Mitochondrial disorders arise from defects in nuclear genes encoding enzymes of oxidative metabolism. Mutations of metabolic enzymes in somatic tissues can cause cancers due to oncometabolite accumulation. Paraganglioma and pheochromocytoma are examples, whose etiology and therapy are complicated by the absence of representative cell lines or animal models. These tumors can be driven by loss of the tricarboxylic acid cycle enzyme succinate dehydrogenase. We exploit the relationship between succinate accumulation, hypoxic signaling, egg-laying behavior, and morphology in C. elegans to create genetic and pharmacological models of succinate dehydrogenase loss disorders. With optimization, these models may enable future high-throughput screening efforts.
Mitochondrial disorders arise from defects in nuclear genes encoding enzymes of oxidative metabolism. Mutations of metabolic enzymes in somatic tissues can cause cancers due to oncometabolite accumulation. Paraganglioma and pheochromocytoma are examples, whose etiology and therapy are complicated by the absence of representative cell lines or animal models. These tumors can be driven by loss of the tricarboxylic acid cycle enzyme succinate dehydrogenase. We exploit the relationship between succinate accumulation, hypoxic signaling, egg-laying behavior, and morphology in C. elegans to create genetic and pharmacological models of succinatedehydrogenase loss disorders. With optimization, these models may enable future high-throughput screening efforts.
Mitochondrial disorders can result from mutations affecting enzymes of oxidative metabolism [1-4]. Interestingly and surprisingly, some cancers are caused by gain-of-function or loss-of-function mutations of genes encoding metabolic enzymes in susceptible tissues [5]. For example, paraganglioma and pheochromocytoma (PPGL) are rare neuroendocrine tumors [6-8] that originate in the parasympathetic and sympathetic ganglia, are highly angiogenic, and may secrete catecholamines. Up to 30% of PPGL tumors are hereditary [9].All four subunits of the mitochondrial enzyme succinate dehydrogenase (SDH) have been identified as tumor suppressors in familial PPGL[10-13], with loss of heterozygosity accounting for tumorigenesis. The succinate accumulation hypothesis attributes tumorigenesis following SDH loss to an oncometabolite role for excess succinate [14]. Loss-of-function mutations of SDH subunits lead to dysfunctional complexes [15, 16]. The resulting TCA cycle dysfunction drives metabolic remodeling with dependence on glycolysis [17] and a profound accumulation of succinate as defective SDH cannot oxidize this dicarboxylic acid to fumarate. Excess succinate acts as a competitive inhibitor of enzymes belonging to the 2-ketoglutarate-dependent dioxygenase family. This family of iron-dependent enzymes, numbering more than 40 in humans [18], catalyzes oxidation reactions splitting molecular oxygen to incorporate one oxygen atom into the substrate with oxidative decarboxylation of co-substrate, 2-ketoglutarate, to form succinate [19].Since many enzymes belong to the 2-ketoglutarate-dependent dioxygenase family, there are many potential consequences of succinate accumulation upon SDH loss [20]. One susceptible enzyme of interest is HIF-α prolyl-hydroxylase (PHD), which participates in the oxygen sensing mechanism of animals. Under normoxic conditions, PHD hydroxylates HIF-α transcription factor subunits, marking the proteins for polyubiquitination by von Hippel-Lindau protein and eventual degradation by the proteasome [21]. Under hypoxic conditions, molecular oxygen is limiting so the PHD-catalyzed dioxygenase reaction slows and HIF-α subunits avoid degradation and translocate to the nucleus to interact with constitutively-expressed HIF-β. The resulting transcription factors activate genes driving angiogenesis