APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression.

Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like (APOBEC) DNA cytosine deaminase 3B (A3B) is a DNA editing enzyme which induces genomic DNA mutations in multiple myeloma and in various other cancers. APOBEC family proteins are highly homologous so it is especially difficult to investigate the biology of specifically A3B in cancer cells. To easily and comprehensively investigate A3B function in myeloma cells, we used CRISPR/Cas9 to generate A3B reporter cells that contain 3×FLAG tag and IRES-EGFP sequences integrated at the end of the A3B gene. These reporter cells stably express 3xFLAG tagged A3B and the reporter EGFP and this expression is enhanced by known stimuli, such as PMA. Conversely, shRNA knockdown of A3B decreased EGFP fluorescence and 3xFLAG tagged A3B protein levels. We screened a series of anticancer treatments using these cell lines and identified that most conventional therapies, such as antimetabolites or radiation, exacerbated endogenous A3B expression, but recent molecular targeted therapeutics, including bortezomib, lenalidomide and elotuzumab, did not. Furthermore, chemical inhibition of ATM, ATR and DNA-PK suppressed EGFP expression upon treatment with antimetabolites. These results suggest that DNA damage triggers A3B expression through ATM, ATR and DNA-PK signaling.

Introduction

The apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like DNA cytosine deaminase 3 family (APOBEC3, A3) consists of seven proteins (A3A, A3B, A3C, A3D, A3F, A3G and A3H) that preferentially induce C to U mutations in single strand DNA. A3 proteins were originally identified as factors of the innate immunity due to their mutagenic activity on viral genomes, and have recently joined the growing list of key intrinsic mutagens that play a part in oncogenesis [1]. Evidence for A3 mutagenicity consists of the presence of their mutational signature in cancer genomes [2], the effects observed when overexpressed in tumor tissues [3, 4], as well as the correlation of APOBEC signature mutations with poor prognosis [5, 6]. Nevertheless, the precise biology of each APOBEC3 protein in cancer cells remains unknown. Due to the high structural homology of APOBEC3 family members, it is particularly difficult to obtain high-affinity- and high-specificity- antibodies against each APOBEC3 protein, which limits our capability to distinguish the precise role of each endogenous APOBEC3 during tumorigenesis.

Among APOBEC3s, we previously reported that endogenous A3B is overexpressed and seems to be the main source of deamination activity in most of the myeloma cell lines we examined [7]. Notably, high levels of A3B expression in tumor cells were an independent risk factor for the overall survival of myeloma patients [7] as well as of other cancer patients [8-11]. However, the regulatory mechanisms that mediate A3B expression have not been well studied. To date, molecules including cell cycle pathway [12] and DNA damage response (DDR) [13, 14] factors and several transcription factors such as human papillomavirus E6/E7 [15, 16], NF-κB [17, 18], c-Maf [5] and B-Myb [19] were reported to enhance A3B expression. Nevertheless, how these factors mediate A3B expression and how A3B contributes to tumor progression and/or acquisition of chemoresistance in myeloma cells remains unclear. To investigate A3B-associated myeloma biology, we used the CRISPR/Cas9 system to introduce the 3×FLAG tag and the IRES–EGFP gene at the beginning of the 3’ UTR of the A3B gene in three human myeloma cell lines. We utilized this reporter cell lines to screen for how A3B expression is affected by anticancer treatments. Overall, we found these reporter cell lines to be very useful for the comprehensive analysis of A3B biology.

Materials and methods

Human cell lines and culture

Three human myeloma cell lines, U266, RPMI8226 and AMO1 cells were maintained in RPMI1640 (Nacalai) containing 10% FBS and 1% PSG (Invitrogen). HEK293T and Lenti-X cells were maintained in DMEM (Nacalai) containing 10% FBS and 1% PSG (Invitrogen).

sgRNA design and construction of A3B reporter donor DNA

To design the single-guide RNA (sgRNA), the mRNA sequence of APOBEC3B (APOBEC3B Homo sapiens chromosome 22, GRCh38 Primary Assembly mRNA variant1, Fig 1A) was imported into CRISPRdirect [20]. After a target site was determined, annealed oligos (S1 Table) were inserted into pSpCas9(BB)–2A–Puro (PX459) V2.0 (Addgene, #62988) using the BbsI (New England Biolabs) cloning site, or into lentiCRISPR ver.2 (Addgene, #52961) using the BsmBI (New England Biolabs) cloning site as previously described [21, 22]. For the construction of the donor DNA vector (Fig 1B), the right homology arm, the modified cassette including the 3×FLAG–IRES–EGFP gene and the left homology arm were PCR-amplified using KOD FX Neo (ToYoBo). Each PCR primer pair contained around 15 bp overlaps. All the amplicons were cloned into the lentiviral plasmid pCSII–CMV–MCS (RIKEN, RDB04377) by using the In-Fusion HD Cloning Kit (TaKaRa), to produce the pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid (Fig 1C).

Fig 1

Schema of APOBEC3B editing strategy.

