Literature DB >> 31846458

Annual replication is essential in evaluating the response of the soil microbiome to the genetic modification of maize in different biogeographical regions.

Márton Szoboszlay1, Astrid Näther1, Ewen Mullins2, Christoph C Tebbe1.   

Abstract

The importance of geographic location and annual variation on the detection of differences in the rhizomicrobiome caused by the genetic modification of maize (Bt-maize, event MON810) was evaluated at experimental field sites across Europe including Sweden, Denmark, Slovakia and Spain. DNA of the rhizomicrobiome was collected at the maize flowering stage in three consecutive years and analyzed for the abundance and diversity of PCR-amplified structural genes of Bacteria, Archaea and Fungi, and functional genes for bacterial nitrite reductases (nirS, nirK). The nirK genes were always more abundant than nirS. Maize MON810 did not significantly alter the abundance of any microbial genetic marker, except for sporadically detected differences at individual sites and years. In contrast, annual variation between sites was often significant and variable depending on the targeted markers. Distinct, site-specific microbial communities were detected but the sites in Denmark and Sweden were similar to each other. A significant effect of the genetic modification of the plant on the community structure in the rhizosphere was detected among the nirK denitrifiers at the Slovakian site in only one year. However, most nirK sequences with opposite response were from the same or related source organisms suggesting that the transient differences in community structure did not translate to the functional level. Our results show a lack of effect of the genetic modification of maize on the rhizosphere microbiome that would be stable and consistent over multiple years. This demonstrates the importance of considering annual variability in assessing environmental effects of genetically modified crops.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31846458      PMCID: PMC6917299          DOI: 10.1371/journal.pone.0222737

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The cultivation of genetically modified (GM) maize with resistance against agricultural pests has become common practice in many countries across the world [1]. Among the genetic modifications, the expression of insecticidal endotoxins which are naturally produced by the bacterium Bacillus thuringiensis (Bt), is especially important. Bt-modifications can provide resistance against insects that are not easy to control by chemical pesticides [2]. Bt-maize event MON810 has been widely used in agriculture for several decades. It produces the Cry1Ab toxin which kills the European corn borer (Ostrinia nubilalis), a widely abundant lepidopteran pest. Nowadays, the event MON810 is present in a high diversity of maize varieties and thereby occurs in agroecosystems with contrasting climatic conditions [1]. In Europe, maize can be cultivated across the whole continent with the exception of larger parts of Scandinavia, and the use of Bt-maize MON810 in the European Union was authorized by the European Commission in 1998 [3]. However, overruling national regulations have limited the actual commercial cultivation of maize MON810 to only a few European countries, with the most widespread use in Spain [1]. For authorizing the cultivation of any genetically modified crop in the European Union, legislation requires that environmental risks are characterized. Guidance documents developed by the Panel of Genetically Modified Organisms of the European Food Safety Authority explain the procedure for environmental risk assessment (ERA) [4]. An important aspect of ERA is the consideration of GM-specific effects on non-target organisms (NTOs), as they may interact with the GM plants in agroecosystems or beyond in neighboring ecosystems. Their protection is required to preserve biodiversity and maintain ecosystem functions [5]. NTOs encompass insects, earthworms, nematodes and other faunal groups, but they also include soil microorganisms, the latter involved in biogeochemical cycling and other ecosystem services [6]. The most immediate interactions between plants and soil microorganisms occur in the rhizosphere, i.e. the soil influenced by roots and their exudates [7]. The energy rich carbon sources provided by plant roots support a diverse microbial community dominated by bacterial and fungal taxa [8]. The composition of these rhizomicrobiomes is variable. It depends on the particular soil with its resident microbial community, as well as on plant properties, climate and other environmental factors [9, 10]. A diverse rhizomicrobiome is generally assumed to support the growth of the plant by facilitating its access to nutrients [11, 12] and provide protection against soil-borne plant pathogens [13, 14]. Thus, maintaining a diverse rhizomicrobiome could be an option in support of an environmentally friendly crop production and a protection goal when considering the unintended environmental effects of a GM plant [15]. The most suitable technical approach to capture the diversity of the rhizomicrobiome is the analysis of genetic markers in DNA extracted from rhizosphere samples. Suitable targets for bacterial and archaeal diversity is the 16S rRNA gene, and for fungal diversity the 18S rRNA and 28S rRNA genes and ITS sequences [16-18]. While these genes allow the characterization of the structure and composition of the microbial community, functional genes may provide additional information on an ecosystem service. Among them, bacterial nirK and nirS genes encode alternative versions of the enzyme nitrite reductase which mediates a key activity in denitrification, a process highly relevant in the rhizosphere. Denitrification results in a loss of nitrogen delivered by fertilization thereby wasting resources in crop production [12, 19]. While a change in the abundance or diversity of such marker sequences does not necessarily directly translate to an adverse effect of a GM plant, it can serve as an indicator if plant signaling to soil is altered, making further consideration of potential environmental hazards necessary. The rhizomicrobiome of maize MON810 in different genetic backgrounds and in relation to near-isogenic cultivars as comparators has already been studied at a number of field sites located in different climatic regions, including Portugal, Spain, Slovakia, the USA, Brazil or Germany [18, 20–25], and an effect of the genetic modification was either not detected or minor compared to the impact of other variables including field heterogeneities, plant age, or annual weather conditions. While these studies all utilized one or several of the above mentioned genetic markers, the resolution by which the corresponding DNA sequences were retrieved and the depth to which they were analyzed varied substantially. Due to the potential of high-throughput sequencing utilizing the Illumina platform, it is now possible to characterize the structural and functional diversity of rhizomicrobiomes in more depth, also retrieving the less abundant but not necessarily less important microbial community members. To date, this technique has to our knowledge not yet been applied to analyze the rhizomicrobiome of maize MON810. Once approved, the European Union (EU) allows the cultivation of a GM plant in all the different geographical zones of the continent, not necessarily asking for specific data from all particular zones. This initiated the EU project AMIGA (https://cordis.europa.eu/project/rcn/101406/factsheet/en) in which context this study took place. The objective of this study was to evaluate with a highly sensitive high-throughput DNA sequencing approach the impact of field site locations in different geographical zones on the rhizosphere microbial community of Bt-maize MON810 in comparison to near isogenic control varieties. Contrasting results between geographical zones could challenge the current ERA requirements for cultivating GM maize in Europe. In accordance with the Regulation on Plant Protection Products [26], we distinguished in this study three geographic zones, i.e. northern (N), central (C) and southern (S), and collected rhizosphere samples at experimental sites in Sweden and Denmark (N), Slovakia (C), and Spain (S). The event MON810 was present in three different cultivars which were suitable for cultivation at these sites. Each site was studied with annual replication. Molecular markers to quantify the abundance and characterize the diversity of the microbial communities from DNA extracted from the rhizosphere included bacterial 16S rRNA genes, fungal ITS sequences and bacterial nirK and nirS genes.

Materials and methods

Field sites and sampling

This study included four field sites located in different countries: Denmark, Slovakia, Spain, and Sweden. No specific permission was required for soil and rhizosphere sampling at these sites in context of the collaboration within the EU research project AMIGA (for more details see Acknowledgment section). The field studies did not involve sampling of endangered or protected species. At each site, 10 plots were sown with BT maize and 10 plots with a near-isogenic non-BT cultivar. The maize cultivars used are listed in Table 1. The plots were randomly assigned to the cultivars. They were 10 m × 10 m in size, placed 5 m apart from each other, and bordered by 5 m wide conventional maize strips.
Table 1

Maize cultivars cultivated and analyzed at the different sites and years.

