Literature DB >> 33409311

Isolation of multidrug-resistant Escherichia coli, Staphylococcus spp., and Streptococcus spp. from dogs in Chattogram Metropolitan Area, Bangladesh.

Probir Deb1,2, Tridip Das1,2, Chandan Nath1, Abdul Ahad1, Pankaj Chakraborty3.   

Abstract

OBJECTIVES: Antibacterial resistance is a great concern in human and food animal medicine, and it poses a significant concern in pet animals like dogs. This cross-sectional study was conducted to evaluate the antimicrobial resistance pattern of Escherichia coli, Staphylococcus spp., and Streptococcus spp. along with the carryover of some resistance genes in E. coli from dogs in the Chattogram metropolitan area, Bangladesh.
MATERIALS AND METHODS: Rectal swab (n = 50), nasal swab (n = 50), and skin swab (n = 50) samples were collected from dogs having respiratory infections, skin infections, and/or enteritis, respectively. Three types of bacteria were identified and isolated by conventional bacteriological techniques and biochemical tests. Antimicrobial susceptibility testing was carried out against 12 antimicrobials by disk diffusion methods. Six resistance genes, namely bla TEM, bla CTX-M, tetA, tetB, Sul-I, and Sul-II, were screened for phenotypically resistant E. coli isolates by the polymerase chain reaction.
RESULTS: A total of 39 (78%) E. coli, 25 (50%) Staphylococcus spp., and 24 (48%) Streptococcus spp. isolates were isolated from the rectal swab, nasal swab, and skin swab samples, respectively. In the cultural sensitivity test, the E. coli isolates showed resistance to ceftriaxone (79%) and sulfamethoxazole/trimethoprim (64%). Doxycycline (80%) demonstrated the highest resistance among Staphylococcus isolates, followed by sulfamethoxazole/trimethoprim (60%). Streptococcus isolates showed the highest resistance to penicillin (63%), followed by ceftriaxone (54%), while no isolate showed resistance to gentamycin. The prevalence of bla TEM, bla CTX-M, tetA, tetB, Sul-I, and Sul-II genes in phenotypically resistant E. coli isolates were 100%, 61.29%, 100%, 8.33%, 56%, and 72%, respectively.
CONCLUSIONS: Spillover of such multidrug-resistant bacteria and resistance genes from pet dogs pose a serious public health risk. Copyright: © Journal of Advanced Veterinary and Animal Research.

Entities:  

Keywords:  Antimicrobial resistance; common pathogens; dog; resistance genes

Year:  2020        PMID: 33409311      PMCID: PMC7774779          DOI: 10.5455/javar.2020.g466

Source DB:  PubMed          Journal:  J Adv Vet Anim Res        ISSN: 2311-7710


Introduction

The emergence of antimicrobial resistance (AMR) in companion animals is a matter of global concern, not only as patient factors but also as public health issues [1]. As companion animals, dogs are adopted worldwide, contributing to emotional comfort to the owner, especially children [2]. Several common pathogens are causing upper and lower respiratory tract infections in dogs. Several other diseases, like diarrhea and skin infection, were recorded in dogs [3]. Escherichia coli are commensal organisms found in the lower gastrointestinal tract of all warm-blooded animals, e.g., dogs [4]. Staphylococcus spp. mainly remain dormant on the healthy skin of dogs. These bacteria are zoologically significant [5]. Streptococcus spp. are normally present in the upper respiratory tracts of dogs, which can cause localized infections and even septicemia [6]. Horizontal transfer of such pathogens from companion animals to humans is likely to occur due to close contact between them [7]. In some geographical regions, antimicrobial drugs are thoroughly used for animal prophylaxis and therapeutics, where many of these belong to a similar group of antimicrobials used in treating humans [8]. It is noteworthy that the widespread scenario in developing countries like Bangladesh is due to the indiscriminate use of antimicrobials [9]. Nowadays, multidrug-resistant (MDR) bacteria, along with their resistance and transmission pattern within and/or between similar and/or different hosts, are a matter of global concern. As these bacteria have zoonotic significance, carryover of resistance genes and their horizontal transfer to humans from dogs will shorten the treatment phenomenon in both species [10]. Therefore, it is crucial to identify the involved bacterial pathogens and use of the most susceptible antimicrobials, which may direct the antimicrobial selection for those bacteria [11]. Several surveillance reports on AMR of zoonotic bacteria like E. coli, Staphylococcus spp., and Streptococcus spp. from food animals, food, and human have been established and published [12]. Still, a few reports are available on dogs. There are limited data on the AMR pattern of common pathogens of dogs in Bangladesh, despite an increasing number of dogs as pet animals among elite people of the metropolitan cities. The study was designed to evaluate the AMR pattern of E. coli from rectal swabs, Staphylococcus spp. from skin swabs, and Streptococcus spp. from nasal swabs along with the carryover of some resistance genes in E. coli from dogs in the Chattogram metropolitan area, Bangladesh.