(A) Schema of A3B mRNA structure. Triangles indicate highly-specific sgRNA target sites within A3B. Each arrow represents an exon (Ex). Areas in light gray show UTRs, those in dark gray show coding sequence regions (CDRs), and those in blue show catalytic domains. A3B mRNA isoforms (arrows in orange) as well as shA3B target sites (rectangles in yellow) are also indicated. (B) Schema of A3B in the host genome and in the donor DNA template. The donor DNA template contains six silent mutations in the sgRNA #4 target site, and intron 7 was removed. The 3×FLAG–IRES–EGFP sequence was inserted adjacent to the beginning of 3’ UTR. (C) Schema of donor DNA plasmid, pCSII–CMV:A3B–3×FLAG–IRES–EGFP.

Validation of sgRNA targeting efficiency

293T cells were transfected with pSpCas9(BB)–2A–Puro:sgRNA #4 (0.5 μg) using the FuGENE HD Transfection Reagent (Promega). Two days after transfection, 293T cells were harvested and their genomic DNA extracted using the QuickGene DNA whole blood kit S (KURABO). The targeted region was PCR-amplified from genomic DNA using the targeting test primers (S1 Table). The PCR products (200 ng) were denatured and then re-annealed to form heteroduplex DNA. The hybridized DNA was digested with T7 endonuclease I (T7E1, New England Biolabs), and run on 2% agarose gel. Mutation frequency was calculated based on band intensity, using Image J software, as previously described [23].

Generation of A3B reporter cell lines

For the U266 and AMO1 cell lines, 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)–2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R, program X-001. For the RPMI8226 cell line, 5 × 106 cells were transduced with lentiCRISPR ver.2:sgRNA #4 viruses and pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA viruses, simultaneously. These lentiviruses were produced by co-transfection of the packaging plasmid pVSVg (Addgene, #8454), psPAX2-D64V (Addgene, #63586) and lentiCRISPR ver.2:sgRNA #4 plasmid, or pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid, into Lenti-X cells.

Flow cytometry analysis

Myeloma cells were stained with DRAQ7 (Biostatus) to mark dead cells, then were read on BD FACS Calibur or BD FACS Lyric (Becton-Dickinson Biosciences). To isolate A3B reporter cell lines, EGFP positive cells were sorted using a FACS Aria III cell sorter (Becton-Dickinson Biosciences) at seven days after transfection or transduction. The data was analyzed using the software FCSalyzer ver. 0.9.15-alpha. (https://sourceforge.net/projects/fcsalyzer/).

Genotyping of A3B reporter single cell clones

Single cell clones were isolated from the sorted EGFP-positive cells of the three myeloma cell lines by limiting dilution. These clones were then PCR-genotyped using 2 pairs of the target confirmation primers, forward #a and reverse #b, and forward #c and reverse #b. To confirm the full sequence of A3B–3×FLAG–IRES–EGFP mRNA from the established cell line, complementary DNA (cDNA) was synthesized as described below, and was PCR-amplified by KOD FX Neo (ToYoBo) using a pair of primers, forward #d and reverse #e. The PCR products were sequenced using the 3130xl Genetic Analyzer (Applied Biosystems). All primers for PCR are listed in S1 Table.

Immunoblot analysis

Whole cell lysates from 5.0 × 106 cells, prepared using an SDS-based buffer (5 mM EDTA, 1% SDS) supplemented with Protease inhibitor cocktail (Roche) and PhosSTOP EASY (Roche), were mixed with an equal volume of twofold concentrated sample buffer (Bio-Rad Laboratories) containing β-mercaptoethanol (Nacalai Tesque), and were treated for 5 min at 100°C. Immunoblot analysis was performed as described previously using a mouse anti-FLAG antibody (Millipore, clone JBW301) or a mouse anti-α-tubulin monoclonal antibody (AA13, Funakoshi).

Immunofluorescence assays

Cells were air-dried and fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 20 minutes on glass slides using Shandon cytospin 2 (THERMO FISHER SCIENTIFIC). Fixed cells were permeabilized, reduced and denatured for 30 minutes in PBS buffer containing 0.5% SDS, 5% β-mercaptoethanol and 10% FBS. Then, cells were washed three times with PBS containing 4% FBS and 0.1% Triton X-100 (PFT buffer) [24], and incubated with a purified mouse anti-FLAG antibody for 1 hour. Subsequently, cells were incubated with a goat anti-mouse IgG (H+L)-Alexa Flour® 594 preadsorbed antibody (Abcam, ab150120) for 30 min in the dark. All antibodies were diluted with 3% BSA and 0.5% Tween in PBS. Then, the cells were stained with DAPI and were observed with a confocal laser scanning microscope (TCS-SP8, Leica).

