Literature DB >> 31881834

Phenotypic and molecular characterization of antimicrobial resistance in Trueperella pyogenes strains isolated from bovine mastitis and metritis.

Mobin Rezanejad¹, Sepideh Karimi², Hassan Momtaz³.

Abstract

BACKGROUND: Trueperella pyogenes is one of the most clinically imperative bacteria responsible for severe cases of mastitis and metritis, particularly in postpartum dairy cows. The bacterium has emergence of antibiotic resistance and virulence characters. The existing research was done to apprise the phenotypic and genotypic evaluation of antibiotic resistance and characterization of virulence factors in the T. pyogenes bacteria of bovine mastitis and metritis in postpartum cows.
METHODS: Two-hundred and twenty-six bovine mastitic milk and 172 uterine swabs were collected and transferred to laboratory. Samples were cultured and T. pyogenes isolates were subjected to disk diffusion and DNA extraction. Distribution of virulence and antibiotic resistance genes was studied by PCR.
RESULTS: Thirty-two out of 226 (14.15%) mastitic milk and forty-one out of 172 (23.83%) uterine swab samples were positive for T. pyogenes. Isolates of mastitic milk harbored the highest prevalence of resistance toward gentamicin (100%), penicillin (100%), ampicillin (90.62%), amoxicillin (87.50%) and trimethoprim-sulfamethoxazole (87.50%), while those of metritis harbored the highest prevalence of resistance toward ampicillin (100%), amoxicillin (100%), gentamicin (97.56%), penicillin (97.56%) and cefalexin (97.56%). AacC, aadA1, aadA2 and tetW were the most generally perceived antibiotic resistance genes. All bacteria harbored plo (100%) and fimA (100%) virulence factors. NanP, nanH, fimC and fimE were also the most generally perceived virulence factors.
CONCLUSIONS: All bacteria harbored plo and fimA virulence factors which showed that they can use as specific genetic markers with their important roles in pathogenicity of T. pyogenes bacteria. Phenotypic pattern of antibiotic resistance was confirmed by genotypic characterization of antibiotic resistance genes.

Entities: CellLine Chemical Disease Gene Species

Keywords: Antibiotic resistance pattern; Mammary infection; Trueperella pyogenes; Uterine infection; Virulence factors

Mesh：

Substances：

Year: 2019 PMID： 31881834 PMCID： PMC6935153 DOI： 10.1186/s12866-019-1630-4

Source DB: PubMed Journal: BMC Microbiol ISSN： 1471-2180 Impact factor: 3.605

Background

Mastitis is an inflammation of the mammary gland and udder tissue. It is a major endemic disease of dairy cattle. It usually occurs as an immune response to microbial invasion of the teat canal by variety of microbes sources present on the farm, and can also occur as a result of chemical, mechanical, or thermal injury to the cow’s udder [1]. Metritis is an inflammation of the uterus. It is mainly caused by infections, and usually is seen following calving complicated by dystocia, retained fetal membranes, twins or stillbirths in postpartum cows [2]. Mastitis and metritis are considered to be the most frequent and most costly production diseases in dairy herds of developing and developed countries. Bacteria are considered to be the prevalent causes of mastitis and metritis in dairy cows [1, 2]. Trueperella pyogenes (T. pyogenes), formerly Arcanobacterium pyogenes (A. pyogenes), is a well-recognized Gram-positive, non-motile, β-hemolytic, irregular/rod-shaped, non-spore-forming, ´coryneform´ bacterium that causes opportunistic pyogenic infections of economic importance in livestock. However, it rarely affects companion animals and humans [3]. T. pyogenes is a widespread opportunistic pathogen with boost presence in mucus layer of upper respiratory, urogenital and gastrointestinal tracts of livestock [3, 4]. In keeping with the ability of T. pyogenes to occur autogenous infection, the bacterium can act as an initial pathogen after occurrence of different trauma [3, 4]. T. pyogenes is a causative agent of metritis, abortion, mastitis, infertility and pneumonia in dairy herds [3-5]. It is also considered as one of the most routine causes of antibiotic resistance mastitis and metritis [5-7]. Numerous virulence markers are accompanied with the pathogenicity of infections caused by this bacterium. The most important virulence markers are plo (pyolysin encoding gene), nanH and nanP (neuraminidases encoding genes), cbpA (collagen-binding protein encoding gene) and diverse fimbrial markers (fimA, fimC, fimG and fimE) [8-10]. Additionally, T. pyogenes are mostly resist toward diverse kinds of antibiotic agents which encoded by presence of determined antibiotic resistance genes including tetW (tetracyclines resistance gene), ermB and ermX (macrolides resistance genes), aacC and aadA1 and aadA2 (aminoglycosides resistance genes) dfr2a (trimethoprim resistance genes), and blaP1 (β-lactams resistance genes). OrfE is additional antibiotic resistance genes of this bacterium with indefinite function [10, 11]. Molecular and antibiotic resistance-based properties of T. pyogenes bacteria are relatively unknown in the cases of mastitis and metritis. Thus, the current study investigated phenotypic and genotypic characterization of antibiotic resistance and molecular characterization of T. pyogenes bacteria isolated from cases of mastitis and metritis in dairy cows in Iran.