and glycolysis to adapt to hypoxia. High levels of succinate inhibit PHD, creating a pseudohypoxic condition that is hypothesized to be tumorigenic in susceptible cell types [14]. It remains unknown how succinate poisoning of PHD and/or other 2-ketoglutarate-dependent dioxygenases drives tumorigenesis. In the absence of rodent models and SDH-loss PPGL cell lines, understanding the linkage between SDH loss and tumorigenesis is an urgent and unmet need.Our limited understanding of the mechanistic impact of SDH loss on cellular processes and tumorigenesis has thwarted PPGL therapeutic advances. We therefore sought to establish a C. elegans model embodying genetic and biochemical aspects of SDH-loss disorders including PPGL. The soil nematode C. elegans provides an inexpensive, easily-maintained, genetically-tractable model organism with a fully-sequenced genome [22, 23]. Moreover, fully 40% of genes known to be associated with human diseases have clear C. elegans orthologs. For example, while humans have three HIFα subunits (HIF-1α, HIF-2 α, and HIF-3α) encoded by three separate genes, C. elegans has only a single hif-1 α gene, facilitating conclusive genetic analysis [24]. In principle, changes in C. elegans phenotype or behavior associated with mutations related to SDH and HIF function could create models for high-throughput screening of compounds that suppress or exacerbate these characteristics in intact animals. Whole-animal suppression screens have the advantage of simultaneously monitoring efficacy and toxicity.Inspiration for a C. elegans model of the molecular changes associated with SDH-loss disorders such as PPGL came from the previous fascinating observation that mutation of egl-9(sa307), the C. elegans ortholog of humanPHD, unexpectedly causes increased egg retention in hermaphrodite worms [25]. In retrospect, it seems likely that oxygen-sensing in egg-laying behavior is adaptive, suppressing egg-laying in inhospitable environments. The egg-laying defect is HIF-1-dependent, as egl-9(sa307):hif-1(ia4) double mutants and hif-1(ia4) single mutants both exhibit normal egg laying behavior [26].Here we exploit HIF-1-dependent egg retention to create C. elegans models of SDH-loss human PPGL. We hypothesized that cellular changes impinging on the C. elegans HIF pathway should be revealed in the egg retention phenotype because, as noted, succinate accumulation upon SDH loss inhibits PHD activity. To investigate this, we utilized both genetic (cell-specific gene expression or knockdown) and pharmacological [treatment with dimethyloxalylglycine (DMOG), a cell-permeable succinate analog] approaches. Further, we report a novel image-based readout of worm morphology with the potential to monitor egg retention phenotypes more efficiently in drug screening. With further optimization, this work suggests a path toward future screening for non-toxic small molecules that suppress the egg retention phenotype caused by succinate inhibition of EGL-9. Such agents might function to therapeutically relieve succinate inhibition of 2-ketoglutarate-dependent dioxygenases in PPGL and other SDH-loss disorders.
Materials and methods
Strains and maintenance
Previously described C. elegans strains utilized in this study include N2, JT307 egl-9 (sa307), CB6088egl-9(sa307):hif-1(ia4), and ZG31 hif-1(ia4). These strains were obtained from the Caenorhabditis Genetics Center.C. elegans were grown and maintained on nematode growth media (NGM) agar seeded with E. coliOP50 at room temperature unless otherwise noted. Standard alkaline sodium hypochlorite treatment was used to establish synchronous populations of worms for egg counting and imaging studies. For egg counting studies, individual worms were placed in bleach droplets and eggs were counted after cuticle dissolution [27]. Media components were obtained from Sigma.
