Literature DB >> 31849517

ATG3, a Target of miR-431-5p, Promotes Proliferation and Invasion of Colon Cancer via Promoting Autophagy.

Wei Huang1,2, Chong Zeng3, Shanbiao Hu4, Lei Wang5, Jie Liu1.   

Abstract

BACKGROUND: Studies have indicated that ATG3 could mediate the effects of other tumor-related regulators in carcinogenesis. However, the expression, role, and mechanism of ATG3 itself in cancers are rarely revealed. Thus, we explored the expression, function, and mechanism of ATG3 in colon cancer.
MATERIALS AND METHODS: The expression of ATG3 was detected in colon cancer tissues and cell lines, as well as in adjacent tumor tissues and normal colon epithelial cells. The effects of ATG3 alteration on proliferation and invasion were further analyzed. The expression and role of miR-431-5p, a potential negative regulator of ATG3, were also studied. Eventually, the role of autophagy in ATG3 related effects in colon cancer was checked.
RESULTS: ATG3 is upregulated in colon cancer tissues and cells demonstrated by qPCR and IHC. ATG3 knockdown significantly suppressed proliferation and invasion of colon cancer cells indicated by plate clone formation and Transwell invasion assays. The expression of miR-431-5p is downregulated and negatively correlates with ATG3 in colon cancer. Furthermore, luciferase report system, plate clone formation and Transwell invasion assays demonstrated that miR-431-5p could prohibit cell proliferation and invasion via directly targeting ATG3 in colon cancer. Eventually, Western blot, plate clone formation and Transwell invasion assays proved that autophagy block could antagonize the promotive functions of ATG3 on proliferation and invasion in cancer suggesting autophagy activation accounts for the promotive role of ATG3 on proliferation and invasion in colon cancer.
CONCLUSION: Collectively, ATG3 upregulation, caused by downregulated miR-435-5p, promotes proliferation and invasion via an autophagy-dependent manner in colon cancer suggesting that miR-431-5p/ATG3/autophagy may be a potential therapeutic target in colon cancer.
© 2019 Huang et al.

Entities:  

Keywords:  ATG3; autophagy; colon cancer; invasion; miR-431-5p; proliferation

Year:  2019        PMID: 31849517      PMCID: PMC6911302          DOI: 10.2147/CMAR.S226828

Source DB:  PubMed          Journal:  Cancer Manag Res        ISSN: 1179-1322            Impact factor:   3.989


Introduction

Colon cancer is one of the most prevalent and fatal malignant diseases both in developing and developed countries. Surgical resection and chemoradiotherapy, the main treatments for colon cancer, is effective for colon cancer at an early stage (stage 0 and I); however, the prognostic outcome of colon cancer patients at advanced stages (II-IV) is unsatisfactory.1–3 Therefore, more efforts should be taken to identify critical regulators in carcinogenesis and to reveal the corresponding mechanism in colon cancer, which can potentially provide new diagnostic markers and therapeutic targets and eventually improve the treatment efficacy of colon cancer. Studies have revealed that autophagy, a conserved process of self-degradation, plays vital roles in mediating the functions of tumor relative factors almost at every stage of cancer, including carcinogenesis, recurrence, metastasis, as well as therapeutic sensitivity.4–7 Serving as the constitutive components of autophagy process, autophagy-associated proteins are critical regulators of autophagy. On the one hand, autophagy-associated proteins are in charge of autophagy modification upon receiving the regulatory signals from upstream regulators of autophagy, such as PI3K/AKT,8 AMPK,9 and MAPK.10 On the other hand, the aberrant expressions of autophagy-related proteins largely account for the abnormal status of autophagy.11–13 Notably, although the roles of autophagy in cancers are widely explored, few studies have focused on the role and mechanism of autophagy-associated proteins themselves in the malignant progression of tumors. Thus, studying the expression of autophagy-related proteins and exploring the underlying mechanisms may help to elucidate the molecular mechanism of cancer and present potential targets for clinical therapy. ATG3, serving as an E2-like enzyme, is an important autophagy regulator involving in LC3-B generation via promoting covalent binding of phosphatidylethanolamine to the C-terminal glycine of LC3-A, a key step for the membrane association of ATG8-like proteins.14 According to the available studies, ATG3 could mediate the functions of other tumor-related factors either in an autophagy-dependent or in the autophagy-independent manners, suggesting ATG3 may exert critical roles in carcinogenesis.15–18 Up to now, the expression and functions of ATG3 in colon cancer have not been revealed. Thus, in this study, we analyzed the expression of ATG3 in colon cancer and further explored functions and the underlying mechanism of aberrant expression of ATG3 in colon cancer. Our results demonstrate that ATG3 is upregulated in colon cancer tissues and cell lines, and ATG3 can promote proliferation and invasion of colon cancer cells by activating autophagy. Loss of miR-431-5p accounts for the overexpression of ATG3 and miR-431-5p can antagonize the oncogenic functions of ATG3 in colon cancer.