201220132014
DenmarkBt cultivarn.c.DKC3872YGDKC3872YG
non-Bt cultivarn.c.DKC3871DKC3871
SlovakiaBt cultivarDKC3872YGDKC3872YGDKC3872YG
non- Bt cultivarDKC3871DKC3871DKC3871
SpainBt cultivarDKC6451YGDKC6451YG n.c.
non- Bt cultivarDKC6450DKC6450 n.c.
SwedenBt cultivarDKC4442YGDKC3872YGDKC3872YG
non- Bt cultivarDKC440DKC3871DKC3871

n.c., not cultivated

n.c., not cultivated The site in Denmark was located at the Aarhus University’s research center in Flakkebjerg (55°19′N, 11°23′E, 35 m above sea level, a.s.l.). The soil was a Udoll with pH (CaCl2) 6.3 ± 0.3, 1.33 ± 0.08% total organic C and 0.14 ± 0.02% total N content. The site in Slovakia was west of Borovce (48°34′N, 17°43′E, 181 m a.s.l.) located on soil classified as a Udoll with pH (CaCl2) 6.2 ± 0.5, 1.25 ± 0.13% total C and 0.14 ± 0.02% total N content. The site in Spain was southeast from Seseña (40°05′N, 3°40′W, 495 m a.s.l.) on a Fluvent with pH (CaCl2) 7.6 ± 0.1, 1.57 ± 0.19% C, and 0.12 ± 0.01% N. The site in Sweden was located northwest of Lund (55°45′N 13°2′E, 10 m a.s.l.). The soil was classified as an Ochrept with pH (CaCl2) 5.94 ± 0.38, 1.43 ± 0.17% C, and 0.15 ± 0.03% N. Rhizosphere samples were collected during the flowering stage (BBCH65) in 2012, 2013, and 2014. The site in Denmark was not sampled in 2012 and the site in Spain was not sampled in 2014. Plants were extracted from the soil, and loosely attached soil was removed from the roots by shaking. To collect soil particles and microbial cells adhering to the roots, 8 g (fresh weight) of root was washed in 30 ml sterile saline solution (0.85% w/v NaCl) in a 50 ml Falcon tube by mixing for 30 min at 4°C with 10 rpm on a rotary shaker. The roots were then discarded and the solution was centrifuged for 30 min with 4,100 x g at 4°C to collect the soil particles and microbial cells. The pellets were resuspended in 1 ml sterile saline solution and transferred to 1.5 ml test tubes. After 5 min centrifugation with 4,100 x g at 4°C, the supernatant was discarded and the pellets were stored at -80°C until DNA extraction.

DNA extraction and quantitative PCR (qPCR)

DNA was extracted from the initially frozen pellets with FastDNA SPIN kit for soil (MP Biomedicals, Illkirch, France) with two bead beating steps at 6.5 m s-1 lasting 45 s each on a FastPrep-24 instrument (MP Biomedicals, Eschwege, Germany). An additional washing of the binding matrix with 1 ml 5.5 M guanidine thiocyanate was included. Copy numbers of bacterial and archaeal 16S rRNA genes, nirK, nirS, and fungal ITS sequences were determined by quantitative PCR. Reactions were run in a StepOnePlus Real Time PCR System (Life Technologies GmbH, Darmstadt, Germany) in duplicates: once with 2 μl of 10 x diluted, and once with 2 μl of 50 x diluted DNA-extract in 20 μl final volume. The sequences of primers and probes with references are listed in S1 Table. For the quantification of bacterial and archaeal 16S rRNA genes, Maxima Probe qPCR ROX Master Mix (Thermo Fisher Scientific, Epsom, UK) was used with 0.5 μM primers and 0.2 μM FAM-labeled TaqMan probes. The temperature profile was 10 minutes of denaturation at 95°C followed by 40 cycles of 95°C for 15 s and 60°C for 60 s. The nirK, nirS, and fungal ITS qPCRs were carried out in Maxima SYBRGreen/ROX qPCR Master Mix (Thermo Fisher Scientific) and, in case of nirK and nirS, with the addition of MgCl2 solution to increase its concentration by 1 mM. The temperature profile was 10 minutes of denaturation at 95°C followed by 40 cycles of 95°C for 15 s, 52°C for 30 s and 72°C for 60 s for fungal ITS, and 10 minutes of denaturation at 95°C followed by 40 cycles of 95°C for 15 s, 63°C for 30 s decreased by 1°C in every cycle to 58°C, and 72°C for 60 s for nirK and nirS. The reactions were followed by melt curve analyses. Standard curves were obtained from 10-fold dilutions of pGEM-T (Promega, Mannheim, Germany) containing either the 16S rRNA gene of Bacillus subtilis, the 16S rRNA gene of Methanobacterium oryza, the ITS region of Fusarium culmorum, the nirS gene of Pseudomonas stutzeri, or the nirK gene of Sinorhizobium meliloti. The amplification efficiencies were 92.4 ± 1.7% for bacterial 16S rRNA genes, 93.4 ± 2.5% for archaeal 16S rRNA genes, 88.1 ± 4.3% for fungal ITS, 86.8 ± 2.1% for nirK, and 91.6 ± 1.5% for nirS. The qPCR results were expressed as copies g-1 root (fresh weight) and subjected to log10 transformation to decrease the heterogeneity of variance. Samples from BT and non-BT maize from the same site and year were compared with t-tests in JMP 13.0.0 (SAS Institute). Differences between sites and years were analyzed with ANOVA and Tukey’s HSD post hoc tests, and pairwise Pearson correlations between the qPCR datasets were calculated in JMP 13.0.0. The significance of the correlations was assessed by t-tests after applying Fisher’s Z-transformation.