Generation of transgenic lines
The C. elegans Punc-31 promoter was used to drive expression of Hif transgenes or RNA interference constructs for SDH subunit knockdown, allowing these effects to be limited to neurons known to be important for egg-laying. DNA oligonucleotides were obtained from IDT. Punc-31 was amplified by PCR from C. elegans genomic DNA (forward primer sequence 5’-AACAACTTGGAAATGAAATACGAGAACTTAAACCATTAAA; reverse primer sequence 5’-GACCTGCAGGCATGCAAGCTGATGTTCCAAACGAAGACTG) and Gibson assembly was used to insert Punc-31 into HindIII-linearized pPD95_75. Following ligation and cloning, the resulting plasmid was linearized by BamHI cleavage 30 bp downstream from the Punc-31 insertion and egl-9(+) coding sequence that had been amplified by PCR from genomic DNA (forward primer sequence 5’- CCTGCAGGTCGACTCTAGAGCACATGACATGAGCAGTGCCCCAAATGA; reverse primer sequence 5’-CTTTGGCCAATCCCGGGGATCGATGTAATACTCTGGGTTTG) or hif-1(+) coding sequence that had been amplified by PCR from genomic DNA (forward primer sequence 5’-CCTGCAGGTCGACTCTAGAGATCAAGATGGAAGACAATCG; reverse primer sequence 5’- CTTTGGCCAATCCCGGGGATCAGAGAGCATTGGAAATGGGG) was inserted using a second round of Gibson assembly. Constructs jhuEx[Punc-31::EGL-9] and jhuEx[Punc-31::HIF-1] were co-injected into adult hermaphrodite egl-9(sa307) and egl-9(sa307):hif-1(ia4) worms, respectively, along with plasmid pRF4 encoding a mutant collagen (rol-6(su1006)) that induces a dominant "roller" phenotype [28, 29]. Importantly, in preliminary experiments it was demonstrated that the rol-6 marker does not affect egg-laying behavior or egg retention.Punc-31 was amplified by PCR with using a different set pair of primers (forward primer sequence 5’- ATGACCATGATTACGCCACGAGAACTTAAACCATTAAATA; reverse primer sequence 5’-CCTGCAGGCATGCAAGCTGATGTTCCAAACGAAGACTGCA) for Gibson assembly into HindIII-linearized pPD49_78. Sense and antisense domains of a 496-bp region of the C. eleganssdhb-1 gene were assembled from appropriate primers by PCR from genomic DNA targeting parts of exons 1 and 3 (44 and 121 bp respectively) and all of exon 2 (sense forward primer sequence 5’- AGCTTGCATGCCTGCAATCGTTTCAACCCAGAAGCACCAG; sense reverse primer sequence 5’- CAAAGTGTGGCTGAACGTGACACGTTCAGCCACACTTTGG; antisense forward primer sequence 5’- CCAAGTGTGGCTGAACGTGTCACGTTCAGCCACACTTTG; antisense reverse primer sequence 5’- GATCCTCTAGAGTCGACCTCGTTTCAACCCAGAAGCACCA). Sbf1 was used to linearize the resulting plasmid 16 bp downstream from the Punc-31 insertion. A second round of Gibson assembly was used to insert the sense and antisense sdhb-1 segments into the SbfI-linearized plasmid, forming an inverted repeat encoding a long RNA hairpin for RNA interference. The resulting plasmid jhuEx[Punc-31::sdhb-1(IR)] was co-injected with pBX into adult hermaphrodite N2 worms.
DMOG treatment
After synchronization, worm concentration was approximated by counting the number of worms in ten 10-μL drops of medium. Culture volume was diluted to 100 worms/mL. One mL of culture was then added to each well of a 12-well plate. OP50 bacteria were added at 5 mg/mL. Plates were sealed with an aluminum plate sealer and transferred to a room temperature shaker.Worms received the first treatment with dimethyloxalylglycine (DMOG; Sigma), a water-soluble succinate analog, approximately four hours after culture initiation. On the following days, DMOG was added and replenished twice daily at 8-hour intervals to account for spontaneous hydrolysis. It was assumed that each dose of compound was hydrolyzed during each interval, so DMOG treatment concentration is termed “nominal.”
Acquisition and analysis of C. elegans images
C. elegans worms were transferred from liquid culture onto clean NGM plates and rinsed with s-complete medium. Adults were manually separated from larvae with a worm pick onto fresh NGM plates. Digital brightfield images were obtained manually using a Leica DMi1 camera using the 10x objective and converted to grayscale tiff files using Adobe Photoshop. WormSizer [30], an open source plugin compatible with Fiji [31], was used to obtain length and width measurements for each imaged animal.
Statistical analysis
Values are expressed as mean +/- standard deviation for the indicated number of independent experiments. The statistical analysis was performed using the Student’s t-test or a one way analysis of variance (ANOVA) test with post-hoc Tukey HSD, or a Dunnett’s test with R Studio software. A P value of less than 0.05 was considered statistically significant.