Moral deliberation

The research was confirmed by the Moral Assembly of Research of the Faculty of Veterinary Medicine, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran. Verification of this research project and the licenses related to sampling process were approved by the Prof. Hassan Momtaz (Approval Ref Number 251216892).

Samples and study population

The present descriptive study was conducted during February 2017 and October 2018 at the Veterinary hospital of the Islamic Azad University, Shahrekord Branch, Shahrekord, Southwest Iran. Two-hundred and twenty-six raw milk samples and one-hundred and seventy-two uterine swab samples were randomly collected from postpartum cows with clinical mastitis and metritis, respectively. Clinical mastitis was determined using the California mastitis test (CMT) according to procedure described by Hoque et al. (2015) [12]. Presence of clinical metritis in cows were approved by an expert veterinary midwifery. All samples were transferred to Microbiology Research Center of the Islamic Azad University, Shahrekord Branch, shahrekord, Iran in cooler with ice-packs.

Bacterial isolation and identification

Isolation and identification of T. pyogenes bacteria were performed using the technique described beforehand [7]. For this goal, brain heart infusion agar (BHI, Merck, Germany) supplemented with 5% sheep blood and MacConkey agar (Merck, Germany) (incubated on aerobic and anaerobic circumstances for 48 h at 37 °C) were used for initial enrichment. T. pyogenes bacteria were identified by diverse biochemical tests such as CAMP tests (Staphylococcus aureus was used as indicator), urease catalase, nitrate reduction, oxidase, gelatin and esculin hydrolysis and finally of lactose, glucose, mannitol, maltose, xylose and sucrose fermentation tests [7].

Phenotypic analysis of antibiotic resistance

Guidelines of the Clinical and Laboratory Standards Institute (CLSI) [13] according to Kirby-Bauer disk diffusion method was used for this goal. Mueller–Hinton agar (Merck, Germany) supplemented with 5% sheep blood was used for this goal. Pattern of antibiotic resistance of T. pyogenes bacteria was studied toward amoxicillin (25 μg), ampicillin (10 μg), azithromycin (15 μg), cefalexin (30 μg), ciprofloxacin (5 μg), enrofloxacin (5 μg), erythromycin (15 μg), gentamicin (10 μg), penicillin (10 units), rifampicin (5 μg), streptomycin (10 μg), sulfamethoxazole (25 μg), tetracycline (30 μg), trimethoprim- lincomycin (2 μg) and tylosin (30 μg) antibiotic disks (Oxoid, UK). T. pyogenes ATCC 19411 was used as quality control organism. Procedure was performed according to CLSI [13].

DNA extraction

T. pyogenes bacteria were sub-cultured on nutrient broth media (NB, Merck, Germany) and further incubated for 48 h at 37 °C. Genomic DNA was extracted from bacterial colonies using the DNA extraction kit (Thermo Fisher Scientific, St. Leon-Rot, Germany) based on the guidelines of the factory. Purity, quality and quantity of extracted DNA were measured using Nanodrop device (NanoDrop, Thermo Scientific, Waltham, MA, USA), gel electrophoresis and spectrophotometer.

Genotypic analysis of antibiotic resistance and virulence factors

Table 1 signifies the PCR circumstances used for amplification of antibiotic resistance genes [14-17]. Table 2 signifies the PCR circumstances used for amplification of virulence factors [18, 19]. A programmable DNA thermo-cycler (Eppendorf Mastercycler 5330, Eppendorf-Nethel-Hinz GmbH, Hamburg, Germany) was used in all PCR reactions. Gel electrophoresis (120 V/208 mA) in 2.5% agarose gel was applied for study the amplification of targeted genes. The UVI doc gel documentation systems (Grade GB004, Jencons PLC, London, UK) was applied for gel visualization.

Table 1

List of primers and PCR conditions used for amplification of antibiotic resistance genes in the T. pyogenes bacteria isolated from samples of mastitis and metritis [14–18]

Target gene	Primer sequence (5′-3′)	PCR product (bp)	PCR programs	PCR volume (50 μL)
Class 1 intI	F: CCTCCCGCACGATGATC	280	1 cycle:	5 μL PCR buffer 10X
Class 1 intI	R: TCCACGCATCGTCAGGC		95 ^0C ------------ 3 min	2 mM Mgcl₂
Class 1 cassette	F: GGCATCCAAGCAGCAAG R: AAGCAGACTTGACCTGA	Unpredictable	35 cycle: 94 ^0C ------------ 60 s	150 μM dNTP (Fermentas) 0.75 μM of each primers F & R
Class 1 cassette			58 ^0C ------------ 60 s 72 ^0C ------------ 60 s 1 cycle: 72 ^0C ------------ 5 min	1.5 U Taq DNA polymerase (Fermentas) 1 μL DNA template
Class 2 intI	F: TTATTGCTGGGATTAGGC R: ACGGCTACCCTCTGTTATC	233	1 cycle: 94 ^0C ------------ 4 min. 35 cycle: 94 ^0C ------------ 60 s 56 ^0C ------------ 60 s 72 ^0C ------------ 45 s 1 cycle: 72 ^0C ------------ 7 min	5 μL PCR buffer 10X 2 mM Mgcl₂ 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1 U Taq DNA polymerase (Fermentas) 1.5 μL DNA template
tetW	F: GACAACGAGAACGGACACTATG R: CGCAATAGCCAGCAATGAACGC	1843	1 cycle: 94 ^0C ------------ 2 min. 35 cycle: 94 ^0C ------------ 60 s 55 ^0C ------------ 60 s 72 ^0C ------------ 60 min 1 cycle: 72 ^0C ------------ 5 min	5 μL PCR buffer 10X 2 mM Mgcl₂ 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template
ermX	F:GTTGCGCTCTAACCGCTAAGGC R:CCATGGGGACCACTGAGCCGTC	571/657	1 cycle: 94 ^0C ------------ 2 min. 35 cycle: 94 ^0C ------------ 60 s 55 ^0C ------------ 60 s 72 ^0C ------------ 60 min 1 cycle: 72 ^0C ------------ 6 min	5 μL PCR buffer 10X 2 mM Mgcl₂ 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template
ermB	F: GAAATTGGAACAGGTAAAGG R: TTTACTTTTGGTTTAGGATG	404	1 cycle: 94 ^0C ------------ 60 s. 35 cycle: 94 ^0C ------------ 60 s 53 ^0C ------------ 60 s 72 ^0C ------------ 60 s 1 cycle: 72 ^0C ------------ 5 min	5 μL PCR buffer 10X 2 mM Mgcl₂ 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template