Sequencing and data processing

The V4 region of the bacterial and archaeal 16S rRNA genes and a segment of the nirK gene was amplified by PCR and subjected to Illumina MiSeq sequencing according to the protocol of [27]. The primers used in the PCR contained the Illumina adaptor sequences, 8 nucleotide (nt) long index sequences, a 10 nt section to allow the appropriate annealing temperature during sequencing, 2 nt not complementary to the target sequence, and a target sequence-specific region which was S-D-Arch-0519-a-S-15 (CAGCMGCCGCGGTAA) and S-D-Bact-0785-a-A-21 (GACTACHVGGGTATCTAATCC) [28] in case of the 16S rRNA gene, and F1aCu (ATCATGGTSCTGCCGCG) and nirK1040R (GCCTCGATCAGRTTRTGGTT) [29] in case of nirK. Two 16S rRNA gene and two nirK PCR were performed from each sample with FastStart High Fidelity PCR System (Roche Diagnostics, Mannheim, Germany) in 50 μl reaction volume containing 1 μl DNA-extract, 0.4 μM of each primer, 200 μM of each dNTP, 5% dimethyl sulfoxide, 1.8 mM MgCl2, and 2.5 U FastStart High Fidelity Enzyme Blend. The temperature profile started with initial denaturation at 95°C for 2 min followed by 35 cycles of 95°C for 30 s, 50°C for 30 s, and 72°C for 60 s, and finished with 72°C for 5 min. The products of the two replicate reactions were pooled, purified with HiYield PCR Clean-up & Gel-Extraction kit (SLG) and quantified with Quant-iT PicoGreen dsDNA assay (Invitrogen, Darmstadt, Germany). Libraries were prepared from equimolar amounts of the individual PCR products and sent to StarSEQ (Mainz, Germany) for sequencing. The nirK PCR products were sequenced in a single MiSeq run with 600 cycle V3 chemistry. The 16S rRNA gene PCR products were distributed between two MiSeq runs, the first with 500 cycle V2 chemistry containing the samples from 2012 and 2013, and the second with 600 cycle V3 chemistry for the samples from 2014. Fungal ITS sequencing was carried out from the samples from 2012 and 2013. ITS1 sequences were PCR-amplified using primers with Illumina overhang adaptors and target specific regions ITS1F (CTTGGTCATTTAGAGGAAGTAA, [30] and ITS2 (GCTGCGTTCTTCATCGATGC, [31]. Reactions were carried out with Kapa2G Robust PCR ReadyMix (Kapa Biosystems, Wilmington, Massachusetts) in 50 μl volume containing 0.2 μM of each primer and 10 ng template DNA. The temperature profile started with initial denaturation at 95°C for 3 min followed by 35 cycles of 94°C for 45 s, 62°C for 45 s, and 72°C for 60 s, and finished with 72°C for 7 min. PCR products were cleaned with Agencourt AMPure XP beads (Beckman Coulter, Brea, California). Illumina sequencing adapters and index sequences were added in a limited-cycle PCR with 5 μl purified PCR product and primers from the Nextera XT Index kit (Illumina). The temperature profile started with initial denaturation at 95°C for 3 min followed by 8 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s, and finished with 72°C for 5 min. The products were purified with Agencourt AMPure XP beads (Beckman Coulter Life Sciences, Krefeld, Germany). Libraries were prepared from equimolar amounts of the individual PCR products and sequenced at the DNA Sequencing Facility of Teagasc (Moorepark, Carlow, Ireland) in two MiSeq runs with 600 cycle V3 chemistry. Sequences obtained in this project are available at the European Nucleotide Archive (http://www.ebi.ac.uk/ena) under the accession number PRJEB33038. Sequences were processed with dada2 [32] version 1.3.5 in R 3.3.3 (https://www.r-project.org/). Error models were constructed and sequence variants (SVs) were determined for the individual MiSeq runs separately. In the 16S rRNA gene dataset, forward and reverse reads were trimmed at position 10 from the start and at positions 240 and 180 from the end, respectively, or at any position with a Q-score of 2. Reads with more than two expected errors or any ambiguous bases were discarded. Error models were constructed with default settings from data from a subset of the samples containing over 106 sequences in total. SVs were identified based on the error models using the pool option. Chimeric sequences were identified with the removeBimeraDenovo function of the dada2 package and discarded. The taxonomical classifications of the SVs were determined based on the SILVA reference version 123 [33]. Only results with at least 70% bootstrap support were accepted. SVs longer than 275 nt, or identified as mitochondrial or chloroplast sequences, or not classified into Bacteria or Archaea were removed from the dataset. In the case of the nirK sequences, forward and reverse reads were trimmed at position 10 from the start and at positions 295 and 250 from the end, respectively, or at any position with a Q-score of 2. Reads with over two expected errors or any ambiguous bases were discarded. Error models were constructed with the band size parameter of the dada algorithm set to 40, and using data from a subset of the samples containing over 880,000 sequences in total. SVs were identified based on the error models using the pool option. Chimeric sequences were identified with the removeBimeraDenovo function of the dada2 package and discarded. FrameBot [34] was used to translate the SVs to amino acid sequences, correct for frameshifts, and compare the resulting translated sequence variants (TSVs) to the nirK reference database at the FunGene repository [35] with a minimal length cutoff of 80 amino acid residues and identity cutoff of 0.8. The fungal ITS sequences were first processed with cutadapt version 1.13 [36] to trim off the primer sequences from the beginning of the reads and the complement sequence of the opposite primer from the end of the reads. A 10% mismatch rate was allowed in the recognition of the primer sequences. Forward and reverse reads in which the forward or reverse primer, respectively, could not be identified were discarded. Reads were truncated at the first position with a Q-score of 10 or lower and those shorter than 90 nt or with more than two expected errors or any ambiguous bases were discarded. Error models were constructed using all sequences from the sequencing run with the band size parameter of the dada algorithm set to 32. Chimeric sequences were identified with the removeBimeraDenovo function of the dada2 package and discarded. The taxonomical classifications of the SVs were determined based on the UNITE reference version 7.1 [37] with a bootstrap support threshold of 70%. SVs not classified as Fungi were removed from the dataset.

Statistical analysis of the sequencing data

Simpson’s diversity index was calculated from the 16S rRNA gene and fungal ITS SVs and the nirK TSVs using the vegan package [38] in R. Samples from BT and non-BT maize from the same site and year were compared with t-tests in JMP 13.0.0. Differences between sites and years were analyzed in JMP 13.0.0 with ANOVA and Tukey’s HSD post hoc tests. Principal component analysis (PCA) and non-metric multidimensional scaling (NMDS) plots based on Euclidean distance were created using the vegan package in R. To decrease the sparsity of the dataset 16S rRNA gene SVs and nirK TSVs that didn’t have at least 0.10% relative abundance, or fungal ITS SVs without at least 1.0% relative abundance, in at least one of the samples included in the ordination were removed. Centered log-ratio transformation was used to correct for compositional effects and differences in sequencing depth between the samples [39]. To allow the transformation, 0.1 was added to all elements of the data matrices. ALDEx2 with 1,000 Monte Carlo samples and Welch’s t-test [40] was used to identify SVs, TSVs, or taxa differentially abundant between the samples from BT and non-BT maize from the same site and year. Only the 16S rRNA gene SVs and nirK TSVs that had at least 0.10% relative abundance, or fungal ITS SVs with at least 1.0% relative abundance, in any of the compared samples were included. To obtain sequence counts of taxa, SVs were merged according to their classification at a given taxonomical level. Only those bacterial and archaeal taxa were included in the ALDEx2 analysis that had at least 100 sequences in total in the compared samples. The p-values from the Welch’s t-tests were corrected for multiple testing with the method of Benjamini and Hochberg [41].

Results

Quantitative analyses (qPCR results)

Between samples from BT and non-BT maize, there was no significant difference in the abundance of bacterial 16S rRNA genes or in the abundance of nirS genes at any of the sites in any of the sampling years. The abundance of archaeal 16S rRNA genes was higher in the non-BT samples than in the BT samples at the Spanish site in 2012 (Table 2) but the maize genotype did not have a significant influence on the archaeal 16S rRNA gene number at the other sites in any of the sampling years and at the site in Spain in 2013. The fungal ITS sequences were more abundant in the BT samples than in the non-BT samples from the site in Sweden in 2014 (Table 2) but the maize genotype did not affect fungal ITS abundance at the other sites in any of the sampling years and at the site in Sweden in 2012 and 2013. The nirK copy number was higher in the non-BT samples than in the BT samples at the Slovakian site in 2012 and the Swedish site in 2014 (Table 2) but nirK abundance was not influenced by the maize genotype at the sites in Denmark and Spain and at the site in Slovakia in 2013 and 2014, and Sweden in 2012 and 2013.
Table 2

Significant differences between MON810 maize (Bt) and isogenic comparator maize (non-Bt) cultivars in the qPCR results.

Site and yearGeneAverage ± SD (log copies g-1 root)p
Btnon-Bt
Spain 2012Archaeal 16S7.85 ± 0.097.94 ± 0.030.0188
Sweden 2014Fungal ITS7.80 ± 0.237.62 ± 0.120.0483
nirK8.98 ± 0.349.26 ± 0.090.0308
Slovakia 2012nirK8.91 ± 0.149.13 ± 0.110.0009

The p-values are from Welch’s t-tests

The p-values are from Welch’s t-tests Bacterial 16S rRNA gene numbers were in 2012 significantly higher in the samples from the Swedish site than in the samples from Slovakia and Spain (Fig 1). Between 2012 and 2013, the abundance of bacterial 16S rRNA genes significantly increased at the Slovakian and Spanish sites, but not in the samples from Sweden, and there were no differences between the four sites in 2013. Between 2013 and 2014, there was a significant decrease at all sites. Among the samples from 2014, the ones from Sweden had significantly lower bacterial 16S rRNA gene numbers than the samples from the Slovakian site.
Fig 1

Gene copies for quantification of microbial communities in maize rhizospheres (qPCR results).

Symbols indicate mean values, lines show standard deviations. Sampling years are distinguished by symbols, sites by colors. Groups not sharing the same letter within a plot are significantly different (Tukey’s HSD, p < 0.05).

Gene copies for quantification of microbial communities in maize rhizospheres (qPCR results).

