Literature DB >> 31849419

Antibiotic-resistant Escherichia coli in deer and nearby water sources at Safari parks in Bangladesh.

Md Samun Sarker1, Abdul Ahad1, Saurav Kumar Ghosh1, Md Shahriar Mannan2, Arup Sen1, Sirazul Islam3, Md Bayzid4, Zamila Bueaza Bupasha1.   

Abstract

BACKGROUND AND AIM: The emergence and rapid dissemination of multidrug-resistant (MDR) bacteria in different ecosystems is a growing concern to human health, animal health, and the environment in recent years. The study aimed to determine the antibiotic resistance in Escherichia coli from deer and nearby water sources at two different Safari parks in Bangladesh.
MATERIALS AND METHODS: A number of 55 fresh fecal samples of deer and six water samples from nearby lakes were collected from two Safari parks. Samples were processed, cultured, and carried out biochemical tests for E. coli. The antibiotic susceptibility was determined by disk diffusion method. To identify the resistance genes, polymerase chain reaction was performed.
RESULTS: A total of 32 E. coli isolates from 55 fecal samples and 6 of 6 E. coli isolates from lake water were isolated. From fecal E. coli isolates, ampicillin and sulfamethoxazole were 90.63% (n=29/32) resistant and 87.5% (n=28/32) were resistant to tetracycline and nalidixic acid. High resistance was also observed to other antibiotics. On the contrary, all E. coli isolates from water sources were 100% (n=6/6) resistant to ampicillin, tetracycline, sulfamethoxazole, and nalidixic acid. MDR was revealed in all water samples, whereas 96.88% (n=31/32) was found in fecal isolates. A number of bla TEM, tet A, and Sul2 genes were detected from both isolates.
CONCLUSION: This study for the 1st time highlights, a significant proportion of E. coli isolates in wildlife deer and nearby water sources were MDR in Bangladesh. Copyright: © Sarker, et al.

Entities:  

Keywords:  Escherichia coli; antibiotic-resistant; deer; lake; multidrug-resistant

Year:  2019        PMID: 31849419      PMCID: PMC6868268          DOI: 10.14202/vetworld.2019.1578-1583

Source DB:  PubMed          Journal:  Vet World        ISSN: 0972-8988


Introduction

Antibiotic resistance in wildlife is significant for human health due to the escalating of zoonotic diseases’ importance and predicting the emergence and dissemination of resistant pathogens among different ecosystems [1]. As major reservoirs, the domestic animals are usually considered for antibiotic-resistant bacteria. In recent times, interest in resistant bacteria and corresponding resistant genes isolated from wildlife and the environment has increased. It is evident that resistant bacteria at different environmental compartments act as a vector and reservoirs due to widespread of multidrug-resistant (MDR) bacteria [2]. Escherichia coli, commensal bacteria of warm-blooded animals, is widely used as fecal contamination indicator [3]. The presence of pathogenic strains of E. coli in wild animals, such as deer, may comprise a risk for human and other animals’ health [4]. The occurrence of antibiotic resistance in E. coli isolated from wild animals is not directly exposed to antibiotic treatment [5,6]. Through the attainment of resistant bacteria from human settings, agriculture, pharmaceuticals, hospitals, and associated tainted environments, they may be infected with antibiotic-resistant bacteria [7]. Even, in the pristine environments, where there was no direct human influence such as habitation, hospitals, and agricultural farming, resistant bacteria were reported [8,9]. There are a large number of captive deer at two different Safari parks in Bangladesh. Antimicrobials are not administered except for severe injury or disease outbreak. The purpose of raised deer at Safari parks is to conserve and for recreation of visitors. Nearby of deer habitat in Safari parks have a number of lakes that are used as the main source of drinking water of deer, easily polluted by visitors, droppings of wild birds and farming. The occurrence of antibiotic-resistant E. coli in wildlife and their environments have been reported worldwide [10-13]. Antibiotic-resistant E. coli has been reported in Bengal tigers at Safari parks in Bangladesh [14]. However, to the best of our knowledge, no previous research has been focused on antibiotic-resistant in E. coli isolated from deer and surrounding environments in Bangladesh. This study aimed to assess the antibiotic-resistant with some corresponding resistant genes of E. coli in deer and nearby aquatic sources at two different Safari parks in Bangladesh.