Knockdown experiments

We constructed pSicoR-mCherry lentiviral vectors [25] expressing short-hairpin RNA (shRNA) against A3B by inserting synthetic double-stranded oligonucleotides, as previously described [7] (TRCN0000140546 [26], sense oligo, 5’-TGCAAAGCAATGTGCTCCTGATCTCGAGATCAGGAGCACATTGCTTTGCTTTTTTC-3’, and antisense oligo, 5’-TCGAGAAAAAAGCAAAGCAATGTGCTCCTGATCTCGAGATCAGGAGCACATTGCTTTGCA-3’; TRCN0000139463, sense oligo, 5’-TCCTGATGGATCCAGACACATTCTCGAGAATGTGTCTGGATCCATCAGGTTTTTTC-3’, and antisense oligo, 5’-TCGAGAAAAAACCTGATGGATCCAGACACATTCTCGAGAATGTGTCTGGATCCATCAGGA-3’) into the cloning site. For non-target shRNA, we used two constructs that were cloned as scrambled sequences (control [27], sense oligo, 5’-TGTCAAGTCTCACTTGCGTCTTCAAGAGAGACGCAAGTGAGACTTGACTTTTTTC-3’, antisense oligo, 5’-TCGAGAAAAAAGTCAAGTCTCACTTGCGTCTCTCTTGAAGACGCAAGTGAGACTTGACA-3’; control-2 [28], sense oligo, 5’-TATCTCGCTTGGGCGAGAGTAAGCTCGAGCTTACTCTCGCCCAAGCGAGATTTTTTTC-3’, antisense oligo, 5’-TCGAGAAAAAAATCTCGCTTGGGCGAGAGTAAGCTCGAGCTTACTCTCGCCCAAGCGAGATA). The lentivirus was produced by co-transfection of Trans-Lentiviral packaging plasmid mix (GE Dharmacon) and pSicoR-mCherry into Lenti-X cells.

Quantitative RT-PCR

Total RNA was extracted from cell lines using the High Pure RNA isolation kit (Roche). cDNA was synthesized using the PrimeScriptR II 1st strand cDNA Synthesis Kit (Takara) by random primer and oligo dT primer mixture. Real-time PCR was performed using the Thunderbird SYBR qPCR Mix (ToYoBo). Target gene expression levels were normalized by endogenous expression levels of HPRT1. All primers for real-time PCR are listed in S1 Table.

Anticancer treatment screening

To examine the effects of chemotherapeutic agents on A3B expression, the A3B reporter cells were cultured for two days at a concentration of 2 × 105 cells/well/1.5 mL medium in 12-well plates and treated with phorbol 12-myristate 13-acetate (PMA, Sigma), melphalan (MEL, Wako), cisplatin (CDDP, Nihon-kayaku), mitomycin C (MMC, Funakoshi), N-desacetyl-N-methylocolchicine (COL, KaryoMAX Colcemid Solution in PBS, Thermo Fisher), camptothecin (CPT-11, TopoGEN), etoposide (VP-16, TREVIGEN), cytosine-1-B-D(+)-arabinofuranoside (Ara-C, Wako), gemcitabine hydrochloride (GEM, Sigma), hydroxyurea (HU, Tokyo chemical industry), aphidicolin (APH, Wako), bortezomib (BOR, Funakoshi), lenalidomide (LEN, Sigma), elotuzumab (ELO, Bristol-Myers Squibb), human IFN-α (Sumiferon, Dainippon Sumitomo Pharma) or olaparib (Funakoshi) at several concentrations as described in the main text. These chemotherapeutics were dissolved in 100% dimethyl sulfoxide (Nacalai Tesque) with the exception of COL, HU, ELO and INF-α which were dissolved in distilled water. To examine the effects of radiation or UV on A3B expression, the cells were exposed to gamma radiation using a Cs-137 Gamma Cell or to UVC using a FUNA UV Crosslinker, FS-800 (Funakoshi). To examine the effects of kinase inhibitors on A3B regulation, KU-55933 (Selleck), VE-821 (Selleck), NU-7026 (Selleck) or CGK733 (Calbiochem) were added 2 hours prior to antimetabolite treatment.

Statistical analysis

Mann-Whitney U test and Welch’s t test were calculated to evaluate the differences in continuous variables between two groups for quantitative RT-PCR results and flow cytometry results, respectively, by using the EZR software (version 3.0.2, Saitama Medical Center, Jichi Medical University) [29].

Results

CRISPR design

We first designed sgRNA candidates for target sites in A3B, excluding introns, using the web based tool, CRISPRdirect [20]. There are only four highly specific candidates for A3B (Fig 1A and S2 Table) mainly due to the high homology among APOBEC3 family genes. In order to insert the 3×FLAG sequence into A3B with a minimal off-target effect, we selected sgRNA #4 (Fig 1A). U266, RPMI8266 and AMO1 endogenously overexpress A3B [7]. We used the pSpCas9(BB)–2A–Puro plasmid and the lentiCRISPR ver.2 plasmid to transduce the CRISPR system that targets APOBEC3B loci in these cell lines. We also used a donor DNA template to introduce the 3×FLAG and IRES-EGFP reporter sequences at the end of the coding region and to move the stop codon behind the 3×FLAG sequence (Fig 1B and 1C). The 3×FLAG–IRES–EGFP cassette was located adjacent to the beginning of 3’ UTR, and intron 7 (281bp) was removed to prevent it from becoming the right homology arm. Usually, the PAM sequence (NGG) in the donor DNA template must be mutated to prevent cutting by Cas9, however, in our case, any mutation of PAM would lead to alteration of the A3B protein sequence. Instead, we designed six silent mutations within the target site to inhibit efficient future sgRNA binding: the host genomic target sequence of sgRNA #4, ‘ctgGGACACCTTTGTGTACCGCCAGGgat’, was altered to ‘ctgGGACAC, in the donor DNA template sequence. Finally, the complete donor DNA template sequence was inserted into the pCSII–CMV–MCS plasmid in the opposite direction of the CMV promoter of the parental vector (Fig 1C), so that cells in which the donor DNA vector is present merely transiently would not express EGFP and only cells which had their genome successfully engineered would emit EGFP fluorescent signals.