Symbols indicate mean values, lines show standard deviations. Sampling years are distinguished by symbols, sites by colors. Groups not sharing the same letter within a plot are significantly different (Tukey’s HSD, p < 0.05). Archaeal 16S rRNA gene abundance was in 2012 significantly lower at the site in Slovakia compared to the samples from Spain and Sweden (Fig 1). There was a significant decrease between 2012 and 2013 at the Slovakian and Swedish sites, and in 2013, the archaeal 16S rRNA gene numbers were significantly lower in the samples from Slovakia than at the other sites, and in the samples from Denmark compared to the ones from the Spanish site. Between 2013 and 2014, there was a significant decrease in the archaeal abundance at the sites in Denmark and Sweden. Among the samples from 2014, the archaeal 16S rRNA gene numbers were significantly different at the three sites being high in Slovakia, intermediate in Sweden, and low in Denmark. For fungal ITS sequences, the numbers were significantly higher at the Swedish site than at the sites in Slovakia and Spain in 2012 (Fig 1). Between 2012 and 2013, fungal ITS abundance increased at the Slovakian and Swedish sites but did not change in Spain. In 2013, the samples from Sweden had the highest number of fungal ITS sequences followed by the samples from Denmark, Slovakia, and Spain, all being significantly different from the others. Between 2013 and 2014, the fungal ITS copy numbers decreased in the samples from Sweden, but did not change at the other sites. Thus, in 2014, the highest fungal ITS abundance was found at the site in Denmark, followed by Slovakia, and lastly Sweden, all differences being significant. In 2012, the number of nirK genes was significantly higher in the samples from Sweden than in the ones from Slovakia and Spain (Fig 1). From 2012 to 2013, nirK abundance significantly increased at all three sites. In 2013, the highest was at the sites in Denmark and Sweden followed by Spain with significantly lower copy numbers than in Sweden, and lastly Slovakia with nirK abundance significantly lower than the other three sites. Between 2013 and 2014, the number of nirK genes decreased significantly at all sites. In 2014, nirK abundance was significantly higher in the samples from Denmark and Sweden than at the Slovakian site. In 2012, the copy number of nirS genes was higher in the samples from the Spanish site than in the samples from Slovakia and Sweden (Fig 1). From 2012 to 2013, nirS abundance increased significantly at the site in Sweden. In 2013, nirS gene numbers were the highest at the site in Spain, significantly lower in the samples from Denmark and Sweden, and lowest in the samples from Slovakia. Between 2013 and 2014, the copy number of nirS genes increased significantly at the site in Slovakia, but decreased in Denmark and Sweden. Accordingly, in 2014, nirS abundance was significantly higher in the Slovakian compared to the Danish and Swedish samples. There was a strong positive correlation (r = 0.759) between the abundance of archaeal 16S rRNA genes and the nirS gene numbers (Fig 2). The nirK abundance was more correlated with bacterial 16S rRNA gene numbers (r = 0.525), and there was no strong correlation between nirK and nirS abundance (r = 0.207). While bacterial and archaeal 16S copy numbers were in strong correlation with each other (r = 0.691), they were not strongly correlated to fungal abundance (r = 0.390 and -0.101 respectively). All pair-wise correlations between the qPCR results were found significant (p ≤ 0.003) except for the correlation between fungal and archaeal abundance (p = 0.157).
Fig 2

Correlation between the gene copies of different target gene sequences.

Scatterplot matrices with shading from grey to red indicate low to high density of data points. The Pearson correlation coefficient is shown in the corner of the plots.

Correlation between the gene copies of different target gene sequences.

Scatterplot matrices with shading from grey to red indicate low to high density of data points. The Pearson correlation coefficient is shown in the corner of the plots.

DNA-sequencing yields

Sequencing the V4 region of the 16S rRNA gene from the 200 samples yielded 5,660,124 high-quality bacterial and archaeal sequences grouped into 10,416 SVs with an average length of 231 bp (Supplementary file 1). The individual samples had 10,858 to 58,101 sequences and 1,079 to 4,908 SVs. Archaea was represented by 1.3% of the sequences. The SVs were classified into 33 bacterial and two archaeal phyla. The most abundant were Proteobacteria (55.9 ± 16.6%), Actinobacteria (23.7 ± 9.5%), Firmicutes (5.0 ± 2.2%), Bacteroidetes (3.5 ± 2.5%), Acidobacteria (3.3 ± 1.9%), Chloroflexi (2.0 ± 1.3%), Verrucomicrobia (1.8 ± 1.0%), and Gemmatimonadetes (1.7 ± 0.8). Within Proteobacteria, the Gamma- (31.9 ± 16.6%) and Alpha- (14.0 ± 6.1%) subphyla showed the highest relative abundance. MiSeq nirK amplicon sequencing produced 2,301,204 high-quality sequences in 6,216 SVs with an average length of 414 bp. FrameBot could match 4,584 of the SVs, containing 2,014,870 sequences, to the FunGene nirK reference database. These SVs formed 3,014 TSVs, on average 138 amino acid residues long, which were matched to 39 reference sequences by FrameBot. The source organisms of these 39 reference sequences represent 17 genera from phylum Proteobacteria (Table 3).
Table 3

Genera represented by the source organisms of the reference sequences matched by the nirK TSVs.

ClassOrderFamilyGenus
AlphaproteobacteriaRhizobialesBradyrhizobiaceaeAfipia
Bradyrhizobium
Rhodopseudomonas
BrucellaceaeBrucella
Ochrobactrum
PhyllobacteriaceaeChelativorans
Mesorhizobium
RhizobiaceaeAgrobacterium
Neorhizobium
Rhizobium
Sinorhizobium
XanthobacteraceaeStarkeya
RhodobacteralesRhodobacteraceaePhaeobacter
Ruegeria
BetaproteobacteriaBurkholderialesAlcaligenaceaeAchromobacter
Alcaligenes
GammaproteobacteriaPseudomonadalesPseudomonadaceaePseudomonas
Fungal ITS sequencing was performed from the samples from 2012 and 2013. One of the 2012 non-BT samples from Spain and one of the 2013 BT samples from Sweden had to be removed from the dataset due to very low sequencing yields. From the remaining 138 samples, 9,173,003 high-quality sequences were obtained which were grouped into 2,706 SVs. The SVs were 134 to 437 nt long with 245 nt average length. The samples contained 27,442–112,974 sequences and 38–188 SVs. The SVs had representatives of six fungal phyla: Ascomycota (51.7 ± 13.0%), Basidiomycota (27.3 ± 15.7%), Zygomycota (17.7 ± 7.7%), Chytridiomycota (1.2 ± 1.6%), Glomeromycota (0.050 ± 0.087%), and Rozellomycota (detected in two samples, 0.045% and 0.018%). 877 SVs could be classified at species-level representing 427 species and together containing 69.3% of the ITS sequences.

Simpson diversity

The samples from BT and non-BT maize did not show significant difference in the Simpson diversity of 16S rRNA gene SVs and fungal ITS SVs at any of the sites or years. Among the samples from the Slovakian site from 2014, however, the Simpson diversity of nirK TSVs was significantly lower (p = 0.003) in the BT samples (0.968 ± 0.014) than in the non-BT samples (0.987 ± 0.01). In contrast, the nirK diversity was not influenced by the maize genotype at the other sites or at the Slovakian site in 2012 and 2013. The Simpson index calculated from the 16S rRNA sequencing dataset showed no significant variation between sites and years with one exception: diversity was significantly lower in the Slovakian samples from 2013 than at the other sites and in other years at the site in Slovakia (Fig 3). This difference is likely a result of the high abundance of one SV (SV#1), classified as a member of Enterobacteriaceae, in the 2013 samples from the Slovakian site (39.1 ± 20.4%) compared to the other samples (4.2 ± 7.8%) leading to decreased evenness and thus lower diversity (Supplementary file 1).
Fig 3

Simpson diversity.

Symbols indicate mean values, lines show standard deviations. Sampling years are distinguished by symbols, sites by colors. Groups not sharing the same letter within a plot are significantly different (Tukey’s HSD, p < 0.05).

Simpson diversity.