Materials and Methods

Ethical approval

Since samples were collected from the environment, ethical approval was not necessary for this study.

Sample collection

Environmental fresh fecal swab samples were collected aseptically from deer from two different Safari parks in Bangladesh, namely, Bangabandhu Sheikh Mujib Safari Park, Gazipur (latitude 23.71 and longitude 90.42, n=30) and Bangabandhu Sheikh Mujib Safari Park, Cox’s Bazar (latitude 21.43 and longitude 92.01, n=25), during the period of January-March 2016. It is interesting to note that the name of both Safari parks are same but they differ only in location. Immediately after collection, all samples were stored into a sterile screw-capped Falcon tube containing buffered peptone water (BPW). Along with feces, three water samples were also collected from each Safari park’s lake during that time. In a sterile Falcon tube, 40 ml of water sample was taken. Fecal and water samples were kept into an icebox and shipped in an unbroken freeze chain to the Poultry Research and Training Centre (PRTC), Chattogram Veterinary and Animal Sciences University (CVASU) as early as possible.

E. coli isolation and identification

Fecal sample in BPW (Oxoid, UK) was incubated overnight at 37°C for enrichment. One loop full of enriched broth was plated onto MacConkey agar (Oxoid, UK) from BPW, incubated for 18-24 h at 37°C. 50 μl of water sample was directly inoculated onto MacConkey agar and incubated overnight at 37°C. On MacConkey agar, large pink-colored colonies were suspected as E. coli. A single isolated colony from MacConkey agar was subjected onto Eosin Methylene Blue (EMB; Merck, Mumbai) agar, characteristic green colonies with metallic sheen indicated as positive one. Different biochemical tests were conducted to confirm E. coli as earlier described by Gupta et al. [15]. Positive E. coli isolates were preserved in trypticase soy broth (TSB; Oxoid, UK) with 15% glycerol at −80°C until use.

Antibiotic susceptibility testing

The disk diffusion method was performed on Mueller-Hinton agar (Oxoid, UK) plate to assess the antibiotic susceptibility of E. coli isolates according to the guidelines and recommendations of the Clinical and Laboratory Standards Institute (CLSI) [16]. The following 10 antibiotics that have both human and veterinary importance were tested: Ampicillin (10 µg), tetracycline (30 µg), ceftriaxone (30 µg), erythromycin (15 µg), chloramphenicol (30 µg), sulfamethoxazole (25 µg), nalidixic acid (30 µg), ciprofloxacin (5 µg), colistin (10 µg), and gentamicin (10 µg) (HiMedia, India). The susceptibility results were interpreted by the CLSI [16]. Isolate being resistant to at least three antimicrobial agents was defined as multidrug resistance [17].

DNA extraction

DNA was extracted by the boiling method [18] with slight modifications. In 1.5 ml sterile Eppendorf tube, 2-3 fresh colonies were taken that contained 200 µl of deionized water and vortexed thoroughly. The Eppendorf tube was heated at 99°C for 15 min and centrifuged at 15,000 rpm for 2 min. The collected supernatant was used as a DNA template and stored at −20°C until use.

Detection of antibiotic-resistant genes

Polymerase chain reaction (PCR) was performed to detect the antibiotic-resistant genes in a final volume of 25 μl consisting of 12.5 μl dream Taq PCR Master Mix (Thermo Scientific, USA), 0.5 μl of each primer, 1 μl template DNA, and 10.5 μl deionized water. Previously published PCR conditions were used to determine the presence of blaTEM, tet A, tet B, tet C, and sul2 genes (Table-1) [19-22]. PCR was carried out using a thermocycler (2720 Thermal Cycler, Applied Biosystems, USA). The amplified products of PCR were then visualized on 1.5% agarose gels stained with ethidium bromide (0.5 μg/ml) (Sigma-Aldrich, USA). A DNA ladder (100-bp, Thermo Fisher Scientific) was used to determine the size of PCR products. The gel was inspected visually and photographed using an ultraviolet transilluminator (BDA digital, Biometra GmbH, Germany). As a positive control for a particular gene, previously isolated strain harboring of that gene was used from Microbiology Laboratory, CVASU.
Table 1

Primers used to identify antibiotic-resistant genes, blaTEM, tet A, tet B, tet C, and sul2.