Table 2

List of primers and PCR conditions used for amplification of virulence factors in the T. pyogenes bacteria isolated from samples of mastitis and metritis [19, 20]

Target gene	Primer sequence (5′-3′)	PCR product (bp)	PCR programs	PCR volume (50 μL)
nanH	F: CGCTAGTGCTGTAGCGTTGTTAAGT R: CCGAGGAGTTTTGACTGACTTTGT	781	1 cycle: 94 ^0C ------------ 3 min. 35 cycle: 94 ^0C ------------ 60 s 60 ^0C ------------ 60 s 72 ^0C ------------ 3 min 1 cycle: 72 ^0C ------------ 7 min	5 μL PCR buffer 10X 1.5 mM Mgcl₂ 200 μM dNTP (Fermentas) 0.5 μM of each primers F & R 1.25 U Taq DNA polymerase (Fermentas) 2.5 μL DNA template
nanP	F: TTGAGCGTACGCAGCTCTTC R: CCACGAAATCGGCCTTATTG	150
cbpA	F: GCAGGGTTGGTGAAAGAGTTTACT R: GCTTGATATAACCTTCAGAATTTGCA	124
fimC	F: TGTCGAAGGTGACGTTCTTCG R: CAAGGTCACCGAGACTGCTGG	843
plo	F: GGCCCGAATGTCACCGC R: AACTCCGCCTCTAGCGC	270	1 cycle: 94 ^0C ------------ 2 min 35 cycle: 94 ^0C ------------ 60 s 55 ^0C ------------ 60 s 72 ^0C ------------ 60 s 1 cycle: 72 ^0C ------------ 5 min	5 μL PCR buffer 10X 2 mM Mgcl₂ 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template
fimA	F: CACTACGCTCACCATTCACAAG R: GCTGTAATCCGCTTTGTCTGTG	605	1 cycle: 94 ^0C ------------ 3 min. 35 cycle: 94 ^0C ------------ 60 s 57 ^0C ------------ 60 s 72 ^0C ------------ 3 min 1 cycle: 72 ^0C ------------ 7 min	5 μL PCR buffer 10X 2 mM Mgcl₂ 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template
fimG	F: ACG CTT CAG AAG GTC ACC AGG R: ATC TTG ATC TGC CCC CAT GCG	929
fimE	F: GCCCAGGACCGAGAGCGAGGGC R: GCCTTCACAAATAACAGCAACC	775	1 cycle: 94 ^0C ------------ 3 min. 35 cycle: 94 ^0C ------------ 60 s 55 ^0C ------------ 60 s 72 ^0C ------------ 3 min 1 cycle: 72 ^0C ------------ 7 min	5 μL PCR buffer 10X 2 mM Mgcl₂ 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template