Materials and Methods

Tissue Samples

Twenty-four cases of colon cancer tissues and paired adjacent tumor tissues were collected from the resection tissues of newly diagnosed colon cancer patients with surgery in the department of general surgery of Xiangya Hospital of Central South University. The collected tissues were immediately divided into two parts, one was frozen in liquid nitrogen for RNA extraction, and one was fixed with formalin for paraffin sectioning. The study was approved by the Ethical Committee of Xiangya Hospital of Central South University and informed consents were signed by all patients before tissue collection.

Immunohistochemistry

Immunohistochemistry (IHC) was performed according to our previous study.19 Simply, paraffin-embedded sections were successively immersed in xylene and graded ethanol for dewaxing and re-hydration. After antigen retrieval and endogenous peroxidase activity blocking, the slides were subsequently incubated with rabbit anti-ATG3 polyclonal antibody (dilution: 1:150, catalog number: D221649, BBI, Shanghai, China) overnight at 4°C. Following three times washing, the slides were successively subjected to the rest processes including incubation with biotin-linked secondary antibody, PBS washing, incubation with streptavidin-HRP, DAB staining, and hematoxylin counterstaining. Eventually, the pictures were captured with the microscopic imaging system microscope (Olympus, Tokyo, Japan) and analyzed by two independent pathologists. Semiquantitative analysis of IHC results was carried out based on staining intensity and area according to our previous description.19,20

Cell Culture

Colon cancer cell lines, SW480, SW620, HCT116, and HCT15, being purchased from ATCC, were maintained with RPMI-1640 (BI, Jerusalem, Israel) plus 10% fetal bovine serum (BI, Jerusalem, Israel). NCM460, an immortalized colon epithelial cell line, was purchased from ATCC and cultured with M3 Base medium (INCELL, TX, USA) plus 10% FBS (BI, Jerusalem, Israel). Human embryonic kidney 293T cells were brought from Cell Bank of Typical Culture Preservation Committee of Chinese Academy of Sciences and cultured with DMEM plus 10% FBS (BI, Jerusalem, Israel). All cells were maintained in a humidified cell incubator at 37°C with 5% CO2. Chloroquine (CQ, Sigma, MI, USA) at 50μM was added into the culture medium for inhibition of autophagy flux.

siRNA and Plasmid Transfection

siATG3, miR-431-4p mimics, and pcDNA3.1-ATG3 plasmids were transfected into SW480 and HCT116 cells using Highgene transfection reagent (Abclonal, Wuhan, China) according to the manufacturer’s instruction. Specific siRNAs targeting ATG3 at 3ʹ-untranslated region and miR-431-5p mimics were synthesized by RiboBio Inc (Guangzhou, China). The sequences of siATG3 were 5ʹ-CAAGCTGTCATTCCAACAATA-3ʹ. The sequences of miR-431-5p mimic, mimic control, and siNC (negative control) were not offered by RiboBio Inc for commercial confidentiality.

RNA Isolation and Quantitative Reverse Transcription Polymerase Chain Reaction (qPCR)

Total RNA extraction and mRNA reverse transcription were performed according to the previous study.21 AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China) was applied to analyze the expression of ATG3 and miR-431-5p in colon cancer tissues and cells. The PCR reaction was run on the CFX Connect Real-Time System (Bio-Rad, CA, USA) and the results were analyzed with CFX Manager 2.0 (Bio-Rad, CA, USA). The sequences of primers are listed as follow. ATG3 mRNA forward primer:5ʹ-ACATGGCAATGGGCTACAGG-3ʹ(Tm, 60.40; GC%,55.00); ATG3 mRNA reverse primer: 5ʹ-CTGTTTGCACCGCTTATAGCA-3ʹ (Tm, 59.26; GC%, 47.62), product length, 108bp. ATG3 hnRNA forward primer: 5ʹ-GCTCGACTTTTCAGGGACCA-3ʹ (Tm, 59.97; GC%,55.00), ATG3 hnRNA reverse primer:5ʹ-TATGACGGGAGAAGGCAGGA-3ʹ (Tm, 60.03; GC%,55.00), product length, 202bp. GAPDH forward primer: 5ʹ- CAGCAAGAGCACAAGAGGAA-3ʹ(Tm, 58.11, GC%, 50.00), GAPDH reverse primer: 5ʹ- ATGGTACATGACAAGGTGCGG -3ʹ (Tm, 60.68, GC%, 52.38), product length, 156bp. The primers of miR-431-5p and U6 were purchased from the RiboBio Inc for commercial confidentiality.