Methods and Materials

Ethical approval

Animal dealings and experiments were carried out following the guidelines approved by the Chattogram Veterinary and Animal Sciences University (CVASU) ethics committee [Memo No: CVASU/Dir(R&E)EC/2018/105/(03)]. Appropriate measures were taken to minimize pain or discomfort during sample collection from the dogs.

Study area and study population

This study was carried out between January 2018 and September 2018 in S. A. Quaderi Teaching Veterinary Hospital (SAQTVH) of the CVASU. Dogs brought to the hospital for treatment purposes were selected for sampling.

Collection of samples

In total, 150 samples comprising rectal swabs (n = 50), nasal swabs (n = 50), and skin swabs (n = 50) were collected from dogs. Dogs having respiratory infections, skin infection, or enteritis were sampled during the study period. The samples were collected using sterile cotton and immediately transferred to Stuart’s transport medium (Oxoid, Basingstoke, UK) and stored at −80°C in the laboratory of the Department of Microbiology and Veterinary Public Health, CVASU, Bangladesh, for further use [13].

Bacteriological investigation

Escherichia coli, Staphylococcus spp., and Streptococcus spp. were isolated and identified from the collected samples based on their cultural properties, biochemical tests, including pigment production, and hemolytic activities [14,15].

Escherichia coli

The collected rectal swab samples were enriched overnight in buffered peptone water (BPW) (Oxoid Ltd., Basingstoke, UK) [16]. A loopful of the enriched broth was inoculated onto MacConkey agar (Oxoid Ltd, Basingstoke, UK) and incubated for 24 h at 37°C. The suspected large pink color colonies were subcultured onto eosin-methylene blue agar (Oxoid Ltd, Basingstoke, UK) and incubated for 24 h at 37°C. Colonies which produced a typical metallic sheen were subcultured onto the blood agar and further confirmed by the Gram stain properties (Fig. 1C) and biochemical tests (Fig. 1F).
Figure 1.

Gram stain and different biochemical tests of the isolated bacteria. (A) Streptococcus spp., (B) Staphylococcus spp., (C) E. coli, (D) catalase test, (E) coagulase test, and (F) indole test.

Staphylococcus spp.

The collected skin swabs were enriched overnight in BPW at 37°C. One loopful of the enriched broth was directly streaked onto the Mannitol Salt Agar (MSA) (Oxoid Ltd., Basingstoke, UK) and incubated for 24 h at 37°C. The suspective positive colonies were identified based on the colony characteristics on the MSA. The suspected bright yellow positive colonies were then subcultured onto the blood agar and incubated at 37°C for 24 h to detect characteristics appearance on the blood agar and the hemolytic properties of the organism [5]. Then, the organism was confirmed by the Gram stain properties (Fig. 1B) and several biochemical tests (Fig. 1D and E).

Streptococcus spp.

The nasal swabs were placed in BPW and incubated overnight at 37°C, and a loopful was inoculated onto the blood agar. White to transparent dew drop-like colonies with alpha- and beta-hemolysis were observed on the blood agar after incubation overnight at 37°C. The suspected colonies were then confirmed by the Gram stain properties (Fig. 1A) and catalase test (Fig. 1D).