Results
Cell-specific knockdown of SDHB-1 leads to increased egg retention in N2 worms
We set out to determine whether C. elegans can be used as a genetic model of the SDH-loss cells present in humanmitochondrial disorders including familial PPGL tumors. RNAi screens have shown that systemic knockdown of any of the four SDH subunits (SDHx) is embryonic lethal in C. elegans [32, 33], as in mammals. Seeking screenable phenotypes associated with SDH loss in worms, it was therefore necessary to limit SDHx knockdown to a subpopulation of cells consistent with viability. We hypothesized that egg-laying behavior controlled by EGL-9 would be sensitive to succinate accumulation such that succinate inhibition of EGL-9 would phenocopy EGL-9 loss and drive egg retention. The unc-31 promoter (Punc-31) was selected to drive expression of test genes because this promoter has been shown to be active in neurons, including those believed to be responsible for egg laying [34]. To test this, we constructed two transgenic lines based on known egg-laying behavior. Hermaphrodite worms homozygous for the egl-9(sa307) mutation retain eggs. We found that Punc-31-driven expression of functional EGL-9 in egl-9(sa307) mutants significantly relieved egg retention from egl-9(sa307) mutant levels (P<2.62e-14) to near wild type levels (mean eggs per worm are 14.2 and 12.7 respectively; P = 0.007; Fig 1A). Likewise, Punc-31-driven expression of wild type hif-1(+) in egl-9(sa307):hif-1(ia4) hermaphrodites increased egg retention significantly above wild type and egl-9(sa307):hif-1(ia4) double mutants levels (P<2.62e-14 for both cases; Fig 1B). These results demonstrate that the unc-31 promoter defines a cell compartment that controls egg-laying behavior. We considered if the more limited neuroendocrine cell compartment defined by tdc-1 promoter (Ptdc-1) activity might also be adequate to control egg-laying behavior. Ptdc-1 activity is thought to be limited primarily to the four uv1 neuroendocrine cells of C. elegans, known to play a prominent role in hormonal control of egg laying. Interestingly, in contrast to Punc-31, we found that Ptdc-1-driven expression of functional hif-1(+) in egl-9(sa307):hif-1(ia4) mutants was inadequate to induce egg retention (data not shown). It is unknown whether this result is due to the tissue restriction of Ptdc-1 or its strength.
Fig 1
Punc-31 control of egl-9 and hif-1 expression is adequate to control egg retention phenotype.
A. Punc-31-driven expression of EGL-9 in egl-9(sa307) mutants is sufficient for statistically significant reduction of egg retention below egl-9(sa307) levels (P<2.62e-14) to near wild type levels (mean eggs per worm are 14.2 and 12.7 respectively; P = 0.007). B. Punc-31-driven expression of HIF-1 in egl-9(sa307):hif-1(ia4) double mutants significantly increases egg retention above egl-9(sa307):hif-1(ia4) and N2 levels (P<2.62e-14 in both cases), to near egl-9(sa307) egg retention levels. ANOVA with post-hoc Tukey’s HSD test was used to compare mean egg retention. **P<0.01, ***P<0.001. Error bars show standard deviation.
Punc-31 control of egl-9 and hif-1 expression is adequate to control egg retention phenotype.
A. Punc-31-driven expression of EGL-9 in egl-9(sa307) mutants is sufficient for statistically significant reduction of egg retention below egl-9(sa307) levels (P<2.62e-14) to near wild type levels (mean eggs per worm are 14.2 and 12.7 respectively; P = 0.007). B. Punc-31-driven expression of HIF-1 in egl-9(sa307):hif-1(ia4) double mutants significantly increases egg retention above egl-9(sa307):hif-1(ia4) and N2 levels (P<2.62e-14 in both cases), to near egl-9(sa307) egg retention levels. ANOVA with post-hoc Tukey’s HSD test was used to compare mean egg retention. **P<0.01, ***P<0.001. Error bars show standard deviation.Based on these results, Punc-31 was chosen to drive cell-specific knockdown of SDHB-1 by RNA interference after injection of a plasmid containing an sdhb-1 inverted repeat (IR) under the control of Punc-31. Disruption of the SDH complex in unc-31-expressing cells is hypothesized to mimic essential biochemical phenotypes of SDH-loss disorders such as PPGL. Three stable worm lines were generated. After synchronization, all individuals carrying the sdhb-1 RNAi transgene showed increased egg retention relative to controls (Fig 2). This result demonstrates for the first time that SDH function in Punc-31-positive cells is necessary for normal egg-laying behavior. We hypothesize that SDH knockdown results in intracellular succinate accumulation, known to inhibit 2-ketoglutarate-dependent dioxygenases such as EGL-9. According to this model, EGL-9 inhibition prevents HIF-1 hydroxylation, stabilizing HIF-1 and promoting HIF-1 signaling and egg retention behavior in C. elegans. We note that global succinate accumulation in whole worms is not expected for SDH knockdown under these conditions, as effects would be limited to the small subset of cells where Punc-31 is active.