List of primers and PCR conditions used for amplification of antibiotic resistance genes in the T. pyogenes bacteria isolated from samples of mastitis and metritis [14-18] F: GGCATCCAAGCAGCAAG R: AAGCAGACTTGACCTGA 35 cycle: 94 0C ------------ 60 s 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 58 0C ------------ 60 s 72 0C ------------ 60 s 1 cycle: 72 0C ------------ 5 min 1.5 U Taq DNA polymerase (Fermentas) 1 μL DNA template F: TTATTGCTGGGATTAGGC R: ACGGCTACCCTCTGTTATC 1 cycle: 94 0C ------------ 4 min. 35 cycle: 94 0C ------------ 60 s 56 0C ------------ 60 s 72 0C ------------ 45 s 1 cycle: 72 0C ------------ 7 min 5 μL PCR buffer 10X 2 mM Mgcl2 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1 U Taq DNA polymerase (Fermentas) 1.5 μL DNA template F: GACAACGAGAACGGACACTATG R: CGCAATAGCCAGCAATGAACGC 1 cycle: 94 0C ------------ 2 min. 35 cycle: 94 0C ------------ 60 s 55 0C ------------ 60 s 72 0C ------------ 60 min 1 cycle: 72 0C ------------ 5 min 5 μL PCR buffer 10X 2 mM Mgcl2 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template F:GTTGCGCTCTAACCGCTAAGGC R:CCATGGGGACCACTGAGCCGTC 1 cycle: 94 0C ------------ 2 min. 35 cycle: 94 0C ------------ 60 s 55 0C ------------ 60 s 72 0C ------------ 60 min 1 cycle: 72 0C ------------ 6 min 5 μL PCR buffer 10X 2 mM Mgcl2 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template F: GAAATTGGAACAGGTAAAGG R: TTTACTTTTGGTTTAGGATG 1 cycle: 94 0C ------------ 60 s. 35 cycle: 94 0C ------------ 60 s 53 0C ------------ 60 s 72 0C ------------ 60 s 1 cycle: 72 0C ------------ 5 min 5 μL PCR buffer 10X 2 mM Mgcl2 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template List of primers and PCR conditions used for amplification of virulence factors in the T. pyogenes bacteria isolated from samples of mastitis and metritis [19, 20] F: CGCTAGTGCTGTAGCGTTGTTAAGT R: CCGAGGAGTTTTGACTGACTTTGT 1 cycle: 94 0C ------------ 3 min. 35 cycle: 94 0C ------------ 60 s 60 0C ------------ 60 s 72 0C ------------ 3 min 1 cycle: 72 0C ------------ 7 min 5 μL PCR buffer 10X 1.5 mM Mgcl2 200 μM dNTP (Fermentas) 0.5 μM of each primers F & R 1.25 U Taq DNA polymerase (Fermentas) 2.5 μL DNA template F: TTGAGCGTACGCAGCTCTTC R: CCACGAAATCGGCCTTATTG F: GCAGGGTTGGTGAAAGAGTTTACT R: GCTTGATATAACCTTCAGAATTTGCA F: TGTCGAAGGTGACGTTCTTCG R: CAAGGTCACCGAGACTGCTGG F: GGCCCGAATGTCACCGC R: AACTCCGCCTCTAGCGC 1 cycle: 94 0C ------------ 2 min 35 cycle: 94 0C ------------ 60 s 55 0C ------------ 60 s 72 0C ------------ 60 s 1 cycle: 72 0C ------------ 5 min 5 μL PCR buffer 10X 2 mM Mgcl2 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template F: CACTACGCTCACCATTCACAAG R: GCTGTAATCCGCTTTGTCTGTG 1 cycle: 94 0C ------------ 3 min. 35 cycle: 94 0C ------------ 60 s 57 0C ------------ 60 s 72 0C ------------ 3 min 1 cycle: 72 0C ------------ 7 min 5 μL PCR buffer 10X 2 mM Mgcl2 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template F: ACG CTT CAG AAG GTC ACC AGG R: ATC TTG ATC TGC CCC CAT GCG F: GCCCAGGACCGAGAGCGAGGGC R: GCCTTCACAAATAACAGCAACC 1 cycle: 94 0C ------------ 3 min. 35 cycle: 94 0C ------------ 60 s 55 0C ------------ 60 s 72 0C ------------ 3 min 1 cycle: 72 0C ------------ 7 min 5 μL PCR buffer 10X 2 mM Mgcl2 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template

Statistical analysis

Data were classified using the Microsoft Office Excel software. SPSS 21.0 statistical software (SPSS Inc., Chicago, IL, USA) and Chi-square and Fisher’s exact two-tailed tests were applied for statistical analysis of data. P value < 0.05 was considered as statistical significant level.

Results

A total of 226 bovine mastitic milk and 172 bovine uterine swab samples were studied for prevalence of T. pyogenes bacteria, as well as phenotypic and genotypic evaluation of antibiotic resistance and distribution of virulence factors. Thirty-two out of 226 (14.15%) mastitic milk and forty-one out of 172 (23.83%) uterine swab of cows with metritis were positive for T. pyogenes. Statistically momentous variance was found for the prevalence of T. pyogenes between mastitis and metritis samples (P < 0.05). Table 3 signifies the phenotypic pattern of antibiotic resistance amongst the T. pyogenes bacteria isolated from samples of mastitis and metritis in postpartum cows. T. pyogenes bacteria isolated from the mastitic milk samples harbored the highest prevalence of resistance toward gentamicin (100%), penicillin (100%), ampicillin (90.62%), amoxicillin (87.50%), trimethoprim-sulfamethoxazole (87.50%), cefalexin (84.37%) and streptomycin (81.25%) antibiotic agents. T. pyogenes bacteria isolated from the uterine swabs taken from cows with metritis harbored the highest prevalence of resistance toward ampicillin (100%), amoxicillin (100%), gentamicin (97.56%), penicillin (97.56%) and cefalexin (97.56%) antibiotic agents. Prevalence of resistance toward azithromycin antibiotic agents were low in both studied groups.