Symbols indicate mean values, lines show standard deviations. Sampling years are distinguished by symbols, sites by colors. Groups not sharing the same letter within a plot are significantly different (Tukey’s HSD, p < 0.05). The diversity of nirK TSVs was significantly higher in the samples from Sweden than at the Spanish site in 2012 (Fig 3). In 2013, the Danish and Swedish samples showed higher diversity than the ones from the Slovakian site. The year-to-year variation within the sites was not significant, except for an increase at the Slovakian site between 2013 and 2014. In 2014, there was no significant difference in nirK diversity between the sites. In fungal ITS diversity, there was no significant change between 2012 and 2013 at any of the sites (Fig 3). In both years, the samples from Slovakia had significantly lower Simpson index values than the samples from the other sites.

Community structure and composition

On the PCA plots from the 16S and ITS SVs, samples from BT plants did not separate from the non-BT samples from the same site and year, indicating that the rhizosphere prokaryotic and fungal community structure was not influenced by the maize genotype. On the other hand, samples from different years form distinct groups on the plots, showing that there was considerable year-to-year variation in community structure at all sites (Fig 4A–4D and 4I–4L). Similarly, the PCA plots from the nirK sequencing data showed no difference between the samples from BT and non-BT plants from the same year at the Danish, Spanish, and Swedish sites, but clear separation between years among the samples from Denmark and Spain (Fig 4E, 4G and 4H). The samples from the Swedish site did not show such clear grouping by years, the samples from 2012 overlap with the ones from 2013 on the ordination plot (Fig 4H). The PCA plot from the nirK TSVs from the Slovakian samples indicate a clear difference in the community structure of nirK-type denitrifiers between the samples from 2012 and 2013 but no difference caused by the maize genotype in either of these years. The samples from 2014, however, group by maize genotype: the samples from BT plants appear close to the samples from 2012, while the samples from non-BT plants separate from all other samples from the Slovakian site (Fig 4F).
Fig 4

Principal component analysis plots.

Sampling years are distinguished by symbols. Darker colors indicate samples from field plots with maize MON810 (Bt), lighter colors samples from non-modified near isogenic maize (non-Bt).

Principal component analysis plots.

Sampling years are distinguished by symbols. Darker colors indicate samples from field plots with maize MON810 (Bt), lighter colors samples from non-modified near isogenic maize (non-Bt). Among bacterial and archaeal SVs and taxa, the genus Acinetobacter (Gammaproteobacteria) and SV#198 classified into this genus had significantly lower relative abundance in the BT than in the non-BT rhizosphere samples at the Danish site in 2014 (Table 4). However, this genus and SV did not show significant response to the maize genotype at the other sites or in Denmark in 2013. In the samples from the Slovakian site in 2014, genera Arthrobacter and Acidothermus (both Actinobacteria), and three SVs assigned to Arthrobacter, Bacillales (Firmicutes), and Sphingobium (Alphaproteobacteria) decreased significantly in relative abundance in the BT compared to the non-BT samples (Table 4). These genera and SVs were not found to respond significantly to the maize genotype in the other two years at the site in Slovakia or at the other sites in any of the sampling years.
Table 4

SVs and taxa from the 16S sequencing data with significantly different abundance in the rhizosphere of maize MON810 (Bt) and non-modified comparator maize (non-Bt maize).

Results from ALDEx2.

Site and yearSV or taxonnon-Bt maizeBt maizep-value
Denmark 2014SV#198 (Acinetobacter)1.32 ± 0.390.004 ± 0.0060.008
genus Acinetobacter2.74 ± 1.160.81 ± 0.550.013
Slovakia 2014SV#5 (Arthrobacter)1.70 ± 0.330.84 ± 0.400.033
SV#20 (Bacillales)0.34 ± 0.110.14 ± 0.040.017
SV#1467 (Sphingobium)0.18 ± 0.120.004 ± 0.0050.028
genus Arthrobacter1.86 ± 0.330.89 ± 0.410.031
genus Acidothermus0.044 ± 0.0200.0006 ± 0.00180.047

The taxonomical classifications of SVs are indicated in parentheses. Relative abundances are shown as percentages (average ± standard deviation). The p-values are from Welch’s t-tests from ALDEx2 with Benjamini-Hochberg correction.

SVs and taxa from the 16S sequencing data with significantly different abundance in the rhizosphere of maize MON810 (Bt) and non-modified comparator maize (non-Bt maize).

Results from ALDEx2. The taxonomical classifications of SVs are indicated in parentheses. Relative abundances are shown as percentages (average ± standard deviation). The p-values are from Welch’s t-tests from ALDEx2 with Benjamini-Hochberg correction. No fungal SVs or taxa were found to have significantly different abundance in the rhizosphere of non-BT and BT maize at any of the sites in any of the sampling years. Similarly, no nirK TSVs were significantly affected by maize genotype at any of the sites in any of the sampling years except at the Slovakian site in 2014. There were 161 nirK TSVs of significantly different abundance between the non-BT and BT rhizosphere samples from Slovakia 2014. Eighty of them were more abundant in the rhizosphere of non-BT maize and 81 in the rhizosphere of BT (S2 Table). Out of these 80 TSVs, 51 were not detectable in the samples from the BT plants. The combined relative abundance of the 161 TSVs in the Slovakian samples from 2014 was 60.2 ± 6.8%. Their nearest matching sequences from the FunGene nirK reference database and the source organisms of the reference sequences are listed in Table 5. Out of the 20 reference sequences, 13 had matches both among the TSVs more abundant in the non-BT rhizosphere samples and the TSVs more abundant in the samples from BT plants.
Table 5

Identifiers (IDs) of the nearest matching sequences from the FunGene reference database and their source organisms for the nirK TSVs significantly more abundant in the non-Bt or Bt samples from Slovakia 2014.

Reference IDSource organismMore abundant in
non-BtBt
1NPJ_AAlcaligenes faecalis+
ACF98088uncultured bacterium 1042++
ACF98123uncultured bacterium 1062++
ACF98152uncultured bacterium 1116++
ACM24772Sinorhizobium sp. NP1++
NP_435927Sinorhizobium meliloti 1021+
NP_949481Rhodopseudomonas palustris++
Q01537Neorhizobium galegae++
YP_001242619Bradyrhizobium sp. BTAi1++
YP_001314809Sinorhizobium medicae WSM419++
YP_002825538Sinorhizobium fredii NGR234+
YP_004110634Rhodopseudomonas palustris++
YP_004134222Mesorhizobium ciceri biovar biserrulae WSM1271++
YP_004614534Mesorhizobium opportunistum++
YP_473141Rhizobium etli++
YP_665890Chelativorans sp. BNC1+
YP_674799Chelativorans sp. BNC1+
ZP_03523451Rhizobium etli GR56++
ZP_04680002Ochrobactrum intermedium LMG 3301+
ZP_05742967Silicibacter sp. TrichCH4B+
Regarding differences in community structure between the sites, similar patterns were found in the bacterial and archaeal, nirK-type denitrifier, and fungal communities. NMDS revealed large differences between the sites that approximate the geographic distances between them: the samples from the Swedish and Danish locations are close on the ordination plots, the Slovakian samples are further apart, while the ones from the site in Spain are relatively far from the others. The NMDS plots of the samples from 2013 are shown as an example in Fig 5. The difference in the structure of the nirK-type denitrifier community between the samples from non-BT and BT maize at the Slovakian site in 2014 (Fig 4F) was not large compared to the differences between sites (Fig 6).
Fig 5

Non-metric multidimensional scaling plots of the samples from 2013.

Fig 6

Non-metric multidimensional scaling plot from the nirK translated sequence variants (TSVs) with the samples from 2014.