Target genePrimer sequence (5’- 3’)Amplicon size (bp)Annealing temperature (°C)References
blaTEMF: TACGATACGGGAGGGCTTAC R: TTCCTGTTTTTGCTCACCCA71653[19]
tet AF: GCTACATCCTGCTTGCCTTC R: CATAGATCGCCGTGAAGAGG21055[20]
tet BF: TTGGTTAGGGGCAAGTTTTG R: GTAATGGGCCAATAACACCG65955[21]
tet CF: CTTGAGAGCCTTCAACCCAG R: ATGGTCGTCATCTACCTGCC41855[21]
sul2F: CGGCATCGTCAACATAACCT R: TGTGCGGATGAAGTCAGCTC72166[22]
Primers used to identify antibiotic-resistant genes, blaTEM, tet A, tet B, tet C, and sul2.

Statistical analysis

Data were managed into a spreadsheet program (Excel 2010, Microsoft Corporation). The proportion of samples with 95% confidence interval and other descriptive statistics were calculated by QuickCalcs GraphPad software.

Results

Proportion and cultural characteristics of E. coli

A proportion of 60% (n=18/30, 95% CI 42.29-75.44) E. coli from deer feces and 100% (n=3/3, 95% CI 38.25-100) E. coli from water samples was isolated from Bangabandhu Sheikh Mujib Safari Park, Gazipur, whereas 56% (n=14/25, 95% CI 37.05-73.35) and 100% (n=3/3, 95% CI 38.25-100) E. coli found in deer feces and water samples, respectively, at Bangabandhu Sheikh Mujib Safari Park, Cox’s Bazar. Overall, 58.18% (n=32/55, 95% CI 45.02-70.27) E. coli from feces and 100% (n=6/6, 95% CI 55.72-100) E. coli in water samples were isolated. Positive E. coli isolates produced bright pink colonies on MacConkey agar and characteristic green colonies with the metallic sheen on EMB agar. In methyl red and indole production test, all isolates were positive but negative to Voges–Proskauer test.

Antibiotic resistance

Of the 32 tested isolates of E. coli from feces, 90.63% (n=29/32) were resistant to ampicillin and sulfamethoxazole and 87.5% (n=28/32) were resistant to tetracycline and nalidixic acid. Resistance to erythromycin and chloramphenicol was 56.25% (n=18/32) and 53.13% (n=17/32), respectively. Results also dictated 93.75% (n=30/32) of E. coli isolates were sensitive to colistin followed by ceftriaxone (81.25%, n=26/32) and gentamicin (56.25%, n=18/32). On the contrary, all E. coli isolates were resistant to ampicillin, tetracycline, sulfamethoxazole, and nalidixic acid from water. None of the isolates were resistant to ceftriaxone and ciprofloxacin. Antibiotic susceptibility to different antibiotics is illustrated in Figure-1a and b. All of the E. coli isolates from deer unveiled that 96.88% (n=31/32) were MDR, whereas 100% (n=6/6) MDR were revealed in water samples. The common antibiotic-resistant patterns were ampicillin, tetracycline, sulfamethoxazole, and nalidixic acid for both feces and water isolates. There were 20 and four different MDR patterns were identified in fecal and water isolates, respectively (Table-2).
Figure-1

(a) Antibiogram profile of deer Escherichia coli isolates against different antibiotics (b) Antibiogram profile of water E. coli isolates against different antibiotics.

Table 2

Antibiotic-resistant patterns in Escherichia coli isolates from deer (n=32) and water (n=6).