Western Blot

Western blot was performed as previously described.3 Briefly, total proteins were extracted with RIPA buffer high-speed centrifugation at 4°C. After denature by 5×SDS loading buffer, proteins were loaded and separated by 10% SDS PAGE (30 μg/lane). Subsequently, the proteins were transferred onto polyvinylidene difluoride membranes (PVDF). Then, the membranes were blocked with 5% non-fat milk and incubated with the primary antibodies including ATG3 (dilution: 1:500, catalog number: D221649, BBI, Shanghai, China), β-Tubulin (dilution: 1:2000, catalog number: 100109-MM05T, Sino Biological, Beijing, China), LC3A/B (dilution: 1:1000, catalog number: A11280, Abclonal, Wuhan, China) at 4°C overnight. Next, after washing by TBST, subsequently incubated with secondary antibodies, and washing by TBST again, the protein bands were visualized using chemiluminescent HRP substrate (EpiZyme, Shanghai, China) via a FluorChem FC3 system (Proteinsimple, CA, USA).

Dual Luciferase Reporter Assay

Both psiCHECK2-wild-ATG3-3ʹUTR and psiCHECK2-mutant-ATG3-3ʹUTR luciferase report plasmids of ATG3 were constructed, respectively, according to manufacturer’s instruction (Promega Corporation, WI, USA). Then, luciferase reporter vectors were co-transfected with miR-451-5p mimics into 293T cells by using LipofectamineTM 2000 reagent (Thermo, MA, USA). Forty-eight hours later, the luciferase activity was detected by using a Dual-Luciferase Reporter detection System (Promega Corporation, WI, USA) and the signaling was collected with an Epoch2 spectrophotometer (BioTek, VT, USA). The relative luciferase activity was presented by the ratio of firefly luciferase to Renilla luciferase activity.

Plate Clone Formation Assay

Plate clone formation assay was performed as previously described.3 Briefly, colon cancer cells were seeded into six-well plates at a density of 800 cells/well. Eight days later, the cells were fixed with methanol and stained by 0.5% crystal violet. Clones containing more than fifty cells were counted under an inverse microscope (Nikon, Tokyo, Japan).

Transwell Invasion Assay

Transwell assay was applied as described in our previous paper with minor modifications.21 Briefly, 8-μm pore size transwell chambers (Costar, ME, USA) pre-coated with Matrigel (Corning, NY, USA) were used to evaluate the ability of cell invasion. 300 μL pure RPMI-1640 containing 2.5×104 cells were added into the upper chamber. The lower well was filled with 750μL RPMI 1640 medium plus 5% FBS as a chemoattractant. After culture at 37°C for twenty-four hours, the cells were fixed with methanol and stained by 0.5% crystal violet. After swabbing the cells above on the upper side of the membrane, the invasive cells were photoed and counted under a microscopic scope.

Statistical Analysis

All experiments were independently repeated for at least 3 times. Statistical analyses and statistical charts were conducted and produced using SPSS18.0 software and GraphPad Prism version 8. For comparisons between two groups, a Student’s t-test or chi-square test was used. Pearson correlation coefficients was adopted to analyze the expression correlation between miR-451-5p and ATG3. P <0.05 were considered to be statistically significant.

Results

ATG3 Is Upregulated in Colon Cancer

Firstly, we analyzed the expression of ATG3 in colon cancer based on the online data from TCGA and GEO using UALCAN22 and Oncomine database. As Figure 1A shows, ATG3 is significantly upregulated in colon cancer tissues, which is confirmed by two GEO data sets (Figure 1B and C). Compared with adjacent tumor tissues, upregulation of ATG3 is also validated in collected colon cancer tissues demonstrated by qPCR and IHC assays (Figure 1D and E). Thus, these results proved that ATG3 is upregulated and may serve as an oncogenic regulator in colon cancer.
Figure 1

ATG3 is upregulated in colon cancer tissues and cells.