Fig 2
Knockdown of SDHB-1 in unc-31-expressing cells increases egg retention in three independently derived worm lines.
sdhb-1 knockdown was accomplished by microinjection of a plasmid containing Punc-31 driven expression of a 496-bp sdhb-1 fragment cloned directly before an inverted repeat of the sequence. An independent Student’s T test was used to compare means. **P<0.01, ***P<0.001. Error bars show standard deviation.
Knockdown of SDHB-1 in unc-31-expressing cells increases egg retention in three independently derived worm lines.
sdhb-1 knockdown was accomplished by microinjection of a plasmid containing Punc-31 driven expression of a 496-bp sdhb-1 fragment cloned directly before an inverted repeat of the sequence. An independent Student’s T test was used to compare means. **P<0.01, ***P<0.001. Error bars show standard deviation.
DMOG treatment increases egg retention in N2 worms
To test the hypothesis that succinate accumulation alone is sufficient to drive egg retention in C. elegans, we studied egg-laying behavior in the presence of dimethyloxalylglycine (DMOG), a cell-permeable succinate analog. DMOG is the prodrug of N-oxalylglycine (NOG), which is known to inhibit 2-ketoglutarate-dependent dioxygenases but is unable to permeate cell membranes [35]. Previous studies have shown that mammalian cells treated with DMOG show an increase in transcription of HIF-1-responsive genes [36]. Consistent with our observations for sdhb-1 knockdown, treatment of C. elegans hermaphrodites with DMOG induced egg retention in wild type N2 worms, but not in hif-1(ia4) worms (Fig 3). The implications of these results are two-fold. First, DMOG-induced egg retention in N2 worms provides a second SDH-loss PPGL model based on a cell-permeable metabolite analog. Second, the inability of DMOG to affect egg laying in hif-1(ia4) mutants demonstrates the HIF-1-dependence of this chemical mechanism of egg retention in N2 worms. This observation supports a model attributing egg retention in N2 worms to increased HIF-1 signaling resulting from DMOG inhibition of EGL-9.
Fig 3
DMOG treatment impacts egg retention in a strain-specific manner.
A. DMOG treatment increases egg retention in N2 worms. B. No egg retention defect was observed in DMOG-treated hif-1(ia4) worms. An independent Student’s T test was used to compare means. *P<0.05, **P<0.01, ***P<0.001. Error bars show standard deviation.
DMOG treatment impacts egg retention in a strain-specific manner.
A. DMOG treatment increases egg retention in N2 worms. B. No egg retention defect was observed in DMOG-treated hif-1(ia4) worms. An independent Student’s T test was used to compare means. *P<0.05, **P<0.01, ***P<0.001. Error bars show standard deviation.
DMOG treatment alters N2 worm body morphology
C. elegans egg retention studies are commonly performed manually either by observing the eggs in an intact animal or after dissolving the cuticle in sodium hypochlorite and counting the eggs in resistant clutches [27]. To more quickly gather egg retention data in a manner that might be optimized in the future for possible high-throughput screening of agents that alter this phenotype, we sought a quantitative surrogate for egg retention. Assays of chitinase release have previously been reported for this purpose[37], but were found to be too variable and imprecise for our purpose. Changes in body morphology were then considered because egg retention might reasonably be expected to affect girth. The WormSizer software tool was used to collect a variety of measurements from brightfield images comparing synchronized untreated and DMOG-treated N2 worms [30]. As hypothesized, DMOG treatment was observed to increase the girth of worms, and this effect was dose-dependent (Fig 4A). Intriguingly, DMOG treatment also decreased length of N2 worms in a dose-dependent manner due to unknown mechanisms (Fig 4B). Thus, DMOG-treated worms were both wider and shorter than normal as evidenced by a reproducible dose-dependent decrease in width:length ratio (Fig 4C). This observation suggests that optimization could lead to a new image-based screening approach for phenotypes related in egg retention in C. elegans.