Discussion

Several previous studies have already assessed the effect of the genetic modification of maize MON810 on the rhizomicrobiome utilizing different techniques. Most of them failed to find an effect, and it’s been assumed that there is no effect or it is not large enough to become detectable over the background of natural variation [22, 42, 43]. However, most previous studies investigated the microbial community with methods of relatively low resolution, e.g. with a widely applied gel-based genetic fingerprinting that can usually distinguish not more than 20 to 50 dominant taxonomic units [44, 45]. Higher resolution can be achieved by high-throughput DNA sequencing of PCR amplicons [10, 46]. This has revealed that a Bt-maize expressing three different Cry-genes was different in the composition of its rhizosphere microbial community from its non-GM comparator, but on the other hand, this difference was not larger than what was found between non-GM cultivars [46]. In our study however, with the sequencing depth and the number of samples representing different field sites and annual replication higher than in any of the above cited works, the results show that neither the abundance nor the diversity of markers characterizing the rhizomicrobiome was affected by maize MON810 and the expression of the Cry1Ab protein in a consistent manner. Considering that the Cry1Ab protein has been demonstrated to enter the soil via root exudation or sloughed-off root cells [22, 47], a response of the rhizomicrobiome resulting in a differently structured community detectable by deep sequencing of marker genes would not have been surprising. The protein present in the rhizosphere could potentially interact with soil microorganisms, either acting as a toxic or growth inhibiting compound or the opposite, serving as an energy and nutrient source thereby supporting the growth of specific microbial community members. Adverse effects, including toxicity of the Cry1Ab protein on soil microorganisms have been previously analyzed but never detected [48, 49]. In contrast it was demonstrated that Cry1Ab can be degraded by soil microbial cells and support microbial growth [50]. However, the stable community structure of the rhizomicrobiome found in our study suggests that the presence of Cry1Ab was not sufficient to cause significant shifts in relative abundances of microbial community members. This lack of response may be explained by the low amount of Cry1Ab compared to other plant proteins released into the soil, and also by the fact that Cry1Ab adsorbs to surface-active soil particles which limits its accessibility to the microbiome and slows down its degradation [50, 51]. Natural variation caused by plant age, weather conditions, and soil properties have been identified as major factors which may mask Bt-specific effects on the rhizomicrobiome. To compensate for plant age, all samples in this study were collected at the same maize growth stage, i.e. during flowering. At this stage, the root system is fully developed and significant amounts of Cry1Ab protein can be detected in the rhizosphere [22]. Underlining the importance of environmental factors, distinct microbiomes were found at each site based on all three genetic markers that were analyzed: 16S rRNA gene, ITS region, and nirK gene. Similarly, comparing soil bacterial communities from sites across Europe, it was found that the site had a predominant influence on community structure [52]. Interestingly, the NMDS analyses indicated a higher similarity between the rhizosphere communities from the two sites from Northern Europe (Denmark and Sweden, situated 115 km apart), than between them and the other two sites, even though in Slovakia the same maize genotype was used. Apparently, the biogeographical zone was more important in shaping the rhizomicrobiome than the cultivars. This geographical effect is likely a combined result of similar soil types and climatic conditions under which maize was cultivated. Shared climate was also considered an important driving factor of bacterial diversity in the rhizosphere of maize studied with different cultivars at five field locations across the United States [53]. Apart from soil and weather, variation between the sites of this study could be linked to locally optimized agricultural management, including fertilization practices, tillage, and pest management. The plants selected for distinct rhizomicrobiomes at each field site, still the community composition as indicated by the relative abundance of phyla, subphyla, and classes was similar to those described in other studies [53, 54]. While the self-organized process of the formation of the rhizosphere microbial community indicated by the consistent occurrence of the same taxonomic groups across different geographical zones is still a matter of research, it appears that the genetic modification did not interfere with this process. The response of vascular arbuscular (VA) mycorrhizal fungi, which commonly belong to the phylum Glomeromycota, to maize expressing Cry1Ab has been investigated, but Bt-specific effects found in one greenhouse study could not be confirmed under field conditions [25, 42, 55]. In our study, Glomeromycota was represented by only 0.050 ± 0.087% of the fungal ITS sequences, suggesting that VA mycorrhization of maize cultivated at the different field sites across Europe had no importance. It has to be noted, that PCR-based surveys of ITS diversity can underestimate the abundance of Glomeromycota [56, 57]. Yet, the lack of mycorrhization would not be unexpected considering that soil tillage and excessive fertilization with nitrogen, potassium, and phosphate are not unusual in maize cultivation in Europe. The functional genes nirK and nirS were analyzed in this study because they were suspected to be sensitive to a modified rhizodeposition. In fact, bacterial communities involved in denitrification were found to respond to the quantity and quality of root exudates [58]. Several studies have indicated that, even though both genes encode an enzyme catalyzing the same reaction, their ecological patterns are different suggesting specific, yet poorly understood niche adaptation [59-62]. When comparing nirS and nirK encoded proteins, it was also suggested that nirK is more frequently associated with incomplete denitrification than nirS. Consequently, a higher expression of nirK versus nirS would lead to an increased production of the greenhouse gas N2O, while higher nirS expression would mean larger N2O sink capacity [63, 64]. On average, nirK was approximately 500-fold more abundant than nirS in our samples. At the four sites during the three years included in our study, nirK abundance was affected by the genetic modification of maize only in two isolated cases and only to a minor extent. These results suggest that maize cultivation at these sites may not be favorable for avoiding the adverse effect of N2O emission but a replacement of conventionally bred maize by Bt maize MON810 would be neutral in this regard assuming no change in agricultural management practices. If only one year, 2014, had been included in our study, it would have concluded based on 161 differentially abundant nirK TSVs containing almost 70% of all nirK sequences, that soil bacteria with the genetic potential to reduce nitrite and to be involved in the production of the greenhouse gas N2O were affected by the genetic modification of the plant at the site in Slovakia, while at other sites this did not occur. This would suggest that the genetic modification can alter the soil microbiome depending on factors like climate or soil type. Results from the other two years from the Slovakian site, however, did not confirm this observation, showing that it was a sporadic event which did not reflect a common biological response to the cultivation of maize MON810. It should be noted that the dramatic change observed in the structure of the nirK-type denitrifier community in Slovakia in 2014 likely did not translate to a large effect at the functional level since many TSVs that showed the opposite response were affiliated with the same bacterial taxa. Similarly, isolated data from 2014 indicated a decline in the abundance of nirK genes in response to the genetic modification of maize at the Swedish site, accompanied by an increase in fungal abundance indicated by ITS sequences. Annual replication, however, did not confirm these responses, suggesting that they were owed to the high variability of microbiological parameters which may be encountered at field sites exposed to variable weather conditions. Considering the potential consequences that such misconceptions derived from data from only one season could imply for an environmental risk assessment, our study underlines the crucial importance of collecting data from more than one growing season. The importance of annual replication was also a major conclusion of a recent review on GM effects on fungal communities [65]. In conclusion, this study demonstrates, with a highly sensitive microbial community analysis which also covered less abundant community members, that the genetic modification enabling Bt maize MON810 to express the insecticidal protein Cry1Ab has no tangible effect on the composition of its rhizomicrobiome. The sporadic differences found in the abundance and community structure of rhizosphere Bacteria, Archaea, Fungi, and denitrifiers between MON810 maize and its near-isogenic comparators were minor or unlikely to affect community functions. Furthermore, these were isolated cases not consistently observed in subsequent years. Our results clearly indicate that for an accurate assessment of the effects of GM plants on their rhizomicrobiome, annual replication is even more important than the consideration of field sites from different biogeographical zones.

Data matrices obtained from high-throughput sequencing.

(XLSX) Click here for additional data file.

Sequences of primers and probes used in qPCR.

(DOCX) Click here for additional data file.

The nirK translated sequence variants (TSVs) differentially abundant between the non-BT and BT samples from the Slovakian site in 2014.

