked to swallow any saliva if present in the mouth. Then, the subjects were instructed to spit the saliva in the sterile graduated container every minute for about 10min.

Isolation of Genomic DNA from Saliva Specimen by Kit Method

The DNA extraction was performed using cetyl trimethylammonium bromide method. About 300-μL saliva was mixed with 900-μL Real Biotech Corporation (RBC) lysis buffer (three times the sample volume). The mixture was incubated at room temperature for 5min and centrifuged at 300rpm for 2min. The supernatant was discarded after centrifugation and the cell pellet was suspended. The cell lysis was performed by addition of 200 μL of GB buffer into the tube and mixed by vortexing. The mixture was incubated at room temperature for 10min to obtain clear sample lysate. The DNA binding was carried out by mixing sample lysate immediately with 200 μL of ethanol by vortexing for 10s. The entire mixture was then dropped into GD column placed in a 2-mL collecting tube and centrifuged at 13,000rpm. The entire mixture was washed sufficiently by introducing wash buffer for two times: 400-μL WB for first time and 600-μL WB for second time into the GD column and centrifuging at 13,000rpm for 30s and the flow through thus obtained was discarded. The GD column was again placed in a 2-mL collecting tube and centrifuged at 13,000rpm for 3min to obtain dry column matrix. This dried GD column was then transferred into a fresh 1.5-mL microcentrifuge tube for DNA elution. For this purpose, 100-μL elution buffer heated at 70ºC was added and allowed to stand for 3–5min to facilitate the sufficient absorption of elution buffer by absorbing matrix. Then, the total sample was centrifuged at 13,000rpm for 30s to elute the purified DNA. The DNA was stored at 4ºC until further use.

Molecular Characterization of H

The identification of H. pylori was performed by amplification of 16S ribosomal RNA (16S rRNA) using PCR from DNA samples isolated from salivary samples as described by Tiwari et al.[11] The reaction conditions for 16S rRNA gene amplification with both 16S rRNA primers (forward primer 5′–TAAGAGATCAGCCTATGTCC–3′ reverse primer 5′–TCCCACGCTTTAAGCGCAAT–3′ (Bangalore Genei Ltd., Bangalore, India) were optimized as 40 cycles with denaturation at 94°C for 30s, annealing at 56°C for 30s and synthesis at 72°C for 1min. The validation of the PCR was carried out using the positive and negative controls. The positive control contained the H. pylori DNA (ATCC 26695 strain) as the template, whereas the negative control contained the DNA mixture without the DNA template. The final PCR product was visualized after electrophoresis at 120 V on 2% agarose gel containing 15-μL ethidium bromide under ultraviolet light.

Molecular Determination of H

The samples were considered positive only if PCR amplified product had shown band at 534 base pairs.

Histopathological Processing and Staining of Gastric Biopsy Specimen

All the gastric biopsy specimens were fixed in 10% buffered formalin. The tissues were dehydrated using increasing grades of alcohol (70%, 80%, 90%, and 100%). Clearing of the samples was done using chloroform overnight. Impregnation in molten paraffin was for 2h with two changes and embedding in paraffin wax using “L”- moulds for sectioning and stained. A 4-μm thick tissue section from paraffin block was then obtained onto egg albumin-coated glass slides using semiautomatic microtome and then fixed by placing it on hot plate at 60ºC. The tissue section was then deparaffinized using two changes of xylene, hydrated using decreasing grades of alcohol (100%, 90%, 80%, and 70%), and washed in distilled water. The tissue sections were then stained using Giemsa stain (Novo special stain kit, ab150673, abcam company, USA). The tissue sections were then differentiated using 0.5% aqueous acetic acid and dehydrated using increasing grades of alcohol (70%, 80%, 90%, and 100%), and cleared using fresh xylene and mounted using dibutyl pthylate xylene.

Identification and Diagnostic Criteria of H Tissue Sections

Helicobacter pylori under Giemsa stain appears as purplish blue. However, the diagnosis of H. pylori in gastric biopsy positivity was made, if and only if there was a typical morphology of H. pylori as coma or S-shaped bacilli (2–4 μm long and 0.5–1 μ thick). The bacteria were only observed if at all it adhered to cell surfaces or lied free in mucosal layer with its typical morphology, with at least forming colonies. If they were found in isolation forms, these were considered negative. Like-wise the samples, which were not elucidated, were considered negative.