CRISPR guided 3×FLAG–IRES–EGFP insertion in A3B locus

To test the targeting efficiency of the sgRNA, we transfected the pSpCas9(BB)–2A–Puro:sgRNA #4 plasmid into 293T cells. The transfection efficiency was 15.2% (T7E1 assay, Fig 2A), therefore, we proceeded to co-transfect/co-transduce Cas9, the sgRNA #4 expressing vector and the donor DNA vector into U266, RPMI8226 and AMO1 cell lines. As expected, the efficiency of genome editing in myeloma cells was quite low, but we successfully enriched EGFP positive cells by cell sorting (Fig 2B). Single clones were isolated by limiting dilution from each cell line, expanded and A3B genotype was confirmed by PCR. Out of all the isolated clones, we selected the following four edited cell lines: U266A3B–3×FLAG–IRES–EGFP #1 and #2 (U266 KI #1 and #2), RPMI8226A3B–3×FLAG–IRES–EGFP (RPMI8226 KI), and AMO1A3B–3×FLAG–IRES–EGFP (AMO1 KI). According to the genotype PCR in Fig 2C, the A3B–3×FLAG–IRES–EGFP cassette was correctly integrated at the target site in these cell lines. Of note, both A3B alleles in U266 KI #2 were edited (Fig 2C). To confirm the mRNA sequence of A3B–3×FLAG–IRES–EGFP, we PCR-amplified the full length of the cDNA derived from each cell line (Fig 2D) and performed Sanger sequencing analysis. As desired, all the engineered cell lines possessed correct A3B–3×FLAG sequences, including the intended 6 silent mutations in the sgRNA target site and SNPs in the unmanipulated region (Fig 2E). According to flow cytometry analysis, the intensity of the fluorescent signal increased in the order of U266 KI #1, RPMI8226 KI and AMO1 KI, which is consistent with their A3B expression levels in a previous report [7]. U266 KI #2 exhibited around two times stronger fluorescence than U266 KI #1, indicating that the 3×FLAG–IRES–EGFP gene was integrated homozygously in U266 KI #2 and heterozygously in U266 KI #1. According to the results of flow cytometry and PCR-genotyping (Fig 2C), RPMI8226 KI and AMO1 KI contain a single allele of the 3×FLAG–IRES–EGFP gene. Immunoblot analysis also confirmed that all the cell lines produced A3B–3×FLAG proteins of the predicted size (Fig 2G). Immunofluorescent analysis of the subcellular localization of A3B–3×FLAG proteins showed a dominant localization in the nucleoplasm (Fig 2H), which is identical with that of wild type A3B proteins [7].

Fig 2

Establishment of A3B–3×FLAG–IRES–EGFP knock-in myeloma cell lines.

(A) T7E1 assay of the sgRNA #4 site in 293T cells. Expected positions of uncleaved (606 bp) and cleaved (532 bp and 74 bp) DNA bands by T7E1 are indicated with arrows. The mutation frequency is also shown. (B) Flow cytometry of U266, RPMI8226 and AMO1 cells after introducing the donor DNA vector along with the CRISPR-Cas9 vector. EGFP positive cells are highlighted in green and their proportions are indicated. (C) Genotyping PCR of genomic DNA from each clone derived from a single cell among the enriched cells in (B). Each clone was genotyped by two pairs of primers, Fw #a × Rv #b and Fw #c × Rv #b. Using the former primer pair, the expected size of the PCR amplicon is 2109 bp for the wild type allele, and 3225 bp for the knock-in allele. Using the latter primer pair, the PCR amplicon (2349 bp) can be detected only if the knock-in allele is present. (D) Genotyping PCR of cDNA from each clone in (C). The PCR amplicon (2401 bp) can be detected only if the knock-in allele is present. (E) Sanger sequencing results for the full length of the edited A3B cDNA originated from the clones of 3×FLAG–IRES–EGFP knock-in cell lines. Schema of the A3B–3×FLAG–IRES–EGFP mRNA structure is also depicted, the same as in Fig 1B. (F) Histograms of EGFP intensity values from the 3×FLAG–IRES–EGFP knock-in cell lines as determined by flow cytometry. (G) Immunoblot analysis of the 3×FLAG–IRES–EGFP knock-in cell lines. Lysates of untransduced HEK293 and A3B–3×FLAG overexpressing HEK293 were also blotted as negative and positive control, respectively. Arrows indicate non-specific bands. α-tubulin was evaluated as internal control. (H) Immunofluorescence analysis of the 3×FLAG–IRES–EGFP knock-in clones using an anti-FLAG antibody. For U226 KI, clone U266 KI #1 was examined. Images were obtained by confocal fluorescence microscopy (magnification, x630).