Relative abundances are indicated as percentages (average ± standard deviation). The p-values are from Welch’s t-tests from ALDEx2 with Benjamini-Hochberg correction. The IDs of the nearest matching sequences from the FunGene nirK reference database and their source organisms are included. (DOCX) Click here for additional data file. 14 Oct 2019 PONE-D-19-24482 Annual replication is essential in evaluating the response of the soil microbiome to the genetic modification of maize in different biogeographical regions PLOS ONE Dear Dr. Christoph Tebbe, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We would appreciate receiving your revised manuscript by Nov 28 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Luigimaria Borruso Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf Additional Editor Comments (if provided): [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The paper "Annual replication is essential in evaluating the response of the soil microbiome to the genetic modification of maize in different biogeographical regions" is interesting and intriguing paper, but my first impression is that, despite a large amount of data it should have been obtained from analyses, there is a is little in-depth analysis and enhancement of them. I think that it should be enhanced, by re-organizing it in a more linear structure. The Introduction is very clear and specific and it well focus on the subject of the work. Furthermore, it is also very smooth and pleasant to read. Materials and methods are very detailed but not very fluent, so I suggest to change the text to make it more pleasant, perhaps by eliminating repeating parts. The Results and discussion should be ordered, them are dispersive, it would be good to reorganize them in a more schematic way. Discussions are interesting and well focused on the results, but need to be reworked and more detailed. I provide some suggestions for the authors, as follows: 114-121: it would be good to insert the data of the soils in a table (or insert them in table 1). Moreover, have the chemical-physical data been collected every year? Or just once? It is not clear, please clarify it. 122-130: is the protocol already described in some work and/or modified by some other paper on the same topic? please specify it. 178-180: why authors used two libraries with different chemistries performed? Since the aim of the work is a comparative study of the microbiome, this could lead to an error in the comparison of the results. Did authors consider it? Please state this choice. 204: why was the 123 database chosen (release 2015), considering that the most recent version is 132 ( release 2018)? 322-329: I suggest to outline the community found in a table, with the percentage of phyla and genus retrieved in samples. I would also add a table with sequencing yields results reported in the text (easier to follow). 410-417: this sentence is very convoluted, it would be good to write the concept better. 430-432: the results are interesting, but why authors showed only the graph related to one of the sampling years? Authors should show them all in a single graph. 462-472: was the concentration of the Cry1Ab samples measured? If yes, authors should add it to material and methods as well as in the results. If not, all that period should be modified. Reviewer #2: Number: PONE-D-19-24482 Title: Annual replication is essential in evaluating the response of the soil microbiome to the genetic modification of maize in different biogeographical regions General comments The research is original, following established scientific procedures and it is scientifically sound. The manuscript is well structured and the writing is concise and the English level allows a fluent lecture to understand the concepts and the authors’ intent. Therefore, please clarify a few things and finally, I would like to recommend the manuscript for the publication in PLOS ONE. Detailed comments Line 39: Instead of colon (:), I would rather prefer a point (.) after “decades”. Line 40: Please write Nowadays instead of “Today”. Line 68: Please use a comma (,) instead of “and” after “18S rRNA”. Line 71: Please write Among them instead of “E.g”. Line 73: Please add the abbreviation (N) after “nitrogen”. Line 117- 121: Please write “…total C and …total N contents”. Line 131: Please uniform the modus of reporting Throbäck et al. (2004) according the Journal’s requests. Line 251-253: Although the results in terms of abundance of 16S rRNA and nirS genes were not significant as a function of site and sampling year, I would like to see them in Table 2. Please add them. Line 370-372: I am wondering why the results of ITS diversity for the year 2014 are not shown in Figure 3. Please double-check. Figure 5: Why did you choose to perform the NMDS analysis of results concerning the year 2013 and not for the other two years (2012 and 2014)? References: Please check and uniform the references following the author's guidelines. Line 599: Please write “Bacillus thuringiensis” in italic font. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 24 Oct 2019 Dear Editor and Reviewers, we are grateful for your constructive comments that helped us improved the manuscript. Below we address the points and questions raised. Reviewer #1: R:The paper "Annual replication is essential in evaluating the response of the soil microbiome to the genetic modification of maize in different biogeographical regions" is interesting and intriguing paper, but my first impression is that, despite a large amount of data it should have been obtained from analyses, there is a is little in-depth analysis and enhancement of them. I think that it should be enhanced, by re-organizing it in a more linear structure. The Introduction is very clear and specific and it well focus on the subject of the work. Furthermore, it is also very smooth and pleasant to read. Materials and methods are very detailed but not very fluent, so I suggest to change the text to make it more pleasant, perhaps by eliminating repeating parts. The Results and discussion should be ordered, them are dispersive, it would be good to reorganize them in a more schematic way. Discussions are interesting and well focused on the results, but need to be reworked and more detailed. A:This work was based on a large amount of data which, we agree, could be used to support the investigation of further questions. The aim of this manuscript, however, was not to present every bit of information that is possible to gain from the data but to fulfill the specific goals of the project as outlined in the introduction and present a focused study. The Results and Discussion sections are structured in a linear fashion along these goals. The materials and methods section was checked for redundancy. The data can be utilized to explore further questions in future manuscripts and is made available to the scientific community both as the raw sequencing output (European Nucleotide Archive) and a data matrices of the SV and TSV counts (Supplementary file 1). R:I provide some suggestions for the authors, as follows: 114-121: it would be good to insert the data of the soils in a table (or insert them in table 1). Moreover, have the chemical-physical data been collected every year? Or just once? It is not clear, please clarify it. A: The soil parameters were measured at every sampling time but had little variation. The goal of the project was not to study the effects of soil parameters on the rhizomicrobiome of maize, thus they are shown only as background information and were not used in the data analysis. Since the four sites were located in different biogeographical regions, they differed not just in soil parameters. It was more appropriate to use “site” in the analysis as a factor that combines the effects of soil type, climate etc. R: 122-130: is the protocol already described in some work and/or modified by some other paper on the same topic? please specify it. A: Obtaining samples of the rhizosphere by washing closely attached soil particles off the roots is a common practice. Yet the exact sample masses, volumes, and centrifugation parameters are optimized to each case and thus differ between studies. R: 178-180: why authors used two libraries with different chemistries performed? Since the aim of the work is a comparative study of the microbiome, this could lead to an error in the comparison of the results. Did authors consider it? Please state this choice. A: Sequencing of the bacterial and archaeal 16S rRNA amplicons from the samples from 2012 and 2013 took place before the sampling in 2014. At that time, the V3 chemistry was not available. Sequencing the 16S rRNA gene from the 2014 samples, and the nirK and ITS from all of the samples were performed later with the V3 chemistry. We agree that the potential bias of the different sequencing chemistries can add to or modify the differences in the 16S data between the 2014 samples and the samples from the other two years. Unfortunately, this effect can’t be separated from the year-to-year variation in this case. Being aware of this limitation, we did not quantify or test the significance of the differences in bacterial and archaeal community structure between 2014 and the other two years. The only exception is the Simpson diversity index, which we compared between the years. In this case, however, the only significant difference we found was driven by the high abundance of one SV in the Slovakian samples from 2013 (lines 356 – 361). We consider it extremely unlikely that this result is caused by the different sequencing chemistries. The analysis of the bacterial and archaeal community structure was focused on comparing the Bt to the non-Bt samples from the same site and year which were processed with the same sequencing chemistry in each case. A year-to-year variation in the bacterial and archaeal community structure was observed on the PCA plots (Figure 4 A-D). Potential biases of the sequencing chemistries can contribute to, but certainly not solely responsible for the distance of the 2014 samples from the other samples on the plots, especially considering the clear separation between the 2012 and 2013 samples. Accordingly, the presence of year-to-year variation was stated but it´s effect size was not quantified and responding SVs or taxa were not reported (lines 377 – 380). R: 204: why was the 123 database chosen (release 2015), considering that the most recent version is 132 (release 2018)? A: Version 123 was the most up-to-date release of the SILVA reference at the time of the analysis of the 16S sequencing data. R: 322-329: I suggest to outline the community found in a table, with the percentage of phyla and genus retrieved in samples. I would also add a table with sequencing yields results reported in the text (easier to follow). A: Such an outline of the community in a table format would result in two enormous tables, one for 16S the other for ITS, with 556 and 427 rows respectively. Furthermore, it would provide much information relevant to the objectives of the manuscript. Interested readers can easily generate these tables from the SV matrices provided in Supplementary file 1. R: 410-417: this sentence is very convoluted, it would be good to write the concept better. A: This section consists of short sentences with simple structure. They are not describing a concept just making simple statements. R: 430-432: the results are interesting, but why authors showed only the graph related to one of the sampling years? Authors should show them all in a single graph. A: The site in Denmark was not sampled in 2012 and the site in Spain in 2014 (Table 1 and also line 123). Therefore, the data from 2013 is the best to demonstrate the point raised in this section as it includes all the sites. R: 462-472: was the concentration of the Cry1Ab samples measured? If yes, authors should add it to material and methods as well as in the results. If not, all that period should be modified. A: The concentration of the Cry1Ab protein was not measured in the rhizosphere samples. The fact that MON810 releases it in its rhizosphere has been demonstrated previously in several studies (see references in the section). Reviewer #2: General comments The research is original, following established scientific procedures and it is scientifically sound. The manuscript is well structured and the writing is concise and the English level allows a fluent lecture to understand the concepts and the authors’ intent. Therefore, please clarify a few things and finally, I would like to recommend the manuscript for the publication in PLOS ONE. Detailed comments R: Line 39: Instead of colon (:), I would rather prefer a point (.) after “decades”. - A: Corrected. R: Line 40: Please write Nowadays instead of “Today”. A:Corrected. R: Line 68: Please use a comma (,) instead of “and” after “18S rRNA”. A:“And” is appropriate. R: Line 71: Please write Among them instead of “E.g”. A: Corrected. R: Line 73: Please add the abbreviation (N) after “nitrogen”. A: We don’t consider it necessary to indicate the chemical symbol of nitrogen. It’s known by the readers. R: Line 117- 121: Please write “…total C and …total N contents”. A: Corrected. R: Line 169: Please uniform the modus of reporting Throbäck et al. (2004) according the Journal’s requests. A:The references were updated. R: Line 251-253: Although the results in terms of abundance of 16S rRNA and nirS genes were not significant as a function of site and sampling year, I would like to see them in Table 2. Please add them. A: Differences between sites and sampling years are shown in Figure 1. R: Line 370-372: I am wondering why the results of ITS diversity for the year 2014 are not shown in Figure 3. Please double-check. A: The samples from 2014 were not included in the fungal ITS sequencing due to financial constraints. We apologize that a clear statement on this was missing from the method section. We added it to lines 181 and 341. R: Figure 5: Why did you choose to perform the NMDS analysis of results concerning the year 2013 and not for the other two years (2012 and 2014)? A: The NMDS plots in Figure 5 serve to demonstrate that regarding differences between the sites, a similar pattern was found in the 16S, nirK, and ITS datasets approximating the geographical distances between the sites. The site in Denmark was not sampled in 2012 and the site in Spain in 2014 (Table 1 and also line 123). Therefore, the data from 2013 is the best to demonstrate this as it includes all the sites. R: References: Please check and uniform the references following the author's guidelines. A: The references were updated. R: Line 599: Please write “Bacillus thuringiensis” in italic font. A: Corrected. Submitted filename: Response to the reviewers.docx Click here for additional data file. 26 Nov 2019 PONE-D-19-24482R1 Annual replication is essential in evaluating the response of the soil microbiome to the genetic modification of maize in different biogeographical regions PLOS ONE Dear Dear Prof. Dr. Christoph C Tebbe, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. ============================== I will be delighted to accept personally your manuscript after you have responded to the last few requirements of Reviewer 2. ============================== We would appreciate receiving your revised manuscript by Jan 10 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Luigimaria Borruso Academic Editor PLOS ONE [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: (No Response) ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: All comments indicated in the review have been addressed in a clear and categorical way. I am fully satisfied. Reviewer #2: Number: PONE-D-19-24482R1 Title: Annual replication is essential in evaluating the response of the soil microbiome to the genetic modification of maize in different biogeographical regions General comments The quality of the revised manuscript has been improved. Thanks to the authors that have followed the reviewers’ comments. Therefore, please clarify a few things and finally, I would like to recommend the revised manuscript for the publication in PLOS ONE. Detailed comments Line 122: Please remove a bracket. Line 379: “did not” instead of “do not”. Line 384: “showed” instead of “show. Line 386: “did not” instead of “do not”. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 26 Nov 2019 All four modifications suggested for the 2nd revision have been accepted and implemented Submitted filename: Response to the 2ndreviewerscomments.docx Click here for additional data file. 2 Dec 2019 Annual replication is essential in evaluating the response of the soil microbiome to the genetic modification of maize in different biogeographical regions PONE-D-19-24482R2 Dear Dr. Christoph C Tebbe, We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication. Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. With kind regards, Luigimaria Borruso Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 6 Dec 2019 PONE-D-19-24482R2 Annual replication is essential in evaluating the response of the soil microbiome to the genetic modification of maize in different biogeographical regions Dear Dr. Tebbe: I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. For any other questions or concerns, please email plosone@plos.org. Thank you for submitting your work to PLOS ONE. With kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Luigimaria Borruso Academic Editor PLOS ONE
  42 in total