Results

In group I (n = 20) (clinical symptoms of gastritis patients), the formalin fixed paraffin embedded tissues sections of endoscopic biopsy specimens, showed H. pylori positivity under modified Giemsa stains in only 50%. The identification of H. pylori in saliva samples of the individuals in group I (n = 20) were made by amplification of 16S rRNA using PCR showed H. pylori positivity in only 55 % of the subjects with clinical symptoms of gastritis. Furthermore, H. pylori was not detected in saliva samples of 20% of subjects who showed H. pylori positivity histopathologically in tissue sections of endoscopic biopsy specimens. However, H. pylori was detected in saliva samples of 30% of subjects who histopathologically did not show H. pylori positivity in tissue section of endoscopic biopsy specimens. A chi-squared test was used to compare the H. pylori positivity in tissue sections with respect to the H. pylori positivity in salivary samples within Group I (n = 20) subjects showed a significant difference with a P value of 0.021 indicated in Table 1 and Graph 1.
Table 1

Comparison of Helicobacter pylori positivity in tissue sections and salivary samples in case groups using chi-squared test

Tissue sections Salivary samplesH. pylori positiveH. pylori negative
H. pylori positive80%30%
H. pylori negative20%70%
P-value0.02%

P < 0.05 is considered statistically significant

Graph 1

Relationship between the results of gastric biopsy and PCR detection of H. pylori in saliva

Comparison of Helicobacter pylori positivity in tissue sections and salivary samples in case groups using chi-squared test P < 0.05 is considered statistically significant Relationship between the results of gastric biopsy and PCR detection of H. pylori in saliva In Group II (n = 10) (healthy volunteers), H. pylori was positive in saliva samples of 60% healthy subjects, whereas H. pylori was negative in saliva samples of 40% healthy subjects. The chi-squared test was used to compare the findings between Groups I and II, and did not show any statistically significant difference between the findings of both groups (P = 0.79), as indicated in Table 2 and Graph 2. In addition, the study also determined the sensitivity and specificity of PCR as 80% and 70%, respectively, to detect H. pylori in salivary samples. These results suggest that the presence of H. pylori in oral cavity may not represent an active cause of gastritis.
Table 2

Comparison of Helicobacter pylori positivity in saliva samples between groups using chi-squared test

H. pylori saliva sample GroupsPositiveNegative
Group I (n = 20)55%45%
Group II (n = 10)60%40%
P-value0.79%

P < 0.005 is considered statistically significant

Graph 2

Distribution of Group II subjects based on gastritis symptoms and PCR reports

Comparison of Helicobacter pylori positivity in saliva samples between groups using chi-squared test P < 0.005 is considered statistically significant Distribution of Group II subjects based on gastritis symptoms and PCR reports

Statistical Analysis

The data were analyzed using Statistical Package for the Social Sciences software (SPSS), version 24, IBM, New York, USA. The chi-squared test was used to compare the findings within the case group (Group I) and between the case and control groups. The sensitivity and specificity of PCR were calculated as follows: Sensitivity = true positive / true positive + false negative Specificity = true negative / true negative + false positive.