Antibiotic-resistant patternsNumber of isolatesSource
AMP-TE1Feces
AMP-E-C1Feces
AMP-TE-SXT-NA4Feces
TE-CRO-SXT-NA1Feces
TE-E-C-CIP1Feces
AMP-TE-SXT-NA-CN1Feces
AMP-TET-E-C-SXT1Feces
AMP-TE-E-SXT-NA4Feces
AMP-E-SXT-NA-CN1Feces
AMP-TE-C-SXT-NA1Feces
AMP-E-SXT-NA-CIP1Feces
AMP-TE-E-C-SXT-NA4Feces
AMP-TE-CRO-E-SXT-NA1Feces
AMP-TE-C-SXT-NA-CN2Feces
TE-CRO-E-C-SXT-NA1Feces
AMP-C-SXT-NA-CIP-CN1Feces
AMP-TE-C-SXT-NA-CIP2Feces
AMP-TE-E-C-SXT-NA-CIP2Feces
AMP-TE-CRO-C-SXT-NA-CN1Feces
AMP-TE-CRO-E-SXT-NA-CIP1Feces
AMP-TE-SXT-NA1Water
AMP-TE-SXT-NA-CN1Water
AMP-TE-SXT-NA-CT2Water
AMP-TE-E-C-SXT-NA2Water

AMP=Ampicillin, TE=Tetracycline, CRO=Ceftriaxone, E=Erythromycin, C=Chloramphenicol, SXT=Sulfamethoxazole, NA=Nalidixic acid, CIP=Ciprofloxacin, CT=Colistin, CN=Gentamicin

Antibiotic-resistant patterns in Escherichia coli isolates from deer (n=32) and water (n=6). AMP=Ampicillin, TE=Tetracycline, CRO=Ceftriaxone, E=Erythromycin, C=Chloramphenicol, SXT=Sulfamethoxazole, NA=Nalidixic acid, CIP=Ciprofloxacin, CT=Colistin, CN=Gentamicin (a) Antibiogram profile of deer Escherichia coli isolates against different antibiotics (b) Antibiogram profile of water E. coli isolates against different antibiotics.

Antibiotic-resistant genes

We have characterized some of the targeting antibiotic-resistant genes on a molecular basis, namely, blaTEM (β-lactamase resistant gene), tet A, tet B, tet C (tetracycline-resistant gene), and sul2 (sulfur drug-resistant gene). In case of feces, of 29 ampicillin and sulfamethoxazole resistant isolates, 58.62% (n=17/29) and 34.48% (n=10/29) exposed blaTEM and sul2 genes, respectively. Eleven (39.29%) of the 28 tetracycline-resistant isolates contained the tet A gene. On the contrary, 66.67% (n=4/6) of water isolates contained blaTEM gene, whereas 33.33% (n=2/6) of isolates carried both tet A and sul2 gene. tet B and tet C gene were not exposed in any of the tested isolates from both sources.