Antimicrobial susceptibility testing

Antimicrobial susceptibility testing for all positive isolates was carried out using the disk diffusion technique recommended by the Clinical Laboratory and Standards Institute (CLSI) [17]. The ATCC25922 was used for quality control during the disk diffusion technique. A total of 12 antimicrobials of different groups were used at the given disk content: penicillin (6 μg), ampicillin (10 μg), cephradine (30 μg), ceftriaxone (30 μg), erythromycin (15 μg), azithromycin (15 μg), gentamycin (30 μg), oxytetracycline (30 μg), doxycycline (5 μg), ciprofloxacin (5 μg), nalidixic acid (30 μg), and sulfamethoxazole/trimethoprim (25 μg). These antimicrobials were selected based on the history of commonly used antimicrobials at the SAQTVH. The interpretation of the test results was made according to the CLSI guidelines [17]

DNA extraction

The conventional crude boiling method was used to extract the genomic DNA of E. coli isolates [18]. In brief, 2–3 fresh colonies were taken in a sterile 1.5-ml microcentrifuge tube containing 200-μl sterile Milli-Q water and vortexed thoroughly. After heating the microcentrifuge tube at 99°C for 10 min, it was rapidly frozen at −20°C and centrifuged at 13,000 rpm for 5 min. Finally, the supernatant (100 μl) was collected and used as the DNA template in polymerase chain reaction (PCR), followed by storing at −20°C for further use.

Screening of AMR genes

The E. coli isolates, which were resistant to tetracycline, were tested for the presence of tetA and tetB genes. Similarly, the E. coli, which were resistant to ampicillin and cefotaxime, were tested for the presence of blaTEM and blaCTX-M genes, respectively. All sulfamethoxazole/trimethoprim-resistant isolates were tested for Sul-I and Sul-II genes. The oligonucleotide primers used for the amplification of the genes by PCR are mentioned in Table 1. Due to resource limitation, Staphylococcus spp. and Streptococcus spp. isolates were not tested for any resistance genes. The specific thermal cyclic conditions of each resistance gene are displayed in Table 2. The PCR products were visualized on a gel documentation system (UVP UVsolo touch – Analytik Jena AG) after electrophoresis with 1.5% agarose gel (SeaKem® LE Agarose from Lonza).
Table 1.

Oligonucleotide primer sequences used to detect resistance genes in E. coli isolates.

GenePrimer NamePrimer sequence (5′- 3′)Annealing temperatureAmplicon size (bp)Reference
blaTEMblaTEM-FTACGATACGGGAGGGCTTAC50°C716[39]
blaTEM-RTTCCTGTTTTTGCTCACCCA
blaCTX-MblaCTXM-FACGCTGTTGTTAGGAAGTG58°C857[40]
blaCTXM-RTTGAGGCTGGGTGAAGT
tetAtetA-FGGCGGTCTTCTTCATCATGC64°C502[41]
tetA-RCGGCAGGCAGAGCAAGTAGA
tetBtetB-FCATTAATAGGCGCATCGCTG64°C930[41]
tetB-RTGAAGGTCATCGATAGCAGG
Sul-ISul-I-FCGG CGT GGG CTA CCT GAA CG68°C779[41]
Sul-I- RGCC GAT CGC GTG AAG TTC CG
Sul-IISul-II-FCCT GTT TCG TCC GAC ACA GA66°C721[41]
Sul-II-RGAA GCG CAG CCG CAA TTCAT
Table 2.

Thermal cycling conditions for PCR of tested resistance genes.

Gene nameblaTEMblaCTX-MtetA, tetBSul-ISul-II
Initial denaturation94°C, 3 min94°C, 3 min95°C, 4 min95°C, 5 mins94°C, 4 min
Cyclic denaturation94°C, 1 min94°C, 1 min95°C, 1 min95°C, 1 min94°C, 1 min
Cyclic annealing50°C, 1 min58°C, 30 sec64°C, 1 min68°C, 1 min66°C, 1 min
Cyclic extension72°C, 1 min72°C, 1 min72°C, 1 min72°C, 1 min72°C, 1 min
Final extension72°C, 10 min72°C, 10 min72°C, 7 min72°C, 10 min72°C, 7 min
Cycle number2536353535
References[39][40][41][41][41]

Statistical analysis

Field and laboratory data obtained were entered into MS Excel 2010 spreadsheets and were analyzed using the R package [19]. The heatmap of antimicrobial susceptibility testing phenotype was generated by using Graphpad Prism 7.0.