Discussion

Marshall and Warren (1983)[21] identified a gram-negative spiral-shaped bacterium referred as H. pylori. These organisms colonize the gastric epithelium (common reservoir for H. pylori) and are responsible for occurrence of chronic gastritis, peptic ulcers, atrophic gastritis, intestinal metaplasia, gastric adenomas, gastric hyperplastic polyps, adenocarcinomas of the distal part of the stomach, and lymphomas of mucosa-associated lymphoid tissue. Therefore, World Health Organization has classified H. pylori as a class I carcinogen to humans, although the exact route of transmission of H. pylori into humans is still unknown. However, either fecal–oral route or oral–oral route describes a particular route for the transmission of H. pylori into humans. Furthermore, there is substantial evidence for both food- and water-borne transmission of H. pylori especially in developing countries. In recent times, H. pylori has been found in human oral cavity. The oral cavity has been implicated as a potential H. pylori reservoir. The nature of oral cavity, whether a permanent or transient reservoir of H. pylori, need to be addressed. Malık et al.[20] reported that histology, IHC, culture, RUT, serology, and urine test are some of conventional methods that are used to detect and diagnose H. pylori. These techniques lack a standard operating procedure that is uniformly applicable, particularly, for populations who are at risk. These techniques also come with serious limitations in terms of technique requiring invasive procedures, sample collection and transportation protocols involved, type of stains used for identification of H. pylori, and also ability and skills of pathologist to identify the organism. Furthermore, these techniques are also questioned for its reliability, sensitivity, and specificity. However, in a study by Medina et al.,[22] molecular techniques have shown promising results in identifying H. pylori and also predict the active infection, which is much required for clinical interpretation, making diagnosis as well as determining prognosis. The molecular techniques that use PCR have shown promising results in identifying H. pylori in gastric biopsy, saliva, and stool samples. However, earlier attempts to detect H. pylori by PCR from saliva and dental plaques have shown low rates of detection. Weiss et al. (1999)[23] in a comparative study of the sensitivity, specificity, and predictive value of PCR of formalin-fixed biopsies showed that the 16S rRNA gene of H. pylori has a high accuracy in identifying H. pylori in gastric biopsy specimens.

Summary of Key Findings

In this study, H. pylori was identified using 16S rRNA by PCR in the saliva samples of 56.66% (17 cases of 30) patients. Of the 20 subjects (Group I), 11 were with gastric symptoms, whereas six of the 10 subjects in Group II were with a history of gastric symptoms. These results indicate that the clinical symptoms of gastritis are not a reliable indicator of oral H. pylori status. In addition, in this study, successful amplification and detection of H. pylori directly from saliva samples in the majority of patients with gastritis indicates that approach is non-invasive, feasible, and reliable with a sensitivity of 80.0%, specificity of 77.7%, and a positive predictor value of 72.7%. This study also showed 30% of cases demonstrating H. pylori in saliva of 50% of patients who showed negative status of H. pylori in endoscopic gastric biopsy in Group I (cases proven with gastric symptoms). This 30% of salivary H. pylori positive cases within the individuals with gastric symptoms who showed negative status of H. pylori in endoscopic gastric biopsy may be due to production of biofilm matrix by H. pylori, which may cause embedding of H. pylori in their matrix that may would have interfered with staining of organisms leading to false negativity. However, this could not be confirmed as endoscopic gastric biopsy was not subjected to detection of H. pylori using16S rRNA by PCR. Furthermore, H. pylori were not identified in the saliva of 45% of the study population who had clinical symptoms or proven gastritis as evident from biopsy and history. However, H. pylori was also identified by PCR assay in saliva specimens from 60% control patients who had no history of gastritis. Therefore, this study suggests that oral cavity may act as initial site of infection for H. pylori. These organisms may persist as low numbers in the oral cavity of these subjects for a long time without colonizing the stomach or gastric lining. These findings are in agreement with those obtained by the studies of Tiwari et al.,[11] Ahmed et al., [13] and Mapstone et al.,[14] which leads us to hypothesize that the oral cavity could be a reservoir of H. pylori infection and oral secretion may be an important means of transmission of H. pylori. As the presence of H. pylori in saliva is comparable to the presence in gastric mucosa in our study, it can be concluded that its presence in saliva is a reliable marker of gastric mucosal immunity status. However, studies involving genotypic status of oral H. pylori and gastric H. pylori, if found similar, would prove oral cavity as a gate way of this infection and saliva as a means of transmission. Such studies have been carried out and none of them could prove that both of them are of the same strain. In contrast the similar strain was present in both sites, in an isolated study.

Strength and Limitations

In this study, the PCR method was used, which has sensitivity and specificity in detection of H. pylori than other methods.[24] The limitation of the study is the lack of the investigation of serotype similarity of H. pylori on saliva and gastric samples. Also, the control group comprised healthy individuals without any systemic diseases. Therefore, no biopsies were taken from them. Long-term follow-up of the individual’s oral health and additional insights and research on H. pylori involving the oral cavity could be pivotal for the future directions.[25]

Conclusion

This study has shown 16srRNA detection of H. pylori by PCR to be best mode for identification with at most reliability and validity in salivary samples. Thus, saliva could serve as an effective valuable, non-invasive specimen to diagnose or monitor the prognosis[26] as compared to existing diagnostic modalities. Molecular based diagnostic techniques such as PCR may be of significant value for non-cultureable samples of H. pylori involving prolonged transport or contaminated samples. However, future studies are very much necessary with larger sample size and better designs to evaluate genotypic status of oral H. pylori and gastric H. pylori to correlate and document the presented hypothesis.