Discussion

In the present study, the overall proportion of fecal carriage E. coli from deer at two different Safari parks was 58.18%. Based on exhaustive literature searches, there are no available reports that predate our detection of E. coli in deer at Safari parks in Bangladesh. A similar study reported by Alonso et al. [23] who found 59% of E. coli from wild deer, whereas Carroll et al. [24] isolated 83% of E. coli. These variations may be due to the sample size, contamination of fecal samples with the surrounding environment, and geographical distribution. Deer E. coli isolates were subjected to 10 antimicrobial agents to assess the antibiotic susceptibility pattern. E. coli isolates were resistant to at least two antibiotics, most commonly practiced in human and veterinary medicine in Bangladesh. In our study, the common phenotypic-resistant patterns were ampicillin, tetracycline, sulfamethoxazole, and nalidixic acid. We found that 90.63% (n=29/32) of resistance to ampicillin and sulfamethoxazole and 87.5% (n=28/32) of resistance to tetracycline and nalidixic acid. Higher resistance was also observed against erythromycin and chloramphenicol at 56.25% (n=18/32) and 53.13% (n=17/32), respectively. This resistance profile is higher than Li et al. [25] who reported that ampicillin, sulfamethazine, and tetracycline were 71.4%, 82.7%, and 80% resistant, respectively, in Northeastern China. However, 93.75% (n=30/32) of E. coli isolates were sensitive to colistin followed by ceftriaxone (81.25%) and gentamicin (56.25%). Resembling to our study, antibiotic-resistant E. coli were found in the environmental and biological sources such as human urine, human feces, sheep, goat, cattle, chicken, pigeon, broiler, duck, soil, and drain sewage in Bangladesh [26,27]. The results we have observed are a matter of great concern as to how these deer acquired resistance, though they were treated very rarely with these human-associated antibiotics at Safari parks. This may be due to deforestation and spillage of organism from human dwellings and wildlife in both directions. From the nearby lakes, water samples were collected as lake water is supplied to deer as their drinking water. E. coli was isolated from all water samples, demonstrated the same resistance pattern as like deer isolates. About 100% of water isolates were resistant to ampicillin, tetracycline, sulfamethoxazole, and nalidixic acid. The studied area is in the main route of bird migration in Bangladesh and lake hosts thousands of wild birds. The wild birds can act as vectors and reservoirs of antibiotic-resistant bacteria that have veterinary and medical importance [28]. Wild birds pick up food from various environments and human surroundings are heavily polluted by resistant bacteria in Bangladesh [29] and lead to polluting natural water reservoirs such as lakes and rivers by inducing fecal contaminates [30] and dissemination of resistant bacteria. We have speculated that antibiotic resistance might have been transferred to deer through E. coli contaminated water. Moreover, in Bangladesh, animal manure is commonly used in agricultural application, which is a significant pathway into the terrestrial environment for the introduction of resistant bacteria. As a result, deer may acquire resistant bacteria during their grazing on pastureland. Our study revealed that 96.88% of deer E. coli isolates were MDR, whereas 100% MDR was found in water isolates. Due to the indiscriminate victimization of antimicrobial agents, MDR strains may apparently occur with high incidence [31]. However, the findings of the MDR patterns of this study will help for the choice of drugs for the veterinarians to practice at Safari parks. A number of different resistant genes, namely, blaTEM, tet A, and sul2 were detected in both fecal and water E. coli in the present study. To the best of author’s knowledge, there are no previous reports on antibiotic-resistant with associated genes in E. coli from deer population at Safari parks in Bangladesh. The findings were in line with the data obtained from other countries by Alonso et al. [23] and Li et al. [25] who reported blaTEM, tet A, and sul2 genes in E. coli isolates in wild deer. The spreading of resistance genes in natural environment may be a great threat to human and animal health.

Conclusion

The study dictated the presence of MDR and some of their corresponding resistant genes in deer and nearby aquatic sources at Safari parks in Bangladesh. Nationwide effective antimicrobial resistance surveillance is badly needed to monitor the antimicrobials use and understanding the role of antimicrobial-resistant bacteria in the domestic and wild environments to diminish the public health challenge.

Authors’ Contributions

MSS and AA conceived and designed the study. MSS and SKG collected samples from Safari parks. MSS, ZBB, and MB performed laboratory experiments. AS and MSM analyzed the data. MSS wrote the manuscript. AA and SI critically reviewed the manuscript. All the authors read and approved the manuscript for publication.
  24 in total

1.  Multiplex PCR for the detection of tetracycline resistant genes.

Authors:  L K Ng; I Martin; M Alfa; M Mulvey
Journal:  Mol Cell Probes       Date:  2001-08       Impact factor: 2.365

2.  Food-borne zoonotic pathogens and antimicrobial resistance of indicator bacteria in urban wild boars in Barcelona, Spain.

Authors:  Nora Navarro-Gonzalez; Encarna Casas-Díaz; Concepción M Porrero; Ana Mateos; Lucas Domínguez; Santiago Lavín; Emmanuel Serrano
Journal:  Vet Microbiol       Date:  2013-08-09       Impact factor: 3.293

Review 3.  An annotated checklist of pathogenic microorganisms associated with migratory birds.

Authors:  Zdenek Hubálek
Journal:  J Wildl Dis       Date:  2004-10       Impact factor: 1.535

4.  Antimicrobial Resistance in Wildlife: Implications for Public Health.

Authors:  D Carroll; J Wang; S Fanning; B J McMahon
Journal:  Zoonoses Public Health       Date:  2015-02-02       Impact factor: 2.702

5.  Antimicrobial resistance in faecal Escherichia coli isolates from farmed red deer and wild small mammals. Detection of a multiresistant E. coli producing extended-spectrum beta-lactamase.