Results

Frequency of samples and organisms

By using the standard bacteriological culture technique, 39 (78%; 95% Confidence Interval 59.84%–89.60%) rectal swabs, 25 (50%; 95% Confidence Interval 36.64%–63.36%) skin swabs, and 24 (48%; 95% Confidence Interval 34.80–59.42) nasal swabs were found positive for E. coli, Staphylococcus spp., and Streptococcus spp., respectively.

AMR patterns

The summary of the AMR profile is outlined in Table 3. In the cases of E. coli, the highest resistance was found toward ceftriaxone (79%) and penicillin (79%), followed by nalidixic acid (67%), sulfamethoxazole/trimethoprim (64%), ampicillin (44%), and oxytetracycline (31%). Only 3% of the isolates showed resistance to azithromycin. On the other hand, doxycycline (80%) demonstrated the highest resistance for Staphylococcus isolates (n = 25), followed by sulfamethoxazole/trimethoprim (60%), ampicillin (12%), and ceftriaxone (48%). From the resistance pattern of Streptococcus isolates (n = 24) among the 12 tested antibiotics, penicillin (63%) turned out to have the highest level of resistance, followed by ceftriaxone (54%), while no isolate displayed resistance to gentamycin. The overall AMR profile of all isolates is shown in Figure 3. The MDR isolates were classified based on the resistance profiles of AMR. If the isolates showed resistance to one antimicrobial agent in three or more antimicrobial classes, they were considered as MDR [20]. Among the three types of the isolated organisms, most of the E. coli isolates were MDR, rather than Staphylococcus spp. and Streptococcus spp. (Fig. 4). About 90% of the E. coli isolates were found to be MDR. On the other hand, 56% Staphylococcus spp. and 71% Streptococcus spp. isolates were MDR.
Table 3.

Phenotypic antibiogram of Streptococcus spp., Staphylococcus spp., and E. coli.

Antibiotic name (concentration)E. coli (n = 39)Staphylococcus spp. (n = 25)Streptococcus spp. (n = 24)
S (%)I (%)R (%)S (%)I (%)R (%)S (%)I (%)R (%)
PEN (6 μg)1557936164833463
AMP (10 μg)36214460281254838
CEP (30 μg)41184176420581725
CRO (30 μg)15579361648331354
ERY (15 μg)44263160832581329
AZM (15 μg)953396409244
GEN (30 μg)7213155636858420
OTC (30 μg)511831403624582517
DOX (5 μg)9235100208079174
CIP (5 μg)212654244432134642
NAL (30 μg)151867204040134246
SXT (25 μg)23136483260212950

n = number of isolates; S = Susceptible; I = Intermediate; R = Resistant; PEN = Penicillin; Ampicillin; CEP = Cephradine; CRO = Ceftriaxone; ERY = Erythromycin; AZM = Azithromycin; GEN = Gentamycin; OTC = Oxytetracyline; DOX = Doxycycline; CIP = Ciprofloxacin; NAL =Nalidixic acid; SXT = Sulfamethoxazole/trimethoprim.

Figure 3.

Distribution of AMR phenotype Streptococcus spp., Staphylococcus spp., and E. coli isolates across the samples. Where PEN = Penicillin; AMP = Ampicillin; CEP = Cephradine; CRO = Ceftriaxone; ERY = Erythromycin; AZM = Azithromycin; GEN = Gentamycin; OTC = Oxytetracycline; DOX = Doxycycline; CIP = Ciprofloxacin; NAL = Nalidixic acid; and SXT = Sulfamethoxazole/trimethoprim.

Figure 4.