Notes: Upregulation of ATG3 in colon cancer is supported by online data from TCGA (A) and GEO database (B and C). Upregulation of ATG3 in colon cancer is confirmed by qPCR (D) and IHC (E) in our collected tissues. COAD: colon adenocarcinoma, “Colon” and “Para-cancer” means normal tissues in this part. *Stands for P < 0.05; ***Stands for P < 0.001.

ATG3 is upregulated in colon cancer tissues and cells. Notes: Upregulation of ATG3 in colon cancer is supported by online data from TCGA (A) and GEO database (B and C). Upregulation of ATG3 in colon cancer is confirmed by qPCR (D) and IHC (E) in our collected tissues. COAD: colon adenocarcinoma, “Colon” and “Para-cancer” means normal tissues in this part. *Stands for P < 0.05; ***Stands for P < 0.001.

ATG3 Knockdown Inhibits Growth Proliferation and Invasion of Colon Cancer Cells

Next, we checked the expression of ATG3 in colon cancer cell lines. As indicated by Figure 2A and B, compared with the expression level in NCM460 cells, ATG3 was slightly upregulated in HCT15 and SW480 and significantly upregulated in SW620 and HCT116. Therefore, to explore the functions of ATG3 in colon cancer, specific siRNAs of ATG3 were introduced into SW620 and HCT116 cells to knock down ATG3 expression. Successful ATG3 knockdown was achieved, indicating by notably decreased protein level (Figure 2C). Subsequently, the proliferation and invasion of SW620 and HCT116 were analyzed by plate clone formation and Transwell invasion assays. Significant inhibitory effects of ATG3 knockdown on cell proliferation and invasion were observed demonstrated by fewer clones (Figure 2D), and less invasive cells (Figure 2E). Therefore, these results indicated ATG3 could promote proliferation and invasion in colon cancer.
Figure 2

ATG3 knockdown inhibits proliferation and invasion of colon cancer cells.

Notes: qPCR (A) and Western blot (B) show that ATG3 is upregulated in colon cancer cells compared with colon epithelial cell NCM460. (C) Western blot indicates that ATG3 is successfully knocked down in SW620 and HCT116 cells. ATG3 knockdown significantly suppresses proliferation and invasion of colon cancer cells demonstrated by plate clone formation (D) and Transwell assays (E). siNC stands for negative control small RNA; Ns stands for no significant difference; **Stands for P < 0.01; ***Stands for P < 0.001.

ATG3 knockdown inhibits proliferation and invasion of colon cancer cells. Notes: qPCR (A) and Western blot (B) show that ATG3 is upregulated in colon cancer cells compared with colon epithelial cell NCM460. (C) Western blot indicates that ATG3 is successfully knocked down in SW620 and HCT116 cells. ATG3 knockdown significantly suppresses proliferation and invasion of colon cancer cells demonstrated by plate clone formation (D) and Transwell assays (E). siNC stands for negative control small RNA; Ns stands for no significant difference; **Stands for P < 0.01; ***Stands for P < 0.001.

Downregulated miR-431-5p Accounts for the High Expression of ATG3 in Colon Cancer Cells

Both transcriptional and post-transcriptional mechanisms may account for the expression regulation.23,24 Hence, we detected the level of ATG3 hnRNA (heterogeneous nuclear RNA), the primary transcript products which can directly indicate transcript activity, between colon cancer cells and normal colon epithelium cells using qPCR. No significant difference was observed among SW620, HCT116, and NCM460 cells (). Furthermore, the TCGA data shows that methylation status of ATG3 promoter is comparable between colon and colon cancer tissues (). Thus, these results imply that post-transcript mechanisms such as miRNAs are involved in the regulation of ATG3 in colon cancer. Subsequently, potential miRNAs for targeting ATG3 were predicted via Starbase 2.0,25 miR-431-5p was selected for experimental validation for more supported AGO CLIP-seq experiment evidence, negative correlation to ATG3 in colon cancer, and positive correlation to the overall survival of colon cancer (data from OncomiR26) (). Indeed, downregulated miR-431-5p in colon cancer cells and tissues was indicated by qPCR (Figure 3A and B), and the expression of miR-431-5p was inversely correlated to ATG3 in colon cancer (Figure 3C). Accordingly, the level of ATG3 mRNA and protein could be dramatically decreased by miR-431-5p mimics in SW620 and HCT116 cells (). Importantly, compared to the negative control, miR-431-5p mimics could significantly decrease luciferase activity of 293T cells transfected with wild ATG3 3ʹUTR report plasmids; whereas, the inhibitory effect did not appear in 293T cells transfected with mutant ATG3 3ʹUTR report plasmids (Figure 3D). Thus, our results confirmed that miR-431-5p could directly target and inhibit ATG3 in colon cancer.
Figure 3

miR-431-5p is downregulated, inversely correlates with ATG3, and directly targets ATG3 in colon cancer.