Table 3

Phenotypic pattern of antibiotic resistance amongst the T. pyogenes bacteria isolated from samples of mastitis and metritis in cow

Types of samples (N. positive)	Antibiotic resistance pattern (%)
Types of samples (N. positive)	Rifampicin	Streptomycin	Azithromycin	Tylosin	Cefalexin	Trimethoprim-sulfamethoxazole	Lincomycin	Tetracycline	Ciprofloxacin	Enrofloxacin	Penicillin	Amoxicillin	Ampicillin	Erythromycin	Gentamicin
Mastitis (32)	19 (59.37)	26 (81.25)	12 (37.50)	20 (62.50)	27 (84.37)	28 (87.50)	14 (43.75)	17 (53.12)	17 (53.12)	19 (59.37)	32 (100)	28 (87.50)	29 (90.62)	17 (53.12)	32 (100)
Metritis (41)	28 (68.29)	23 (56.09)	19 (46.34)	26 (63.41)	40 (97.56)	29 (70.73)	24 (58.53)	20 (48.78)	29 (70.73)	30 (73.17)	40 (97.56)	41 (100)	41 (100)	16 (39.02)	40 (97.56)

Phenotypic pattern of antibiotic resistance amongst the T. pyogenes bacteria isolated from samples of mastitis and metritis in cow Table 4 signifies the genotypic pattern of antibiotic resistance amongst the T. pyogenes bacteria isolated from samples of mastitis and metritis in postpartum cows. AacC (87.50%), aadA1 (81.25%), aadA2 (56.25%) and tetW (56.25%) were the most generally perceived antibiotic resistance genes amongst the T. pyogenes bacteria isolated from mastitic milk samples. AacC (53.65%), aadA1 (58.78%), orfE (48.78%) and tetW (48.78%) were the most generally perceived antibiotic resistance genes amongst the T. pyogenes bacteria isolated from uterine swab samples taken from cows with metritis. Statistically momentous variance was found between type of samples and distribution of antibiotic resistance genes of T. pyogenes bacteria (P < 0.05). Additionally, Statistically momentous variance was found between prevalence of ermB and ermX (P < 0.05) and aadA1 and aadA2 (P < 0.05) antibiotic resistance genes.

Table 4

Genotypic pattern of antibiotic resistance amongst the T. pyogenes bacteria isolated from samples of mastitis and metritis in cow

Types of samples (N. positive)	Antibiotic resistance genes (%)
Types of samples (N. positive)	tetW	ermB	ermX	orfE	dfr2a	blaP1	aadA2	aadA1	aacC
Mastitis (32)	18 (56.25)	10 (31.25)	14 (43.75)	16 (50)	12 (37.50)	14 (43.75)	18 (56.25)	26 (81.25)	28 (87.50)
Metritis (41)	20 (48.78)	14 (34.14)	18 (43.90)	20 (48.78)	18 (43.90)	19 (46.34)	17 (41.46)	20 (48.78)	22 (53.65)

Genotypic pattern of antibiotic resistance amongst the T. pyogenes bacteria isolated from samples of mastitis and metritis in cow Table 5 signifies the distribution of virulence factors amongst the T. pyogenes bacteria isolated from samples of mastitis and metritis in postpartum cows. Plo (100%), fimA (100%), nanP (84.37%), fimC (87.12%) and fimE (75%) were the most generally perceived virulence factors amongst the T. pyogenes bacteria isolated from mastitic milk samples. Plo (100%), fimA (100%), nanH (97.56%), nanP (92.68%), fimE (92.68%), fimC (78.04%) and fimG (73.17%) were the most generally perceived virulence factors amongst the T. pyogenes bacteria isolated from uterine swab samples collected from cows with metritis. Statistically momentous variance was found between type of samples and distribution of virulence factors of T. pyogenes bacteria (P < 0.05). Additionally, Statistically momentous variance was found between prevalence of fimC and fimG (P < 0.05), nanP and nanH (P < 0.05) and fimE and fimG (P < 0.05) virulence factors.

Table 5

Distribution of virulence factors amongst the T. pyogenes bacteria isolated from samples of mastitis and metritis in cow

Types of samples (N. positive)	Virulence factors (%)
Types of samples (N. positive)	plo	fimG	fimE	fimC	fimA	cbpA	nanP	nanH
Mastitis (32)	32 (100)	2 (6.25)	24 (75)	25 (78.12)	32 (100)	6 (18.75)	27 (84.37)	20 (62.50)
Metritis (41)	41 (100)	30 (73.17)	38 (92.68)	32 (78.04)	41 (100)	26 (63.41)	38 (92.68)	40 (97.56)

Distribution of virulence factors amongst the T. pyogenes bacteria isolated from samples of mastitis and metritis in cow