Multidrug-resistance pattern of E. coli, Staphylococcus spp., and Streptococcus spp.

n = number of isolates; S = Susceptible; I = Intermediate; R = Resistant; PEN = Penicillin; Ampicillin; CEP = Cephradine; CRO = Ceftriaxone; ERY = Erythromycin; AZM = Azithromycin; GEN = Gentamycin; OTC = Oxytetracyline; DOX = Doxycycline; CIP = Ciprofloxacin; NAL =Nalidixic acid; SXT = Sulfamethoxazole/trimethoprim.

Distribution of resistance genes in E. coli

Six resistance genes were screened among the phenotypically resistant E. coli isolates. The PCR gel images of all tested resistance genes of some selected E. coli isolates are shown in Figure 2. All the phenotypically ampicillin-resistant E. coli isolates (17) carried the blaTEM gene, and 61.29% of phenotypically ceftriaxone-resistant E. coli isolates (31) harbored the blaCTX-M gene. In the phenotypically tetracycline-resistant isolates (12), all carried the tetA gene. In the case of phenotypically sulfamethoxazole/trimethoprim-resistant isolates (25), 72% carried the Sul-II gene. The distribution of the resistance genes is shown in Table 4.
Figure 2.

Antibiogram phenotype (disk diffusion) and PCR gel images of resistance genes. (A) Comparing inoculum with 0.5 McFarland standard; (B) antimicrobial susceptibility testing plates of selected E. coli isolates after 18 h incubation; (C) bla gene (D) blaCTX-M gene, (E) tetA gene, (F) tetB gene, (G) Sul-I gene, and (H) Sul-II gene. In all the gel images, L, P, N stands for DNA ladders, positive control (previously isolated E. coli strain), and negative control (ATCC25922), respectively.

Table 4.

Prevalence of resistance genes in phenotypically resistant E. coli.

AntimicrobialResistance genesNumber of phenotypically resistant isolatesNumber of isolates harboring genes%
AmpicillinblaTEM1717100
CeftriaxoneblaCTX-M311961.29
TetracyclinetetA1212100
TetracyclinetetB1218.33
Sulfamethoxazole/TrimethoprimSul-I251456
Sulfamethoxazole/TrimethoprimSul-II251872