The established A3B–3×FLAG–IRES–EGFP knock-in cell lines work as A3B reporters

To verify the feasibility of the established cell lines as A3B reporters, we first transduced RPMI8226 KI and AMO KI cells with lentiviral shRNA against A3B together with an EF1α-driven mCherry fluorescent marker. When A3B mRNA was efficiently depleted (Fig 3A), A3B–3×FLAG protein levels decreased as expected (Fig 3B). Similarly, EGFP fluorescence intensity decreased in mCherry positive, shRNA transduced cells, compared with mCherry negative, shRNA non-transduced cells (Fig 3C–3F). Next, we treated U266 KI #1, RPMI8226 KI and AMO1 KI cells with PMA, a PKC activator, which is known to upregulate A3B expression via the NF-κB pathway [17, 18]. A quantitative RT-PCR analysis confirmed the enhancement of A3B mRNA levels for each cell line (Fig 3G). Consistently, immunoblot analysis detects increases of A3B–3×FLAG proteins (Fig 3H), and flow cytometry analysis detects peak shifts and increases of mean fluorescent intensity (MFI) for each cell line (Fig 3I and 3J). Based on the above results, we conclude that these established cell lines can be used as reliable A3B reporters.

Fig 3

A3B–3×FLAG–IRES–EGFP knock-in cells work as A3B reporters.

(A, B) Real-time PCR (A) and immunoblotting (B) of A3B in RPMI8226 KI cells and AMO1 KI cells, which were transduced with lentiviral shRNA against A3B (two constructs: shA3B or shA3B-2) or control (two constructs: control or control-2). HPRT1 or α-tubulin were evaluated as internal controls. Mann-Whitney U tests were used to compare the results between control and A3B knockdown samples: **P < 0.01; *P < 0.05. (C, D) Flow cytometry of RPMI8226 KI cells (C) and AMO1 KI cells (D) at 17 days after transduction with lentiviral shRNA against A3B or control. In the histogram representation, EGFP intensity was compared between mCherry positive cells (colored in red) and mCherry negative cells (colored in green). (E, F) Bar graph of EGFP mean fluorescence intensity (MFI) of the experiments in Figures (C, D). Mann-Whitney U tests were performed to compare the results between mCherry negative and mCherry positive samples: **P < 0.01; *P < 0.05. (G, H) Real-time PCR (G) and immunoblotting (H) of A3B in three A3B–3×FLAG–IRES–EGFP knock-in cell lines, which were treated with PMA (20 ng/mL) for 6 hours and 24 hours, respectively. Mann-Whitney U tests were performed to compare the results between control and PMA-treated samples: **P < 0.01. (I) Representative result of EGFP intensity histogram of AMO1 KI cells, which were treated with PMA (20 ng/mL) for 2 days. (J) Bar graph of EGFP mean fluorescent intensity (MFI) of three A3B–3×FLAG–IRES–EGFP knock-in cell lines, which were treated with PMA (20 ng/mL) for 2 days. Mann-Whitney U tests were performed to compare the results between control and PMA-treated samples: **P < 0.01.

DDR upregulates A3B expression via all the DDR-PIKK pathways in myeloma cells

Because the established A3B reporter cell lines provide an easy way to evaluate the alteration of A3B expression by simply performing flow cytometry analysis, we investigated which of the current clinically approved myeloma treatments affect A3B expression. Interestingly, most conventional anticancer treatments which induce DNA interstrand cross-links (e.g., CDDP, MEL and MMC), microtubule inhibition (e.g.,COL), topoisomerase inhibition (e.g.,CPT-11 and VP-16), DNA synthesis inhibition (e.g., Ara-C, GEM, HU and aphidicolin) or DNA double-strand breaks (e.g., radiation), exacerbated endogenous A3B overexpression (Fig 4A and 4B). Treatment with olaparib alone, a Poly(ADP-ribose) polymerase (PARP) inhibitor, which is known to induce SSBs that are degraded to DSBs during replication [30], also enhanced A3B expression (Fig 4C). On the other hand, the proteasome inhibitor (i.e., BOR), the immunomodulatory drug (i.e., LEN), the non-agonistic antibody drug (i.e., ELO) and INF-α did not enhance A3B expression levels (Fig 4A). These results intimate that DNA toxic stimulation upregulates A3B expression through DDR and following activation of DDR associated phosphatidylinositol 3' kinase-related kinases (DDR-PIKKs) [31] including ataxia telangiectasia and Rad3-related (ATR), and ataxia telangiectasia-mutated (ATM), DNA-dependent protein kinase (DNA-PK). Chemical inhibition of DDR-PIKKs by VE-821 for ATR, or NU-7026 for DNA-PK, suppressed EGFP increase upon antimetabolite treatment (Fig 4D and 4E). Moreover, various combinations of PIKK inhibitors, including KU-55933, an ATM inhibitor, exhibited a synergistic effect of preventing A3B expression increase upon antimetabolite stimulation (Fig 4D and 4E). Notably, pretreatment with CGK733 alone, which was first reported as an ATM/ATR inhibitor [32], almost completely blocked the antimetabolite effect on A3B expression in the three cell lines (Fig 4F). These results suggest that all the DDR-PIKK pathways might be involved in A3B regulation in myeloma cells.

Fig 4

DNA damage response exacerbates A3B overexpression via the DDR-PIKK pathways in myeloma cells.