Notes: (A and B) miR-431-5p is downregulated in colon cancer tissues and cells indicated by qPCR assay. (C) miR-431-5p expression is inversely associated with that of ATG3 in colon cancer indicating by Pearson correlations analysis (r = −0.5773, P <0.01). (D) Sketch of wild and mutant luciferase reports plasmids and dual luciferase reporter system assay shows that miR-432-5p can directly target ATG3. (E) Western blot shows that ATG3 can be inhibited by miR-431-5p mimics, which can be reversed by ectopic expression of ATG3. **Stands for P < 0.01; ***Stands for P < 0.001.

miR-431-5p is downregulated, inversely correlates with ATG3, and directly targets ATG3 in colon cancer. Notes: (A and B) miR-431-5p is downregulated in colon cancer tissues and cells indicated by qPCR assay. (C) miR-431-5p expression is inversely associated with that of ATG3 in colon cancer indicating by Pearson correlations analysis (r = −0.5773, P <0.01). (D) Sketch of wild and mutant luciferase reports plasmids and dual luciferase reporter system assay shows that miR-432-5p can directly target ATG3. (E) Western blot shows that ATG3 can be inhibited by miR-431-5p mimics, which can be reversed by ectopic expression of ATG3. **Stands for P < 0.01; ***Stands for P < 0.001.

Ectopic miR-431-5p Expression Suppresses Colon Cancer Progression by Targeting ATG3

Following, we explored the functions of miR-431-5p and the roles of ATG3 in miR-431-5p related functions in colon cancer. By ectopic expression of ATG3, we successfully rescued the expression of ATG3 in colon cancer cells transfected with miR-431-5p mimics (Figure 3E), which ensured the reliability of function experiments. As Figure 4A and B indicated, miR-431-5p mimics can significantly suppress the proliferation and invasion of colon cells, and these inhibitory effects on colon cancer cells were almost released upon ectopic expression of ATG3. Thus, miR-431-5p can inhibit the proliferation and migration of colon cancer cells by targeting ATG3.
Figure 4

miR-431-5p could inhibit proliferation and invasion of colon cancer cells by targeting ATG3.

Notes: (A) As the results of plate clone formation assay indicated, miR-431-5p mimic significantly inhibits proliferation of SW620 and HCT116 which could be subsequently rescued by restoration of ATG3. (B) miR-431-5p mimic significantly inhibits invasion of SW620 and HCT116 which could be subsequently rescued by ectopic expression of ATG3, demonstrating by Transwell assay. **Stands for P < 0.01; ***Stands for P < 0.001.

miR-431-5p could inhibit proliferation and invasion of colon cancer cells by targeting ATG3. Notes: (A) As the results of plate clone formation assay indicated, miR-431-5p mimic significantly inhibits proliferation of SW620 and HCT116 which could be subsequently rescued by restoration of ATG3. (B) miR-431-5p mimic significantly inhibits invasion of SW620 and HCT116 which could be subsequently rescued by ectopic expression of ATG3, demonstrating by Transwell assay. **Stands for P < 0.01; ***Stands for P < 0.001.

ATG3 Promotes Proliferation and Invasion of Colon Cancer Cells in an Autophagy-Dependent Manner

Considering ATG3 is an autophagy-related protein, we further explored whether ATG3 exerts its functions by modulating autophagy in colon cancer. As Figure 5A demonstrated, ATG3 knockdown significantly inhibited the accumulation of LC3B, an autophagy marker for indicating autophagosome formation, and these inhibitory effects could be observed under chloroquine (CQ) treatment, excluding the possibility of degradation obstacle accounting for LC3B accumulation, and, suggesting that ATG3 can suppress autophagy flux in colon cancer. Next, we investigated the role of autophagy in ATG3 related functions in colon cancer. Re-expression of ATG3 with or without CQ addition was successfully applied in colon cancer cells with ATG3 knockdown (Figure 5B). Subsequently, function experiments showed that CQ treatment could significantly antagonize the rescue effects of ATG3 restoration on proliferation and invasion in colon cancer (Figure 5C and D). Consequently, our results manifested that ATG3 can promote proliferation and invasion of colon cancer cells in an autophagy-dependent manner.
Figure 5

ATG3 promotes proliferation and invasion of colon cancer cells in an autophagy-dependent manner.