Discussion

The trend of keeping pet animals has increased dramatically over the last decade in Bangladesh. Pet owners treat them as family members and usually provide first medications at home when they become sick. Antimicrobials are also included in their medication profiles, and the use of unregulated antibiotics in these animals has received little attention. Moreover, like in humans, the indiscriminate use of antibiotics is widespread among dogs in Bangladesh, which is increasing the risk of antibiotic resistance. Studying antibiotic sensitivity patterns might explore the possible MDR bacteria in dogs, and due to living in close contact with dogs, it may cause problems in humans if they are infected with MDR bacteria from dogs. The findings of the study reveal the common bacterial pathogens circulating in dogs, and also show their extended spectrum of resistance to several antibiotics that are commonly used in therapeutic purposes. The categories of the samples, like a rectal swab, skin swab, and nasal swab, selected for isolating E. coli, Staphylococcus spp., and Streptococcus spp., respectively, were based on the expected availability of the common investigated pathogens, either in a healthy or diseased condition. The isolation frequency of E. coli, Staphylococcus spp., and Streptococcus spp. varied in terms of sources [1,21,22]. The frequency was higher in E. coli (78%) than that of Staphylococcus spp. (50%) and Streptococcus spp. (48%). Similar findings were also stated in a previous study [23]. In dogs, a variety of antimicrobials are used to treat common bacterial infections, including respiratory infection, urinary tract infections, wound infections, ear infections, gastroenteritis, and pyoderma. Resistance to these antimicrobials squeezes the treatment options of the companion animals. Multiple studies have reported that the isolation frequency of resistant bacteria from dogs which were treated for infection were higher than untreated dogs [7,24]. In this study, 3 organisms were subjected to 12 antimicrobials to evaluate their resistance patterns against antimicrobials. The E. coli isolates from dogs were found to be highly resistant to ceftriaxone (79%). As ceftriaxone is also a widely used antibiotic in humans, it might be risky for humans in the context of AMR if these E. coli can somehow pass into humans by direct contact or from the environment. Higher levels of resistance toward sulfamethoxazole/trimethoprim (64%) and nalidixic acid (67%) were also observed in this study, which is higher than that reported by Chang et al. [26]. In this study, phenotypic resistance was 44% to ampicillin, 41% to cephradine, and 31% to erythromycin, whereas Abdi et al. [25] reported that the resistance to ampicillin, cephradine, ceftriaxone, and erythromycin were 100%, 43%, 46%, and 2%, respectively. Oxytetracycline and doxycycline were found to be 31% and 5% resistant, respectively, in the study, which is lower than that reported by Chang et al. [26]. Rantala et al. [24] reported that the level of sulfamethoxazole/trimethoprim resistance among canine Staphylococcus infection varied from country to country. Rantala et al. [24] isolated 57% Staphylococcus spp. resistant to sulfamethoxazole/trimethoprim, but in our study, it was 60%. Ceftriaxone (a third-generation cephalosporin) is the most used antimicrobial in canine practice, and it showed 48% resistance in our study, which is lower than the values reported by Punia et al. [27] and Saravanan et al. [28]. About 12% of isolates showed resistance to ampicillin, which was partially higher than other studies [29]. Onwubiko and Sadiq [30] reported 31.2% resistance to penicillin and 31.2% resistance to oxytetracycline in their study, but the values were 48% and 24%, respectively, in the present study. Of the Streptococcus spp. isolates, high resistance was found toward penicillin (63%) and ceftriaxone (54%), which was higher than that in the study conducted by Norton et al. [31]. The resistance to ampicillin, erythromycin, and azithromycin was 38%, 29%, and 4%, respectively, which is lower than the results obtained in an earlier study [32]. In this study, we found that Streptococcus spp. were resistant to oxytetracycline (17%) and doxycycline (4%), as reported by Norton et al. [31] The MDR isolates showed resistance against at least three groups or classes of antimicrobials [20,33]. Overall, 77% of the isolates were found to be MDR. Among them, the highest frequency was found in E. coli isolates (90%). Dutta et al. [18] also observed a high percentage of MDR E. coli isolates, although it was from livestock origin. On the other hand, MDR Staphylococcus spp. and Streptococcus spp. isolates were also found in higher frequency. This high MDR frequency is alarming for the prophylaxis treatment of pet animals. Fecal Gram-negative bacteria are considered as good indicator bacteria for humans and animals, which act as a reservoir of several AMR genes that could be of zoonotic significance [33]. Several resistance genes, namely blaTEM, blaCTX-M, tetA, tetB, Sul-I, and Sul-II were detected in fecal E. coli in the present study. All the phenotypically ampicillin-resistant isolates were positive for blaTEM gene in the current study, which is lower than that reported by Costa et al. [34]. Among all β-lactamases, ceftriaxone (a third-generation cephalosporin) is frequently used in dogs. The frequency of blaCTX-M gene was 61.29% in this study, whereas Seputiene et al. [35] found a frequency of 96% in Lithuania, 76% in Portugal [36], and 83.18% in Turkey [37]. This variation might be due to the presence of multiple genes of the CTXM group, which are responsible for extended-spectrum β-lactamase E. coli. Among the phenotypically tetracycline-resistant isolates, 100% isolates were positive for tetA gene, whereas 8.33% were positive for tetB gene. Although there are several genes, like tetA, tetB, tetC, tetD, and tetE, that are responsible for tetracycline resistance in E. coli, the dominant gene is tetA, which verifies the findings of the current study with another study [34]. Simultaneously, among the sulfamethoxazole/trimethoprim resistance genes, like Sul-I, Sul-II, and Sul-III, Sul-I is predominant over others for such acquisition of resistance by E. coli [38]. However, in this study, the prevalence of Sul-II gene is a bit higher than Sul-1. This might be due to the random selection during the isolation of the bacteria.