(A) A panel of EGFP mean fluorescent intensity (MFI) of three A3B–3×FLAG–IRES–EGFP knock-in cell lines with various anti-cancer treatment. A3B reporter cells were incubated for 2 days with each anti-cancer reagent at the concentrations indicated on the horizontal axis. For the UVC exposure experiment, A3B reporter cells were irradiated with a single dose at 2 days before flow cytometry analysis. Hash mark (#) represents unmeasurable state due to cytotoxicity. (B) Bar graph of EGFP MFI of AMO1 KI cells, which were exposed to a single dose of γ-ray at 2 days before flow cytometry analysis. (C) Bar graph of EGFP MFI of three A3B–3×FLAG–IRES–EGFP knock-in cell lines with olaparib treatment (10 μM) for 2 days. (D, E) Histograms (D) and bar graphs (E) of EGFP intensity values from AMO1 KI cells, which were co-treated with HU (1μM) and DDR-PIKK inhibitors: KU-55933, 5 μM; VE-821, 5 μM; NU-7026, 2 μM; CGK733, 5 μM. Cells were incubated with the reagents for 2 days and subsequently analyzed by flow cytometry. Mann-Whitney U tests were performed to compare the results between HU-treated and PIKK inhibitor-treated samples: **P < 0.01; *P < 0.05. (F) Bar graph of EGFP MFI of three A3B–3×FLAG–IRES–EGFP knock-in cell lines treated with an antimetabolite (Ara-C, 50 μM; GEM, 1 μM; HU, 1 μM) with or without CGK733 (5 μM) for 2 days. Mann-Whitney U tests were performed to compare the results between antimetabolite-treated and CGK733-treated sample: **P < 0.01.

Discussion

In the present report, we successfully established four A3B reporter cell lines derived from three human myeloma cell lines, U266, RPMI8226 and AMO1. These cell lines express EGFP proteins with attribution to A3B expression, regulated by the same transcriptional/posttranscriptional mechanisms due to identical promoter, 3’-UTR and 5’-UTR to A3B. Due to these particularities, these cell lines are a very useful tool for investigating A3B regulation in a high-throughput screening format by flow cytometry analysis, which will allow for the development of specific A3B suppressors. There are several similar reports of other gene-edited reporter cell lines used for comprehensively studying the transcriptional regulation of the targeted gene [33-37]. In the case of A3B, most previous reports have studied A3B protein function using exogenous overexpression by transient transfection in a limited number of cell lines including non-human cells [16, 26, 38–44], mainly due to the difficulty of obtaining specific anti-A3B antibodies. In contrast, the commercially available and certified anti-FLAG antibody can be used to explore the A3B protein in the established A3B reporter cell lines described here. That is to say, these cell lines have the potential to clarify natural protein-protein and/or DNA-protein interaction of A3B specifically, in tumor cells. In addition, the A3B reporter system can be integrated into other A3B-overexpressing cell lines by using the Cas9/sgRNA #4 expressing vector and pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA vector described here.

According to our pilot screening, most of the conventional anticancer treatments exacerbated A3B overexpression in myeloma cells (Fig 4A and 4B). These treatments seem to act through a common pathway: induction of DDR [45]. Specifically, HU, which inhibits the incorporation of nucleotides by interfering with the enzyme ribonucleotide reductase [46], and APH, which interferes with DNA replication by inhibiting DNA polymerases α, ε and δ [47], are both commonly used to induce replication fork stalling that leads to ATR/ATM activation. These antimetabolites are also known to induce DSBs [48, 49]. CPT-11 covalently stabilizes the topoisomerase I–DNA cleavage complex by inhibiting the ligation of SSBs [50], thereby increasing the number of SSBs and subsequent DSBs [51]. Meanwhile, VP-16 leads to increases in the levels of topoisomerase II–DNA covalent complexes resulting in the rapid induction of DSBs [52]. DNA interstrand cross-linkers form a number of adducts with DNA, and thereafter activate a wide variety of DNA repair pathways [53] such as nucleotide excision repair (NER) [54, 55], homology-directed repair (HDR) [56] and mismatch repair (MMR) [57]. DNA interstrand cross-links are also known to be sensed by non-histone chromosomal high-mobility group box proteins 1 and 2 (HMGB1 and HMGB2), which affect cell cycle events and subsequently induce apoptosis [58]. Colcemid also has the potential to induce DSBs [59, 60]. Although UV exposure dominantly produces cyclobutane pyrimidine dimers (CPDs) and 6–4 photoproducts (6-4PP) but not DSBs directly, it activates ATR by SSBs and ATM by DSBs in a NER-dependent manner [61]. On the other hand, bortezomib and lenalidomide did not enhance A3B overexpression (Fig 4A). We cannot exclude the possibility that these drugs can directly cause DSBs, however, there are few reports of DNA damage induced by a single treatment with bortezomib or lenalidomide.