Fig 4
DMOG treatment affects worm body morphology in a dose-dependent manner.
A. Midpoint width increases with increasing DMOG dose. B. Length decreases with increasing DMOG dose. C. Width:length ratio increases with increasing DMOG dose. Worms treated with higher DMOG doses are increasingly shorter and fatter than untreated worms. Brightfield images were analyzed as described in Methods. Measurements were normalized to untreated worm measurements. A Dunnett’s test was used to compare mean morphological characteristics of DMOG-treated to untreated worms. **P<0.01, ***P<0.0001. Boxplot indicates the median, first and third quartiles and whiskers indicate the largest value within 1.5 × interquartile range. Data points beyond 1.5 × interquartile range are plotted individually.
DMOG treatment affects worm body morphology in a dose-dependent manner.
A. Midpoint width increases with increasing DMOG dose. B. Length decreases with increasing DMOG dose. C. Width:length ratio increases with increasing DMOG dose. Worms treated with higher DMOG doses are increasingly shorter and fatter than untreated worms. Brightfield images were analyzed as described in Methods. Measurements were normalized to untreated worm measurements. A Dunnett’s test was used to compare mean morphological characteristics of DMOG-treated to untreated worms. **P<0.01, ***P<0.0001. Boxplot indicates the median, first and third quartiles and whiskers indicate the largest value within 1.5 × interquartile range. Data points beyond 1.5 × interquartile range are plotted individually.
Discussion
There is increasing interest in understanding disorders caused by cellular metabolite imbalances [18]. Of particular importance to us are cancers driven by alteration of metabolic enzymes, resulting in accumulation of dicarboxylates such as succinate, fumarate, and 2-hydroxyglutarate. These oncometabolites inhibit 2-ketoglutarate-dependent enzymes important for many aspects of cell regulation, including hypoxic response, and epigenetic regulation through demethylation of histones, DNA, and RNA [38, 39]. Studies to develop potential therapies for SDH-loss disorders, including familial PPGL, have been limited by the absence of cell and animal models of the SDH-loss condition [40]. We have previously exploited SDH-loss yeast models for drug screening to identify vulnerabilities induced by SDH loss and succinate accumulation [41]. Here we envision a different approach–the potential for a suppression screen in intact C. elegans worms where a measurable quantitate phenotype reflects oncometabolite accumulation. Such a system would allow screening of drug libraries for non-toxic agents that suppress the phenotype driven by SDH loss and succinate accumulation. Such agents might function by preventing or discharging succinate accumulation.Toward this end we report both genetic and chemical C. elegans models that link quantifiable egg-laying phenotypes to SDH loss and succinate accumulation. These models include egg retention secondary to SDH loss in Punc31 cells, and egg retention secondary to whole-body treatment with succinate analog DMOG. We further show that worm body morphology changes in a dose-dependent manner with DMOG treatment, paralleling egg retention, and providing a possible future approach for high-content image screening of worm phenotypes if the methodologies can be optimized. These results and their interpretations are summarized in Fig 5.
Fig 5
Summary of EGL-9 activity and impact on egg laying in C. elegans models described here.
A. In normoxia, EGL-9 prolyl-hydroxylase marks HIF-1 for degradation and egg-laying is normal. B. hif-1 mutant worms lack stable HIF-1 and display normal egg laying. C. egl-9 mutant worms cannot hydroxylate HIF-1. Stable HIF-1 translocates to the nucleus, and interacts with AHA-1, serving as a transcription factor for hypoxia genes. These worms show increased egg retention. D. hif-1 mutation rescues the egg-laying phenotype in egl-9:hif-1 double mutant worms: though EGL-9 activity is missing, the corresponding absence of HIF-1 precludes HIF-1 signaling and egg laying is normal. E. Punc-31 driven knockdown of SDHB-1 leads to a succinate accumulation that inhibits EGL-9 activity thus stabilizing HIF-1 and leading to egg retention. F. DMOG inhibits EGL-9 activity, stabilizing HIF-1 and leading to egg retention in N2 worms. G. DMOG can also inhibit EGL-9 activity in hif-1 worms but no HIF-1 signaling occurs leading to normal egg laying.