Notes: (A) ATG3 knockdown inhibits autophagy indicated by less LC3B accumulation with or without CQ (50μM) addition. (B) Ectopic expression of ATG3 restores autophagy flux of colon cancer cells demonstrated by LC3B accumulation. (C and D) CQ (50μM) treatment antagonizes the promotive effects of ATG3 on proliferation and invasion of colon cancer cells indicated by plate clone formation and Transwell assays. **Stands for P < 0.01; ***Stands for P < 0.001.

ATG3 promotes proliferation and invasion of colon cancer cells in an autophagy-dependent manner. Notes: (A) ATG3 knockdown inhibits autophagy indicated by less LC3B accumulation with or without CQ (50μM) addition. (B) Ectopic expression of ATG3 restores autophagy flux of colon cancer cells demonstrated by LC3B accumulation. (C and D) CQ (50μM) treatment antagonizes the promotive effects of ATG3 on proliferation and invasion of colon cancer cells indicated by plate clone formation and Transwell assays. **Stands for P < 0.01; ***Stands for P < 0.001.

Discussion

Although the expression patterns of autophagy-related proteins have been exclusively revealed in multiple cancers, almost all studies focus on only three proteins: BECN1, p62, and LC3B.27–29 As for ATG3, its expression in tumors has been rarely revealed. According to the expression profiles from the TCGA database, ATG3 upregulation is observed in most type of tumors (data not shown) suggesting ATG3 is an important regulator in carcinogenesis. A recent study shows that ATG3 is upregulated in gastric cancer tissues, but acts as a favorable prognostic factor supported by overall survival analysis.30 Accordingly, we proved that ATG3 is also upregulated in colon cancer tissues and cell lines indicating ATG3 may serve as an oncogenic regulator in colon cancer. No significant difference of ATG3 hnRNAs between colon epithelial cells and colon cancer cells was observed indicating post-transcriptional regulators involved in the regulation of ATG3. Micro RNAs (miRNAs), a type of non-coding RNA with 21–24 nucleotides in length, are the most common negative regulators of expression which can cause mRNA translation inhibition or degradation via directly binding its target mRNAs at 3ʹ untranslated region (3ʹUTR). Several miRNAs including miR-495,31 −23a,32 −155,33 −206,34 −1,35 and −36536 have been confirmed to target ATG3 in both malignant and non-malignant cells suggesting miRNAs may account for the dysregulation of ATG3 in colon cancer. Indeed, we validated that miR-431-5p is downregulated and inversely correlated to ATG3 in colon cancer. Moreover, miR-451-5p can directly bind and decrease ATG3 level in colon cancer. Therefore, we originally reveal that downregulation of miR-431-5p accounts for ATG3 upregulation in colon cancer. The roles of ATG3 in tumorigenesis and progression are tissue-dependent demonstrated by the available studies. Generally, ATG3 serves as a positive and protective factor in tumors. Oncogenic lncRNAs (long noncoding RNAs), including lnc-HOTAIR,17 -Meg3,15 -PVT136 and -GAS5,32 promote tumorigenesis and progression via stabilizing ATG3 mRNA by specifically sponging miRNAs targeting ATG3 like miR-365 and miR-23a, or directly interacting with ATG3 mRNA in distinct cancers. Meanwhile, sustained levels of ATG3 can impair the resistance of malignant cells to DNA-damaging drugs.16 Consistent with most research findings, the oncogenic roles of ATG3 in colon cancer, such as promoting proliferation and invasion, are confirmed by our results. Moreover, miR-431-5p, serving as a tumor-suppressive regulator, can significantly inhibit colon cancer progression by targeting ATG3. However, additional efforts should be paid to reveal the underlying mechanism of miR-431-5p deregulation in colon cancer. In addition to acting in an autophagy-dependent manner, autophagy-related proteins can also regulate tumorigenesis and progression in an autophagy-independent manner manifesting by numerous studies.18,37–39 For example, BECN1 can promote degradation of MCL1, one of oncogenes, via physical interaction, being independent of autophagy.40 Similarly, Y203 phosphorylation of ATG3 is not critical for autophagy induction but is important in sensitizing cancer cells to DNA-damaging agents.16 Moreover, the pro-apoptotic roles of ATG3 for attached intestinal epithelial cells are independent of ATG3 related autophagy.18 Thus, it is necessary to distinguish the function of autophagy in autophagy-related proteins. In our study, CQ treatment significantly antagonized the promotive effects of ATG3 on colon cancer cells, suggesting that ATG3 promotes colon cancer progression in an autophagy-dependent manner.