The upregulation of A3B expression induced by DNA damage was suppressed by DDR-PIKK inhibitors, consistent with a previous report in breast cancer [13]. Under single-inhibition of each DDR-PIKK pathway, the DNA-PK inhibitor (NU-7026) suppressed A3B elevation the strongest. Kanu et al. reported that inhibiting ATR, and to a lesser extent ATM, reduced hydroxyurea-induced A3B activation, and concluded that DNA replication stress activates transcription of A3B via an ATR/Chk1-dependent pathway in breast cancer [13]. Thus, the dependency of A3B regulation on each DDR-PIKK pathway could vary among cancer cell types. On closer examination of the histograms in our study, EGFP signal curves from cells treated with NU-7026 had two peaks in contrast to those treated with VE-821 which had only one peak (Fig 4D), suggesting that DNA-PK inhibition completely blocked A3B upregulation in a certain population of cells, whereas ATR inhibition suppressed it in all cells. Considering the synergistic effects of the combinations of DDR-PIKK inhibitors in our study (Fig 4D and 4E), it seems that all the DDR-PIKK pathways are at least partly involved in A3B regulation in myeloma cells. This model is also supported by the redundancy between DDR-PIKK pathways under DNA replication stress [62]. Interestingly, A3B induction by DDR was almost completely blocked by treatment with CGK733 alone. CGK733 was initially reported to inhibit both ATM and ATR kinase activities, however, its specificity is now considered controversial [63, 64]. Nonetheless, there seems to be no doubt that CGK733 targets at least partly a downstream factor of the ATM/ATR pathway [65, 66]. HMGB1 and Cdc7 were identified as new target kinase candidates of CGK733 [67]. Of note, proteasome inhibitors were reported to suppress DDR by inhibiting phosphorylation of DDR-PIKKs [68, 69]. This suppression effect could explain why bortezomib did not exacerbate A3B expression.

We previously reported that shRNA against A3B decreased the basal level of γH2AX foci in myeloma cell lines, indicating that A3B induces constitutive DNA double-strand breaks, promoting DDR activation [7]. Therefore DDR-inducible treatments trigger a positive feedback loop for A3B expression, which may drive chemoresistant clone expansion during chemotherapy. To prevent disease progression and potentiate current therapy, conventional anticancer treatment coupled with a combination of DDR-PIKK inhibitors including a proteasome inhibitor might not only have a synergistic cytotoxicity for tumor cells but also suppress the production of chemoresistant clones.

Original membranes and gels.

(PDF)

Click here for additional data file.

List of oligos and thermal cycle conditions for genotyping PCR.

(XLSX)

Click here for additional data file.

sgRNA target candidates for A3B.

(XLSX)

Click here for additional data file.

9 Oct 2019

PONE-D-19-26273

APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression

PLOS ONE

Dear Dr. Takaori-Kondo,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Both reviewers raised minor but important points that should be addressed. These include both editorial and content points, requiring both textual and experimental revisions. Further, there was a small concern regarding grammar and statistical analysis. In addition, it was mentioned that only a single clone was analyzed. Additional clones would add significant value.

We would appreciate receiving your revised manuscript by Nov 23 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Robert W Sobol, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2.  PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

3. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

Additional Editor Comments (if provided):

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: I Don't Know

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression.

Authors use CRSPR technology to investigate the APOBEC3B protein. The methodology and diagram made the genetic engineering steps easy to follow for the reader. The authors show a good understanding of the CRISPR insertion protocol.

Minor points:

1. Line 215- Can the author clarify the sentence, “and intron 7 was removed to avoid partial gene

editing.”

2. Line 234- The authors ability to only produce one clone in the RPMI8226 and AMO1 lines confounds the data for the reader. It is unclear whether the differences are related to changes in the single cell clone or the gene editing. This is compounded further with both homozygous and heterozygous integrations in the cell lines.

3. Line 250- In the reviewers experience the FLAG protein is very easy to detect, yet in the presented work the bands seem rather faint and there is also FLAG signal in the WT cell lines. Can the author comment on this?

4. Figure 2H – U266 FLAG distribution is not particularly convincing. Can the author provide a better example?

5. Figure 3C and 3D, Line 259- EGFP fluorescent intensity

260- decreased in mCherry positive, shRNA transduced cells, compared with mCherry negative,

261- shRNA untransduced cells (Fig. 3C and 3D). Can the author present this data in a different way, it is not clear to the reviewer how large the difference really may be?

6. Line 291- “These results suggest that all the DDR related pathways are involved in A3B regulation in myeloma cells.” This has not been testing in the presented study, there are dozens of DDR pathways, using a few ATR/ATM inhibitors does not prove the above statement.

Various spelling mistakes through-out manuscript.

Major points:

1. There is a lack of meaningful statistical analysis on many of the graphs making it difficult to determine whether the results are significant, single experiments or biologically relevant.

Reviewer #2: The authors demonstrate the creation of CRISPR/Cas9 knock in of 3x FLAG tag and IRES-EGFP to the end of APOBEC3B gene in myeloma cell lines that they subsequently use as a reporter for chemotherapeutic treatments that induce APOBEC3B expression. Using this system they were able to identify inhibition of ATM, ATR and DNA-PK suppressed EGFP expression in response to antimetabolite treatments in several myeloma cell lines. This work is important to the understanding of APOBEC3B in myeloma and the findings support what is already known in breast cancer regarding APOBEC3B and ATM/ATR inhibition.

The methods are well described and the reporter system well characterized in the figures.