Summary of EGL-9 activity and impact on egg laying in C. elegans models described here.
A. In normoxia, EGL-9prolyl-hydroxylase marks HIF-1 for degradation and egg-laying is normal. B. hif-1 mutant worms lack stable HIF-1 and display normal egg laying. C. egl-9 mutant worms cannot hydroxylate HIF-1. Stable HIF-1 translocates to the nucleus, and interacts with AHA-1, serving as a transcription factor for hypoxia genes. These worms show increased egg retention. D. hif-1 mutation rescues the egg-laying phenotype in egl-9:hif-1 double mutant worms: though EGL-9 activity is missing, the corresponding absence of HIF-1 precludes HIF-1 signaling and egg laying is normal. E. Punc-31 driven knockdown of SDHB-1 leads to a succinate accumulation that inhibits EGL-9 activity thus stabilizing HIF-1 and leading to egg retention. F. DMOG inhibits EGL-9 activity, stabilizing HIF-1 and leading to egg retention in N2 worms. G. DMOG can also inhibit EGL-9 activity in hif-1 worms but no HIF-1 signaling occurs leading to normal egg laying.The results described here open the possibility that C. elegans can be applied after future assay optimization to high-throughput screening of chemical libraries for non-toxic agents that suppress effects of SDH loss and succinate accumulation. Such agents would reveal druggable pathways that might be altered to block oncometabolite effects in cancers of interest.25 Nov 2019PONE-D-19-29380Modeling succinatedehydrogenase loss disorders in C. elegansPLOS ONEDear Dr. Maher, III,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.We would appreciate receiving your revised manuscript by Jan 09 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Ales Vicha, M.D., PhDAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttp://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf1. To comply with PLOS ONE submission guidelines, in your Methods section, please provide additional information regarding your statistical analyses. For more information on PLOS ONE's expectations for statistical reporting, please see https://journals.plos.org/plosone/s/submission-guidelines.#loc-statistical-reporting.2. At this time, we ask that you please provide the source of the primers and NGM media used in this study.3. Thank you for including the following funding information within your acknowledgements section; "This work was supported by the Mayo Foundation, the Paradifference Foundation, and by NIH grant CA166025 (LJM). Some C. elegans strains were provided by the CGC, which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440). "We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:"The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."4. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.Additional Editor Comments (if provided):The present article focuses on exploring the relationship between succinate accumulation, hypoxic signaling, egg-laying behavior, and morphology in C. elegans. In the present study, authors specifically focus on egg retention in C. elegans associated with SDH-loss disorders. They hypothesize that HIF-1alpha is the main player in egg retention. Since almost entire manuscript is devoted to this problem, the title of the manuscript should be more specific. This article is of interest to the readers of this journal.The reviewer has a few comments:1. Why was only the HIF-1alpha but not HIF-2alpha was proposed in the hypothesis? It is known that SDH loss is associated with HIF-2alpha changes.2. What is the mechanism how Punc-31 affects SDHB expression? The page number 6 is very hard to read and understand. The same to applies to Figure 5.3. Succinate measurement is not included, what is the reason for this?4. HIF downstream genes should be shown in a way to see the effect of HIF-1alpha and HIF-2alpha…5. How is this work related to paraganglioma? While SDH is, this work may not be and therefore some information related to paraganglioma and therapies/incidence could be deleted. This information can be also reduced in the summary.6. References 6,7 and 9 should include original studies.7. von Hippel Lindau should be von Hippel-Lindau[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Yes**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: It is clear form the paper that:- SDHB KD is associated with egg retention- This finding is linked to succinate through regulation of HIF1 stabilization- Evaluation of girth provides an indirect reliable marker of succinate accumulationIn this way the C. Elegans model could be a useful tool for screening drugs1- A critical issue of this paper for translating results into PPGL would be that the link between PPGL tumorigenesis and HIF1 is still debated. Many experiments suggest that HIF2 is