Ethical policy and institutional review board statement

I testify on behalf of all co-authors that our article submitted to the Journal of Medical Microbiology. This manuscript has not been published in whole or in part elsewhere. The manuscript is not currently being considered for publication in another journal. The data procured were true and followed the standard protocols. No any animals were included in this research work.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.
  23 in total

1.  Recommended minimal standards for describing new species of the genus Helicobacter.

Authors:  F E Dewhirst; J G Fox; S L On
Journal:  Int J Syst Evol Microbiol       Date:  2000-11       Impact factor: 2.747

2.  Preparative and analytical purification of DNA from agarose.

Authors:  B Vogelstein; D Gillespie
Journal:  Proc Natl Acad Sci U S A       Date:  1979-02       Impact factor: 11.205

3.  Prevalence study to elucidate the transmission pathways of Helicobacter pylori at oral and gastroduodenal sites of a South Indian population.

Authors:  K S Ahmed; A A Khan; I Ahmed; S K Tiwari; M A Habeeb; S M Ali; J D Ahi; Z Abid; A Alvi; M A Hussain; N Ahmed; C M Habibullah
Journal:  Singapore Med J       Date:  2006-04       Impact factor: 1.858

Review 4.  Helicobacter pylori and extragastric diseases--other Helicobacters.

Authors:  Antonio Gasbarrini; Emilia Carloni; Giovanni Gasbarrini; Stephanie A Chisholm
Journal:  Helicobacter       Date:  2004       Impact factor: 5.753

5.  Iatrogenic Campylobacter pylori infection is a cause of epidemic achlorhydria.

Authors:  D Y Graham; L C Alpert; J L Smith; H H Yoshimura
Journal:  Am J Gastroenterol       Date:  1988-09       Impact factor: 10.864

6.  Sensitive detection of Helicobacter pylori by using polymerase chain reaction.

Authors:  C L Clayton; H Kleanthous; P J Coates; D D Morgan; S Tabaqchali
Journal:  J Clin Microbiol       Date:  1992-01       Impact factor: 5.948

7.  PCR detection of Helicobacter pylori in clinical samples.

Authors:  Emiko Rimbara; Masanori Sasatsu; David Y Graham
Journal:  Methods Mol Biol       Date:  2013

8.  Measuring salivary flow: challenges and opportunities.

Authors:  Mahvash Navazesh; Satish K S Kumar
Journal:  J Am Dent Assoc       Date:  2008-05       Impact factor: 3.634

9.  The investigation of Helicobacter pylori in the dental biofilm and saliva samples of children with dyspeptic complaints.

Authors:  Damla Aksit Bıcak; Serap Akyuz; Binnur Kıratlı; Merve Usta; Nafiye Urganci; Burcin Alev; Aysen Yarat; Fikrettin Sahin
Journal:  BMC Oral Health       Date:  2017-03-21       Impact factor: 2.757

10.  Detection of oral Helicobacter Pylori infection using saliva test cassette.

Authors:  Min Yu; Xue-Yan Zhang; Qing Yu
Journal:  Pak J Med Sci       Date:  2015 Sep-Oct       Impact factor: 1.088

View more
  2 in total

Review 1.  Helicobacter pylori Infection, Its Laboratory Diagnosis, and Antimicrobial Resistance: a Perspective of Clinical Relevance.

Authors:  Shamshul Ansari; Yoshio Yamaoka
Journal:  Clin Microbiol Rev       Date:  2022-04-11       Impact factor: 50.129

2.  Intracellular Presence of Helicobacter pylori and Its Virulence-Associated Genotypes within the Vaginal Yeast of Term Pregnant Women.

Authors:  Kimberly Sánchez-Alonzo; Lillian Matamala-Valdés; Cristian Parra-Sepúlveda; Humberto Bernasconi; Víctor L Campos; Carlos T Smith; Katia Sáez; Apolinaria García-Cancino
Journal:  Microorganisms       Date:  2021-01-08
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.