Conclusions

Collectively, we demonstrate that upregulation of ATG3, a result of the loss of miR-431-5p, can promote cell proliferation and invasion in colon cancer. miR-431-5p restoration can significantly inhibit proliferation and invasion via targeting ATG3 in colon cancer. Moreover, we further reveal that ATG3 promotes colon cancer progression in an autophagy-dependent manner suggesting that miR-451-5p/ATG3/autophagy may be an effective therapeutic target in colon cancer.
  40 in total

1.  MicroRNA-1 overexpression increases chemosensitivity of non-small cell lung cancer cells by inhibiting autophagy related 3-mediated autophagy.

Authors:  Li Hua; Guirong Zhu; Jianguo Wei
Journal:  Cell Biol Int       Date:  2018-06-15       Impact factor: 3.612

2.  MicroRNA-495 regulates starvation-induced autophagy by targeting ATG3.

Authors:  Wen Li; Yue Yang; Xiaoyan Hou; Haixia Zhuang; Zijun Wu; Zhiyi Li; Runmin Guo; Hao Chen; Chunxia Lin; Wangtao Zhong; Yusen Chen; Keng Wu; Liangqing Zhang; Du Feng
Journal:  FEBS Lett       Date:  2016-03-04       Impact factor: 4.124

3.  Gene expression: layers of gene regulation.

Authors:  Bryony Jones
Journal:  Nat Rev Genet       Date:  2015-03       Impact factor: 53.242

4.  PTK2-mediated degradation of ATG3 impedes cancer cells susceptible to DNA damage treatment.

Authors:  Ke Ma; Wan Fu; Ming Tang; Chaohua Zhang; Tianyun Hou; Ran Li; Xiaopeng Lu; Yanan Wang; Jingyi Zhou; Xue Li; Luyao Zhang; Lina Wang; Ying Zhao; Wei-Guo Zhu
Journal:  Autophagy       Date:  2017-01-19       Impact factor: 16.016

5.  Knockdown of Long Non-Coding RNA GAS5 Increases miR-23a by Targeting ATG3 Involved in Autophagy and Cell Viability.

Authors:  Lexing Li; Chunxiao Huang; Yulong He; Zhan Sang; Guoquan Liu; Hanchuan Dai
Journal:  Cell Physiol Biochem       Date:  2018-08-03

Review 6.  Personalizing colon cancer adjuvant therapy: selecting optimal treatments for individual patients.

Authors:  Rodrigo Dienstmann; Ramon Salazar; Josep Tabernero
Journal:  J Clin Oncol       Date:  2015-04-27       Impact factor: 44.544

7.  Flotillin-2 promotes metastasis of nasopharyngeal carcinoma by activating NF-κB and PI3K/Akt3 signaling pathways.

Authors:  Jie Liu; Wei Huang; Caiping Ren; Qiuyuan Wen; Weidong Liu; Xuyu Yang; Lei Wang; Bin Zhu; Liang Zeng; Xiangling Feng; Chang Zhang; Huan Chen; Wei Jia; Lihua Zhang; Xiaomeng Xia; Yuxiang Chen
Journal:  Sci Rep       Date:  2015-07-24       Impact factor: 4.379

8.  Expression of Autophagy-Related Proteins in Different Types of Thyroid Cancer.

Authors:  Hye Min Kim; Eun-Sol Kim; Ja Seung Koo
Journal:  Int J Mol Sci       Date:  2017-03-02       Impact factor: 5.923

9.  Nuclear localization of Beclin 1 promotes radiation-induced DNA damage repair independent of autophagy.

Authors:  Fei Xu; Yixuan Fang; Lili Yan; Lan Xu; Suping Zhang; Yan Cao; Li Xu; Xiaoying Zhang; Jialing Xie; Gaoyue Jiang; Chaorong Ge; Ni An; Daohong Zhou; Na Yuan; Jianrong Wang
Journal:  Sci Rep       Date:  2017-03-27       Impact factor: 4.379

Review 10.  The Roles of Autophagy in Cancer.