Discussion

Prevalence of T. pyogenes bacteria in samples of mastitis and metritis in postpartum cows were 14.15 and 23.83%, respectively. Epidemiological investigations revealed that bovine intramammary infections caused by T. pyogenes are associated with the highest somatic cell count (SCC) in milk and significant losses in milk yield, as well as high percentages of nonfunctional quarters [20, 21]. Furthermore, the efficacy of intramammary therapy of mastitis caused by this bacterium is rather low [20, 21]. T. pyogenes was the most important bacterial risk factor for clinical endometritis, but not for subclinical endometritis. T. pyogenes bovine metritis is characterized by fever, a fetid vulvar discharge, excessive fluid discharge and lacking tone of uterus and off-feed and depression. It is occasionally acute disease that can be life threatening [22, 23]. Tamai et al. (2018) [24] described that 65 T. pyogenes bacteria (32.50%) were isolated from 200 collected samples, 16 (24.60%) of which were isolated as pure cultures, as opposed the other 49 isolates (75.40%) were obtained from mixed cultures which was higher than our stated findings. Prevalence of T. pyogenes in mastitic milk samples collected from Iran was 36.50% [25] which was higher than our stated findings. A cross-section study in Brazil, which was conducted through 2002 to 2012 revealed that mastitis (45.10%), abscesses (18.00%), pneumonia (11.10%), and lymphadenitis (9.00%) were the most common clinical manifestations occurred due to the T. pyogenes [3]. Furthermore, T. pyogenes was also isolated from other miscellaneous clinical specimens from cases of septicemia, encephalitis, pyometra, prostatitis, orchitis, seminal vesiculitis, pericarditis, and omphalitis [3]. High prevalence of T. pyogenes bacteria in the cases of mastitis and metritis in postpartum cows has been described from China [26], Germany [27], Poland [28] and Egypt [29]. The development of antimicrobial resistance by bacteria is a global problem. Overuse of antimicrobial agents, incomplete treatment, wrong choice of medication and transfer of antibiotic resistance genes among bacteria are the main reasons for the increase in antibiotic resistance. Findings of the current investigation revealed that the phenotypic pattern of the antibiotic resistance was confirmed by the genotypic pattern. Otherwise, higher prevalence of tetW, ermB and ermX, aacC and aadA1 and aadA2, dfr2a, and blaP1 antibiotic resistance genes were found in tetracycline, macrolides, aminoglycosides, trimethoprim, and β-lactams-resistant T. pyogenes bacteria. We found that T. pyogenes bacteria isolated from the mastitic milk and also uterine swabs taken from cows with metritis harbored the highest prevalence of resistance toward gentamicin, penicillin, ampicillin, amoxicillin and cefalexin antibiotic agents. High prevalence of antibiotic resistance described in the existing research is may be due to the unofficial and unselective antibiotic prescription in Iranian veterinary hospitals. Boost incidence of resistance of T. pyogenes bacteria toward gentamicin, penicillin, ampicillin, amoxicillin and cefalexin antibiotic agents was also described from Lithuania [30], Senegal [31] and Brazil [32]. Moreover, boost incidence of tetW, ermB and ermX, aacC and aadA1 and aadA2, dfr2a, and blaP1 antibiotic resistance genes in the T. pyogenes bacteria was also described from China [9], Iran [25] and Poland [33]. Momtaz et al. (2016) [25] described that T. pyogenes bacteria isolated from bovine mastitic milk samples harbored the highest prevalence of resistance toward tetracycline (97.80%), gentamicin (86.90%),streptomycin (84.80%), penicillin (69.60%), erythromycin (63.00%), trimethoprim-sulfamethoxazole (39.10%), enrofloxacin (23.90%) and ciprofloxacin (19.60%) which was similar to our findings. Similarly, more than 50% of the isolates recovered from bovine metritis samples were simultaneously resist toward penicillin and ampicillin [34]. Rife prescription of tylosin and tetracyclines as therapeutic and growth stimulating agents have resulted in high occurrence of resistant T. pyogenes [24, 33, 34]. Askari et al. (2018) [35] described the boost incidence of resistance of T. pyogenes bacteria toward gentamycin, tetracycline, cefotaxime, ciprofloxacin, erythromycin, vancomycin, streptomycin, ampicillin and doxycycline antibiotic agents. Dong et al. (2017) [36] described that strB, aphA1, sul1 and aac (6′)-Ib were the most generally perceived antibiotic resistance genes amongst the T. pyogenes bacteria isolated from animal clinical infections. Zhao et al. (2011) [37] described that the incidence of aacC, aadA1, aadA2, blaP1, dfr2a and orfE antibiotic resistance genes were 3.60, 32.10, 21.40, 28.60, 21.40 and 28.60%, respectively which was similar to our findings. They also showed that the incidence of aminoglycoside-resistance markers was 57.10%. The tetracycline resistant phenotype is principally associated with tetW gene, which is responsible for resistance in a wide range of bacteria recovered from both human and animal [15]. It has been shown that ermX and ermB genes encoded rRNA methylases which associated with resistance to MLSB antibiotics [33]. Additionally, the incidence of ermX is much higher than of ermB amongst the tylosin-resistant T. pyogenes [33]. Aminoglycoside-resistance determinants (aacC, aadA1 and aadA2), β-lactam-resistance determinant (blaP1) and trimethoprim-resistance determinant (dfr2a) were prevalent among A. pyogenes isolates of other clinical infections [9, 15, 33, 37]. Our findings showed that all of the T. pyogenes bacteria harbored plo (100%) and fimA (100%) virulence factors. Prevalence of nanH was also near to 100% amongst the T. pyogenes bacteria isolated from uterine swabs of cows with metritis. Additionally, nanP, fimC and fimE were the most generally perceived virulence factors amongst the T. pyogenes bacteria. Higher prevalence of plo and nanH virulence genes was also detected in previous researches [8–10, 24, 25, 28]. However, low distribution of nanP, cbpA and fimbrial genes were described [8–10, 23, 24, 27]. fimA gene was detected in nearly 94% of T. pyogenes isolates which originated from animal sources [38] and in 76.40% isolates recovered from metritis in dairy cows [10, 19]. We detected the fimA gene in all T. pyogenes isolates of bovine mastitis and metritis origins, which was similar to results stated by Hijazin et al. (2011) [27]. Thus, plo and fimA virulence factors may have the higher importance in the pathogenesis of the mastitis and metritis diseases caused by T. pyogenes. These genes may also be good genetic markers in detection of T. pyogenes bacteria in clinical samples. Pyolysin is a major virulence factor responsible for lysis of host cells. Most of the isolates recovered from milk (75%) and those of metritis (92.68%) were positive fimE gene which was similar to findings of Silva et al. (2008) [19]. FimG gene had the higher prevalence in T. pyogenes bacteria isolated from the cases of metritis (73.17%) than those of mastitis (6.25%). The fimG genewas also more prevalent among isolates of bovine metritis (50–67%) [10, 19], compared to mastitis (18%). Thus, the fimG gene may be predominant among T. pyogenes bacteria isolated from the cases of metritis. The collagen-binding protein gene (CbpA) was detected in 18.75 and 63.41% isolates recovered from clinical mastitis and metritis, respectively. CbpA was also detected in 21% isolates recovered from clinical mastitis [33]. Prevalence of cbpA gene in T. pyogenes strains isolated from bovine clinical infection [39] and uterine secretion [10, 19] were 48.9 and 100%, respectively. Higher prevalence of cbpA gene was described in the cases of metritis [24, 40]. We also found that T. pyogenes elaborates at least two neuraminidases encoded by nanH and nanP proteins. Otherwise, prevalence of nanP protein in the cases of mastitis and metritis was 84.37 and 92.68%, respectively. Moreover, prevalence of nanH protein in the cases of mastitis and metritis was 62.50 and 97.56%, respectively. Two neuraminidases, nanH and nanP, are proteins undoubtedly underwriting to the colonization of host tissue. Previous works [41, 42] showed that all investigated T. pyogenes isolates recovered from diverse kinds of infections were positive for nanH protein and 64.2% of them harbored nanP protein. Both nanH and nanP proteins were detected in majority of T. pyogenes bacteria isolated from bovine clinical samples studied in Iran [25], USA [43], Portugal [10] and Brazil [44]. Reversely, nanH protein was not detected in the bovine clinical samples studied by Hijazin et al. (2011) [27]and Zastempowska et al. (2012) [33]. A comparison of these results may lead us to conclude that neuraminidases, especially nanH, may not be the main virulence marker occupied in the pathogenesis of bovine clinical infections. Momtaz et al. (2016) [25] described that the prevalence of plo, fimA, fimC, fimG, nanP, cbpA and nanH virulence markers amongst the T. pyogenes bacteria isolated from bovine mastitic milk samples were 100, 100, 84.70, 26, 21.70, 17.30 and 15.20%, respectively. Silva et al. (2008) [20] described that the prevalence of plo, nanH, nanP, cbpA, fimA, fimC, fimE and fimG virulence factors amongst the T. pyogenes bacteria isolated from bovine clinical metritis were 100,100, 100, 100, 100, 67, 98 and 67%, respectively which was also similar to our findings. Similar patterns for virulence factors were also described by Rzewuska et al. (2012) [28].