Authors:  C A Alonso; D González-Barrio; Carmen Tenorio; F Ruiz-Fons; C Torres
Journal:  Comp Immunol Microbiol Infect Dis       Date:  2016-02-18       Impact factor: 2.268

6.  Tracking pathogen transmission at the human-wildlife interface: banded mongoose and Escherichia coli.

Authors:  R Pesapane; M Ponder; K A Alexander
Journal:  Ecohealth       Date:  2013-04-24       Impact factor: 3.184

7.  High prevalence of antimicrobial-resistant genes and integrons in Escherichia coli isolates from Black-headed Gulls in the Czech Republic.

Authors:  M Dolejska; A Cizek; I Literak
Journal:  J Appl Microbiol       Date:  2007-07       Impact factor: 3.772

8.  Dissemination of multidrug-resistant bacteria into the Arctic.

Authors:  Maria Sjölund; Jonas Bonnedahl; Jorge Hernandez; Stina Bengtsson; Gunilla Cederbrant; Jarone Pinhassi; Gunnar Kahlmeter; Björn Olsen
Journal:  Emerg Infect Dis       Date:  2008-01       Impact factor: 6.883

9.  Antibiotic resistance of Escherichia coli isolated from broilers sold at live bird markets in Chattogram, Bangladesh.

Authors:  Md Samun Sarker; Md Shahriar Mannan; Md Younus Ali; Md Bayzid; Abdul Ahad; Zamila Bueaza Bupasha
Journal:  J Adv Vet Anim Res       Date:  2019-06-06

10.  Antibiotic resistance of Escherichia coli isolated from captive Bengal tigers at Safari parks in Bangladesh.

Authors:  Saurav Kumar Ghosh; Zamila Bueaza Bupasha; Hatem Sazzat Md Zulkar Nine; Arup Sen; Abdul Ahad; Md Samun Sarker
Journal:  J Adv Vet Anim Res       Date:  2019-07-23
View more
  5 in total

1.  Virulence and Antimicrobial Resistance Profiles of Salmonella enterica Serovars Isolated from Chicken at Wet Markets in Dhaka, Bangladesh.

Authors:  Nure Alam Siddiky; Md Samun Sarker; Md Shahidur Rahman Khan; Ruhena Begum; Md Ehsanul Kabir; Md Rezaul Karim; Md Tanvir Rahman; Asheak Mahmud; Mohammed A Samad
Journal:  Microorganisms       Date:  2021-04-28

2.  Isolation of multidrug-resistant Escherichia coli, Staphylococcus spp., and Streptococcus spp. from dogs in Chattogram Metropolitan Area, Bangladesh.

Authors:  Probir Deb; Tridip Das; Chandan Nath; Abdul Ahad; Pankaj Chakraborty
Journal:  J Adv Vet Anim Res       Date:  2020-10-09

3.  Advanced molecular characterization of enteropathogenic Escherichia coli isolated from diarrheic camel neonates in Egypt.

Authors:  Momtaz A Shahein; Amany N Dapgh; Essam Kamel; Samah F Ali; Eman A Khairy; Hussein A Abuelhag; Ashraf S Hakim
Journal:  Vet World       Date:  2021-01-12

4.  Virulence and antimicrobial resistance profile of non-typhoidal Salmonella enterica serovars recovered from poultry processing environments at wet markets in Dhaka, Bangladesh.

Authors:  Nure Alam Siddiky; Samun Sarker; Shahidur Rahman Khan; Tanvir Rahman; Abdul Kafi; Mohammed A Samad
Journal:  PLoS One       Date:  2022-02-07       Impact factor: 3.752

5.  Antimicrobial resistance pattern in domestic animal - wildlife - environmental niche via the food chain to humans with a Bangladesh perspective; a systematic review.

Authors:  Shahneaz Ali Khan; Mohammed Ashif Imtiaz; Md Abu Sayeed; Amir Hossan Shaikat; Mohammad Mahmudul Hassan
Journal:  BMC Vet Res       Date:  2020-08-24       Impact factor: 2.741

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.