probably more important than HIF1. Is HIF2 also involved in egg laying behavior ? Please comment.2- Although intracellular succinate is very important in SDHB-related PPGL, it seems to be not only contained into the mitochondria and cytosol of the mutated cells but could act as an extracellular mediator, possibly via a specific receptor '"hormone like action". Did the authors assess the concentrations of intra-cellular and extra-cellular succinate (media) in SDHB KD models ? Please add informations. Would the results be similar if the media is removed very often during experiments ? Please add informations.3- Succinate accumulation may lead to acidific pH. Is pH controlled during experiments ? Is extra or intracellular pH influences egg laying behavior ? Please add informations.Reviewer #2: This is an interesting manuscript documenting a link between SDH and biological activities of C. elegans. The link between one of the key enzymes of the Krebs cycle, SDH, that feeds electron into the OXPHOS system, and biology of a worm is intriguing.Concerning the experimental set-up, the manuscript is well executed, although I have some concerns about presentation of results. Figure 5 is really difficult to read. Although there are significant differences, the individual data are too close to each other, so the authors may start the y-scale at the value of 0.5 or 0.75 rather than 0.The Introduction needs to be re-written partially. It is a bit too long. Also, the authors should refer to a key recent review that documents the role of SDH (complexII, CII) in the Krebs cycle and the OXPHOS system, i.e. Bezawork-Geleta A et al. Mitochondrial complex II: At the crossroads. Trends Biochem Sci 2017, 42, 312-325.The authors state in the Introduction that 'Loss-of-function mutation of any SDH subunit leads to a nonfunctional complex...' This is not exactly true. For example. loss of SDHB results in the assembly of the so called CII-low, a subcomplex of CII comprising SDHA and SDHAF2 and/orSDHAF4 subunits. This CII-low allows for slow rate tumour formation> This should be included in the manuscript, as well as the original reference, where this was shown, i.e. Bezawork-Geleta A et al. Alternative assembly of respiratory complex II connects energy stress to metabolic checkpoints. Nat Commun 2018, 9, 2221.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.3 Dec 2019See cover letter and response to reviewersSubmitted filename: Response_to_Reviewers.docxClick here for additional data file.12 Dec 2019Modeling succinate dehydrogenase lossdisorders in C. elegans through effects onhypoxia-inducible factorPONE-D-19-29380R1Dear Dr. Maher, III,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.With kind regards,Ales Vicha, M.D., PhDAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: All comments have been addressedReviewer #2: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Yes**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: I have no additional comment/question. Although the model is interesting, I have some doubts regarding the ability of this model to predict response to therapies in PPGL, since there is no HIF2 alpha and no expected elevated succinate..Reviewer #2: The authors addressed the comments satisfactorily, in accordance with the reviewers comments and the manuscript is now in good shape.**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No17 Dec 2019PONE-D-19-29380R1Modeling succinatedehydrogenase loss disorders in C. elegans through effects on hypoxia-inducible factorDear Dr. Maher, III:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.For any other questions or concerns, please email plosone@plos.org.Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Ales VichaAcademic EditorPLOS ONE
Authors: B E Baysal; R E Ferrell; J E Willett-Brozick; E C Lawrence; D Myssiorek; A Bosch; A van der Mey; P E Taschner; W S Rubinstein; E N Myers; C W Richard; C J Cornelisse; P Devilee; B Devlin Journal: Science Date: 2000-02-04 Impact factor: 47.728
Authors: Mary A Selak; Sean M Armour; Elaine D MacKenzie; Houda Boulahbel; David G Watson; Kyle D Mansfield; Yi Pan; M Celeste Simon; Craig B Thompson; Eyal Gottlieb Journal: Cancer Cell Date: 2005-01 Impact factor: 31.743
Authors: Irina Bancos; John Paul Bida; Defeng Tian; Mary Bundrick; Kristen John; Molly Nelson Holte; Yeng F Her; Debra Evans; Dyana T Saenz; Eric M Poeschla; Derek Hook; Gunda Georg; L James Maher Journal: PLoS One Date: 2013-02-22 Impact factor: 3.240
Authors: Tammie Bishop; Kah Weng Lau; Andrew C R Epstein; Stuart K Kim; Min Jiang; Delia O'Rourke; Christopher W Pugh; Jonathan M Gleadle; Martin S Taylor; Jonathan Hodgkin; Peter J Ratcliffe Journal: PLoS Biol Date: 2004-09-07 Impact factor: 8.029