Conclusions

High prevalence of resistance toward gentamicin, penicillin, ampicillin, amoxicillin and cefalexin antibiotic agents and high prevalence of aacC, aadA1, aadA2 and tetW antibiotic resistance genes in the T. pyogenes bacteria were the most important findings of our study. Furthermore, T. pyogenes bacteria harbored certain putative virulence factors, especially plo, fimA, nanP, nanH, fimC and fimE which showed their high pathogenicity. All of the T. pyogenes bacteria harbored plo and fimA virulence factors which showed that they can use as specific genetic markers for detection of pathogenic T. pyogenes bacteria in the cases of mastitis and metritis in postpartum cows. Phenotypic pattern of antibiotic resistance was approved by the genotypic characterization of antibiotic resistance genes. The presence of detected gene cassettes in bacterial isolates indicates that integrons may play an important role in the dissemination of antimicrobial resistance. However, further investigation are needed to found the exit relations between distribution of virulence factors and antibiotic resistance genes and other epidemiological aspects of virulent and resistant T. pyogenes bacteria in the cases of mastitis and metritis in postpartum cows.

38 in total

Review 1. Arcanobacterium pyogenes: molecular pathogenesis of an animal opportunist.

Authors: B Helen Jost; Stephen J Billington
Journal: Antonie Van Leeuwenhoek Date: 2005-08 Impact factor: 2.271

2. Metritis in dairy cows: risk factors and reproductive performance.

Authors: M J Giuliodori; R P Magnasco; D Becu-Villalobos; I M Lacau-Mengido; C A Risco; R L de la Sota
Journal: J Dairy Sci Date: 2013-03-30 Impact factor: 4.034

3. Trueperella pyogenes multispecies infections in domestic animals: a retrospective study of 144 cases (2002 to 2012).

Authors: M G Ribeiro; R M Risseti; C A D Bolaños; K A Caffaro; A C B de Morais; G H B Lara; T O Zamprogna; A C Paes; F J P Listoni; M M J Franco
Journal: Vet Q Date: 2015-03-20 Impact factor: 3.320

4. Identification of a second Arcanobacterium pyogenes neuraminidase and involvement of neuraminidase activity in host cell adhesion.