Conclusion

Antibiotic-resistant bacteria have been isolated from dogs, indicating the random use of antibiotics or it may be due to cross-infection from the environment. Therefore, awareness against random and excessive use of antimicrobials in companion animals may help in reducing the spread of MDR bacteria.
  32 in total

1.  Detection of the sul1, sul2, and sul3 genes in sulfonamide-resistant bacteria from wastewater and shrimp ponds of north Vietnam.

Authors:  Phan Thi Phuong Hoa; Lisa Nonaka; Pham Hung Viet; Satoru Suzuki
Journal:  Sci Total Environ       Date:  2008-08-06       Impact factor: 7.963

2.  Antibiotic resistance-the need for global solutions.

Authors:  Ramanan Laxminarayan; Adriano Duse; Chand Wattal; Anita K M Zaidi; Heiman F L Wertheim; Nithima Sumpradit; Erika Vlieghe; Gabriel Levy Hara; Ian M Gould; Herman Goossens; Christina Greko; Anthony D So; Maryam Bigdeli; Göran Tomson; Will Woodhouse; Eva Ombaka; Arturo Quizhpe Peralta; Farah Naz Qamar; Fatima Mir; Sam Kariuki; Zulfiqar A Bhutta; Anthony Coates; Richard Bergstrom; Gerard D Wright; Eric D Brown; Otto Cars
Journal:  Lancet Infect Dis       Date:  2013-11-17       Impact factor: 25.071

3.  Fecal Indicator and Pathogenic Bacteria and Their Antibiotic Resistance in Alluvial Groundwater of an Irrigated Agricultural Region with Dairies.

Authors:  Xunde Li; Edward R Atwill; Elizabeth Antaki; Olin Applegate; Brian Bergamaschi; Ronald F Bond; Jennifer Chase; Katherine M Ransom; William Samuels; Naoko Watanabe; Thomas Harter
Journal:  J Environ Qual       Date:  2015-09       Impact factor: 2.751

Review 4.  Antimicrobial resistance: A global emerging threat to public health systems.

Authors:  Maurizio Ferri; Elena Ranucci; Paola Romagnoli; Valerio Giaccone
Journal:  Crit Rev Food Sci Nutr       Date:  2017-09-02       Impact factor: 11.176

5.  Acquisition of Plasmid-Mediated Colistin Resistance Gene mcr-1 in Escherichia coli of Livestock Origin in Bangladesh.

Authors:  Avijit Dutta; Md Zohorul Islam; Himel Barua; Eaftekhar Ahmed Rana; Mohammad Shah Jalal; Pangkaj Kumar Dhar; Avijit Das; Tridip Das; Sabuj Manohar Sarma; Sanjoy Kanti Biswas; Paritosh Kumar Biswas
Journal:  Microb Drug Resist       Date:  2020-04-28       Impact factor: 3.431

6.  Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland.

Authors:  Roland Lanz; Peter Kuhnert; Patrick Boerlin
Journal:  Vet Microbiol       Date:  2003-01-02       Impact factor: 3.293

7.  Methicillin-resistant Staphylococcus aureus: prevalence and current susceptibility pattern in sikkim.

Authors:  Dechen C Tsering; Ranabir Pal; Sumit Kar
Journal:  J Glob Infect Dis       Date:  2011-01

8.  Antibiotic sensitivity pattern of Staphylococcus aureus from clinical isolates in a tertiary health institution in Kano, Northwestern Nigeria.

Authors:  Emmanuel Onwubiko Nwankwo; Magaji Sadiq Nasiru
Journal:  Pan Afr Med J       Date:  2011-01-26

9.  Antimicrobial resistance of Escherichia coli isolates from canine urinary tract infections.

Authors:  Shao-Kuang Chang; Dan-Yuan Lo; Hen-Wei Wei; Hung-Chih Kuo
Journal:  J Vet Med Sci       Date:  2014-10-28       Impact factor: 1.267

10.  Companion dog acquisition and mental well-being: a community-based three-arm controlled study.

Authors:  Lauren Powell; Kate M Edwards; Paul McGreevy; Adrian Bauman; Anthony Podberscek; Brendon Neilly; Catherine Sherrington; Emmanuel Stamatakis
Journal:  BMC Public Health       Date:  2019-11-05       Impact factor: 3.295

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.