1.  Development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform.

Authors:  James J Kozich; Sarah L Westcott; Nielson T Baxter; Sarah K Highlander; Patrick D Schloss
Journal:  Appl Environ Microbiol       Date:  2013-06-21       Impact factor: 4.792

Review 2.  Going back to the roots: the microbial ecology of the rhizosphere.

Authors:  Laurent Philippot; Jos M Raaijmakers; Philippe Lemanceau; Wim H van der Putten
Journal:  Nat Rev Microbiol       Date:  2013-09-23       Impact factor: 60.633

3.  Reassessing PCR primers targeting nirS, nirK and nosZ genes for community surveys of denitrifying bacteria with DGGE.

Authors:  Ingela Noredal Throbäck; Karin Enwall; Asa Jarvis; Sara Hallin
Journal:  FEMS Microbiol Ecol       Date:  2004-09-01       Impact factor: 4.194

Review 4.  Genomics and Ecology of Novel N2O-Reducing Microorganisms.

Authors:  Sara Hallin; Laurent Philippot; Frank E Löffler; Robert A Sanford; Christopher M Jones
Journal:  Trends Microbiol       Date:  2017-08-10       Impact factor: 17.079

5.  Spatial soil heterogeneity has a greater effect on symbiotic arbuscular mycorrhizal fungal communities and plant growth than genetic modification with Bacillus thuringiensis toxin genes.

Authors:  Tanya E Cheeke; Ursel M Schütte; Chris M Hemmerich; Mitchell B Cruzan; Todd N Rosenstiel; James D Bever
Journal:  Mol Ecol       Date:  2015-04-20       Impact factor: 6.185

6.  Bulk and rhizosphere soil bacterial communities studied by denaturing gradient gel electrophoresis: plant-dependent enrichment and seasonal shifts revealed.

Authors:  K Smalla; G Wieland; A Buchner; A Zock; J Parzy; S Kaiser; N Roskot; H Heuer; G Berg
Journal:  Appl Environ Microbiol       Date:  2001-10       Impact factor: 4.792

7.  Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies.

Authors:  Anna Klindworth; Elmar Pruesse; Timmy Schweer; Jörg Peplies; Christian Quast; Matthias Horn; Frank Oliver Glöckner
Journal:  Nucleic Acids Res       Date:  2012-08-28       Impact factor: 16.971

8.  The variability of the 16S rRNA gene in bacterial genomes and its consequences for bacterial community analyses.

Authors:  Tomáš Větrovský; Petr Baldrian
Journal:  PLoS One       Date:  2013-02-27       Impact factor: 3.240

9.  Environmental Filtering of Microbial Communities in Agricultural Soil Shifts with Crop Growth.

Authors:  Sarah K Hargreaves; Ryan J Williams; Kirsten S Hofmockel
Journal:  PLoS One       Date:  2015-07-30       Impact factor: 3.240

10.  FunGene: the functional gene pipeline and repository.

Authors:  Jordan A Fish; Benli Chai; Qiong Wang; Yanni Sun; C Titus Brown; James M Tiedje; James R Cole
Journal:  Front Microbiol       Date:  2013-10-01       Impact factor: 5.640

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.