Authors:  Chul Won Yun; Sang Hun Lee
Journal:  Int J Mol Sci       Date:  2018-11-05       Impact factor: 5.923

View more
  11 in total

1.  Proteomic profiling of plasma exosomes from patients with B-cell acute lymphoblastic leukemia.

Authors:  Shicong Zhu; Cheng Xing; Ruijuan Li; Zhao Cheng; Mingyang Deng; Yunya Luo; Heng Li; Guangsen Zhang; Yue Sheng; Hongling Peng; Zhihua Wang
Journal:  Sci Rep       Date:  2022-07-13       Impact factor: 4.996

2.  Circ_0001367 inhibits glioma proliferation, migration and invasion by sponging miR-431 and thus regulating NRXN3.

Authors:  Liang Liu; Peng Zhang; Xuchen Dong; Haoran Li; Suwen Li; Shan Cheng; Jiaqi Yuan; Xuejun Yang; Zhiyuan Qian; Jun Dong
Journal:  Cell Death Dis       Date:  2021-05-25       Impact factor: 8.469

Review 3.  Exploring the role of non-coding RNAs in autophagy.

Authors:  Soudeh Ghafouri-Fard; Hamed Shoorei; Mahdi Mohaqiq; Jamal Majidpoor; Mohammad Amin Moosavi; Mohammad Taheri
Journal:  Autophagy       Date:  2021-02-18       Impact factor: 13.391

4.  Prognostic Value of Autophagy-related Proteins in Human Gastric Cancer.

Authors:  Minmin Wu; Bicheng Chen; Xiaodong Pan; Jiadong Su
Journal:  Cancer Manag Res       Date:  2020-12-31       Impact factor: 3.989

5.  Identification of an autophagy-related gene signature for survival prediction in patients with cervical cancer.

Authors:  Hengyu Chen; Qingchun Deng; Wenwen Wang; Huishan Tao; Ying Gao
Journal:  J Ovarian Res       Date:  2020-11-07       Impact factor: 4.234

6.  The role of human umbilical cord mesenchymal stem cells-derived exosomal microRNA-431-5p in survival and prognosis of colorectal cancer patients.

Authors:  Muwen Qu; Junyi Li; Zifu Hong; Fei Jia; Yinghua He; Lingling Yuan
Journal:  Mutagenesis       Date:  2022-04-23       Impact factor: 2.954

7.  Mixotrophy in a Local Strain of Nannochloropsis&amp;nbsp;granulata for Renewable High-Value Biomass Production on the West Coast of Sweden.

Authors:  Valeria Villanova; Christian Galasso; Giovanni Andrea Vitale; Gerardo Della Sala; Johan Engelbrektsson; Niklas Strömberg; Kashif Mohd Shaikh; Mats X Andersson; Fortunato Palma Esposito; Susanne Ekendahl; Donatella De Pascale; Cornelia Spetea
Journal:  Mar Drugs       Date:  2022-06-28       Impact factor: 6.085

8.  miR-431-5p regulates cell proliferation and apoptosis in fibroblast-like synoviocytes in rheumatoid arthritis by targeting XIAP.

Authors:  Yuejiao Wang; Kailin Zhang; Xiaowei Yuan; Neili Xu; Shuai Zhao; Linxin Hou; Lili Yang; Ning Zhang
Journal:  Arthritis Res Ther       Date:  2020-10-06       Impact factor: 5.156

Review 9.  Melatonin and Autophagy in Aging-Related Neurodegenerative Diseases.

Authors:  Fang Luo; Aaron F Sandhu; Wiramon Rungratanawanich; George E Williams; Mohammed Akbar; Shuanhu Zhou; Byoung-Joon Song; Xin Wang
Journal:  Int J Mol Sci       Date:  2020-09-28       Impact factor: 5.923

10.  FBXL19‑AS1 promotes the progression of nasopharyngeal carcinoma by acting as a competing endogenous RNA to sponge miR‑431 and upregulate PBOV1.

Authors:  Hongjun Dong; Chao Huang; Jingjing Huang
Journal:  Mol Med Rep       Date:  2021-07-19       Impact factor: 2.952

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.