Authors: B Helen Jost; J Glenn Songer; Stephen J Billington
Journal: Infect Immun Date: 2002-03 Impact factor: 3.441

5. Different screening tests and milk somatic cell count for the prevalence of subclinical bovine mastitis in Bangladesh.

Authors: Md Nazmul Hoque; Ziban Chandra Das; Anup Kumar Talukder; Mohammad Shah Alam; Abu Nasar Md Aminoor Rahman
Journal: Trop Anim Health Prod Date: 2014-10-19 Impact factor: 1.559

6. Sensitivity to antibiotics of Arcanobacterium pyogenes and Escherichia coli from the uteri of cows with metritis/endometritis.

Authors: Edward Malinowski; Henryka Lassa; Hanna Markiewicz; Maciej Kaptur; Marek Nadolny; Wiesław Niewitecki; Jacek Ziętara
Journal: Vet J Date: 2010-02-02 Impact factor: 2.688

7. Genotypic characterization and evaluation of an antibiotic resistance of Trueperella pyogenes (Arcanobacterium pyogenes) isolated from milk of dairy cows with clinical mastitis.

Authors: Ewa Zastempowska; Henryka Lassa
Journal: Vet Microbiol Date: 2012-07-20 Impact factor: 3.293

8. A second tylosin resistance determinant, Erm B, in Arcanobacterium pyogenes.

Authors: B Helen Jost; Hien T Trinh; J Glenn Songer; Stephen J Billington
Journal: Antimicrob Agents Chemother Date: 2004-03 Impact factor: 5.191

9. Susceptibility to antibiotics in urinary tract infections in a secondary care setting from 2005-2006 and 2010-2011, in São Paulo, Brazil: data from 11,943 urine cultures.

Authors: Erique José Peixoto de Miranda; Gerson Sobrinho Salvador de Oliveira; Felício Lopes Roque; Sílvia Regina dos Santos; Rodrigo Diaz Olmos; Paulo Andrade Lotufo
Journal: Rev Inst Med Trop Sao Paulo Date: 2014 Jul-Aug Impact factor: 1.846

10. Aminoglycoside resistance of Trueperella pyogenes isolated from pigs in China.

Authors: Wen-Long Dong; Ling-Cong Kong; Yu Wang; Chang-Long Gou; Bo Xu; Hong-Xia Ma; Yun-Hang Gao
Journal: J Vet Med Sci Date: 2017-10-02 Impact factor: 1.267

7 in total

1. Assessment of animal diseases caused by bacteria resistant to antimicrobials: cattle.

Authors: Søren Saxmose Nielsen; Dominique Joseph Bicout; Paolo Calistri; Elisabetta Canali; Julian Ashley Drewe; Bruno Garin-Bastuji; Jose Luis Gonzales Rojas; Christian Gortazar Schmidt; Mette Herskin; Virginie Michel; Miguel Angel Miranda Chueca; Barbara Padalino; Paolo Pasquali; Helen Clare Roberts; Hans Spoolder; Karl Stahl; Antonio Velarde; Arvo Viltrop; Christoph Winckler; Jeroen Dewulf; Luca Guardabassi; Friederike Hilbert; Rodolphe Mader; Francesca Baldinelli; Julio Alvarez
Journal: EFSA J Date: 2021-12-10

2. Role of microorganisms isolated from cows with mastitis in Moscow region in biofilm formation.

Authors: Pavel Rudenko; Nadezhda Sachivkina; Yury Vatnikov; Sergey Shabunin; Sergey Engashev; Svetlana Kontsevaya; Arfenia Karamyan; Dmitry Bokov; Olga Kuznetsova; Elena Vasilieva
Journal: Vet World Date: 2021-01-07

3. A case of Trueperella pyogenes causing prosthetic joint infection.

Authors: Tariq Azamgarhi; Simon Warren
Journal: J Bone Jt Infect Date: 2020-12-01

4. Predisposing factors, diagnostic and therapeutic aspects of persistent endometritis in postpartum cows.

Authors: Takeshi Osawa
Journal: J Reprod Dev Date: 2021-09-11 Impact factor: 2.214

5. Pathogenic and Endosymbiotic Bacteria and Their Associated Antibiotic Resistance Biomarkers in Amblyomma and Hyalomma Ticks Infesting Nguni Cattle (Bos spp.).

Authors: Aubrey Dickson Chigwada; Ntanganedzeni Olivia Mapholi; Henry Joseph Oduor Ogola; Sikhumbuzo Mbizeni; Tracy Madimabi Masebe
Journal: Pathogens Date: 2022-04-02

6. New Determinants of Aminoglycoside Resistance and Their Association with the Class 1 Integron Gene Cassettes in Trueperella pyogenes.

Authors: Ewelina Kwiecień; Ilona Stefańska; Dorota Chrobak-Chmiel; Agnieszka Sałamaszyńska-Guz; Magdalena Rzewuska
Journal: Int J Mol Sci Date: 2020-06-13 Impact factor: 5.923

7. Effect of intramolecular disulfide bond of bovine lactoferricin on its molecular structure and antibacterial activity against Trueperella pyogenes separated from cow milk with mastitis.

Authors: Jie Pei; Lin Xiong; Min Chu; Xian Guo; Ping Yan
Journal: BMC Vet Res Date: 2020-10-23 Impact factor: 2.741

7 in total