Major issues: none

Minor issues: Methods section: Statistical analysis described but not reported anywhere in the text, figures, or figure legends. Suggest adding this information prior to publication.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

28 Nov 2019

Response to the Reviewers:

We thank the reviewers for their useful comments and suggestions. We have addressed all the issues they outlined and revised the manuscript as detailed below. Changes in the manuscript are highlighted in red. We asked native English speakers in the lab to proofread the manuscript again, corrected typos and grammatical errors and made changes so that readers can easily follow the manuscript. We also added acknowledgements for plasmids and research funding that we forgot to mention in the original manuscript. We hope the reviewers find that our manuscript has much improved, is more robust, easier to read and suitable for publication in PLOS ONE.

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression.

Authors use CRSPR technology to investigate the APOBEC3B protein. The methodology and diagram made the genetic engineering steps easy to follow for the reader. The authors show a good understanding of the CRISPR insertion protocol.

Minor points:

1. Line 215- Can the author clarify the sentence, “and intron 7 was removed to avoid partial gene editing.”

We changed the sentence in Line 215 to “and intron 7 (281bp) was removed to prevent it from becoming the right homology arm”, because if the DNA repair after CRISPR cleavage happened using this region including intron 7 as right homology arm, only 6 silent mutations would be introduced and the reporter sequence could not be introduced.

2. Line 234- The authors ability to only produce one clone in the RPMI8226 and AMO1 lines confounds the data for the reader. It is unclear whether the differences are related to changes in the single cell clone or the gene editing. This is compounded further with both homozygous and heterozygous integrations in the cell lines.

We obtained multiple heterozygous clones for each cell line, and were fortunate to also find a clone in the U266 cell line that was homozygous for the edited A3B gene, so we decided to include it in our analysis. The two clones, U266 KI #1 and #2, exemplified how the GFP expression increases if both alleles are edited. To clarify this, we changed the lines 235-236 and 247.

3. Line 250- In the reviewers experience the FLAG protein is very easy to detect, yet in the presented work the bands seem rather faint and there is also FLAG signal in the WT cell lines. Can the author comment on this?

We added the immunoblots for A3B overexpressing 293T lysate as positive control and mock transfected 293T cell lysates as negative control in Fig 2G. We believe that the amount of the A3B protein overexpressed in myeloma cell lines was substantially small compared to that of A3B overexpressed in 293T by transfection of the A3B expressing plasmids. The extra band that the reviewer pointed out is a faint non-specific band that appears just below the A3B in myeloma cell lines and even in 293T cells. We put arrows for these non-specific bands in Fig. 2G.

4. Figure 2H – U266 FLAG distribution is not particularly convincing. Can the author provide a better example?

We replaced the immunofluorescent images for Fig 2H, U266 for a better example.

5. Figure 3C and 3D, Line 259- EGFP fluorescent intensity

260- decreased in mCherry positive, shRNA transduced cells, compared with mCherry negative,

261- shRNA untransduced cells (Fig. 3C and 3D). Can the author present this data in a different way, it is not clear to the reviewer how large the difference really may be?

We added bar graphs of MFI values with error bars in Figure 3E and 3F.

6. Line 291- “These results suggest that all the DDR related pathways are involved in A3B regulation in myeloma cells.” This has not been testing in the presented study, there are dozens of DDR pathways, using a few ATR/ATM inhibitors does not prove the above statement.

We revised the sentence “These results suggest that all the DDR-PIKK pathways might be involved in A3B regulation in myeloma cells” as the reviewer suggested.

Various spelling mistakes through-out manuscript.

We checked the manuscript again and corrected minor mistakes and spelling errors.

Major points:

1. There is a lack of meaningful statistical analysis on many of the graphs making it difficult to determine whether the results are significant, single experiments or biologically relevant.

We added indications of statistical significance in Figs 3 and 4 and described in legends in the manuscript.

Reviewer #2: The authors demonstrate the creation of CRISPR/Cas9 knock in of 3x FLAG tag and IRES-EGFP to the end of APOBEC3B gene in myeloma cell lines that they subsequently use as a reporter for chemotherapeutic treatments that induce APOBEC3B expression. Using this system they were able to identify inhibition of ATM, ATR and DNA-PK suppressed EGFP expression in response to antimetabolite treatments in several myeloma cell lines. This work is important to the understanding of APOBEC3B in myeloma and the findings support what is already known in breast cancer regarding APOBEC3B and ATM/ATR inhibition.

The methods are well described and the reporter system well characterized in the figures.

Major issues: none

Minor issues: Methods section: Statistical analysis described but not reported anywhere in the text, figures, or figure legends. Suggest adding this information prior to publication.

We added indications of statistical significance in Figs 3 and 4 and described in legends in the manuscript.

Submitted filename: Yamazaki et al., response to reviewers.docx

Click here for additional data file.

17 Dec 2019

APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression

PONE-D-19-26273R1

Dear Dr. Takaori-Kondo,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Robert W Sobol, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: (No Response)

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: (No Response)

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: (No Response)

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: (No Response)

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have address all comments sufficiently. This reviewer thanks the authors for taking the time to improve the manuscript.

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

23 Dec 2019

PONE-D-19-26273R1

APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression

Dear Dr. Takaori-Kondo:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Robert W Sobol

Academic Editor

PLOS ONE