Literature DB >> 31834893

Genome wide identification and characterization of microsatellite markers in black pepper (Piper nigrum): A valuable resource for boosting genomics applications.

Ratna Kumari1, Dhammaprakash Pandhari Wankhede1, Akansha Bajpai1, Avantika Maurya1, Kartikay Prasad1, Dikshant Gautam1, Parimalan Rangan1, M Latha1, Joseph John K1, Suma A1, Kangila V Bhat1, Ambika B Gaikwad1.   

Abstract

Black pepper is one of the most valued and widely used spices in the world and dominates multi-billion dollar global spices trade. India is amongst the major producers, consumers and exporters of black pepper. In spite of its commercial and cultural importance, black pepper has received meagre attention in terms of generation of genomic resources. Availability of markers distributed throughout the genome would facilitate and accelerate genetic studies, QTL identification, genetic enhancement and crop improvement in black pepper. In this perspective, the sequence information from the recently sequenced black pepper (Piper nigrum) genome has been used for identification and characterisation of Simple Sequence Repeats (SSRs). Total 69,126 SSRs were identified from assembled genomic sequence of P. nigrum. The SSR frequency was 158 per MB making it, one SSR for every 6.3 kb in the assembled genome. Among the different types of microsatellite repeat motifs, dinucleotides were the most abundant (48.6%), followed by trinucleotide (23.7%) and compound repeats (20.62%). A set of 85 SSRs were used for validation, of which 74 produced amplification products of expected size. Genetic diversity of 30 black pepper accessions using 50 SSRs revealed four distinct clusters. Further, the cross species transferability of the SSRs was checked in nine other Piper species. Out of 50 SSRs used, 19 and 31 SSRs were amplified in nine and seven species, respectively. Thus the identified SSRs may have application in other species of the genus Piper where genome sequence is not available yet. Present study reports the first NGS based genomic SSRs in black pepper and thus constitute a valuable resource for a whole fleet of applications in genetics and plant breeding studies such as genetic map construction, QTL identification, map-based gene cloning, marker-assisted selection and evolutionary studies in Piper nigrum and related species.

Entities:  

Year:  2019        PMID: 31834893      PMCID: PMC6910694          DOI: 10.1371/journal.pone.0226002

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Spices have been an important ingredient of food for human consumption all over the world since time immemorial. Among the spices, black pepper (Piper nigrum L.), is the most widely used spice in the world and therefore commercially the most important one, no wonder it is known as ‘the king’ of spices [1]. Black pepper (2n = 4x = 52) is a perennial woody climbing vine of the Piperaceae family. The berries (dried mature fruits) are of economic importance owing to its pungency and flavour, attributed to alkaloid Piperine and volatile oil, respectively [1,2]. Black pepper is used in human diet as spice and seasoning as well as for several other purposes such as traditional medicines, preservatives and perfumery [3]. Piperine, an alkaloid from black pepper is reported to possess cytotoxic activity towards tumour cell lines [4], antipyretic, analgesic, anti-inflammatory activities and is also shown to protect against chemical carcinogens [5]. Piperine in diet, however, is known to stimulate digestive enzymes and thus enhance digestion [6] and therefore black pepper has been an important ingredient of food preparations in different parts of the world. In commercial perspective, the global market of spices is estimated to be USD 12 billion, of which black pepper constitutes a major share with India among the leading exporters [7]. However, there is still tremendous potential and scope to increase the larger share of India in global market. Black pepper has its origin in Western Ghats of India (south western regions of India) from where it spread to Indonesia, Malaysia and other South-East Asian countries [8]. Western Ghats, especially the Kerala state of India harbours the maximum genetic diversity of black pepper [8]. However, there have been a very few studies on genetic diversity using molecular markers [9-13] primarily due to limitations in genetic resources availability. Therefore black pepper remained largely untouched from genomic interventions. Advances in plant genomics have facilitated deeper insights to crop diversity at species as well as gene levels [14]. Availability of genomic resources in the form of DNA based markers, is expected to accelerate basic research such as genetic map construction, QTL/gene mapping, comparative genomics and ultimately molecular breeding which expedite pace of varietal development [15-19]. Among the DNA based markers, micro-satellite or Simple Sequence Repeat markers are a preferred marker system of researchers owing to their advantages such as reproducibility, multi-allelic and co-dominant nature and genome coverage [20]. Additionally, SSRs are also amenable to high throughput genotyping platforms, albeit with the lower automation efficiency than SNP genotyping technologies. Microsatellites or SSRs are tandem repeats of 1 to 6 nucleotide found interspersed in the genome (both coding and non-coding regions) [21]. In black pepper there have been only a few reports of generation of SSRs [13, 22]. Lately, transcriptome based approaches have been employed for generation of SSRs in black pepper [23-24]. These approaches largely represent only expressed portion of the genes and are restricted to only the genic regions of the genome thus limiting their applications in linkage map construction, diversity and evolutionary studies. The advances in next generation sequencing (NGS) technologies have accelerated marker generation with higher efficiency [25-26]. This also has expedited identification of simple sequence repeats (SSR) and their flanking regions for generation of PCR based markers. NGS has been used in recent years for generation of genomic SSRs in wide range of plants species such as watermelon [27], cotton [28], finger millets [29], Foxtail Millet [30], faba bean [26], progenitors of peanut, Arachis duranensis and A. ipaensis [31] and Maqui [32]. The flanking regions of SSRs are usually conserved across related species or genera and hence the primers developed in one species can be tested for amplification across related species and genera, and is known as cross species amplification or transferability [33]. This saves time, effort and resources in the development of SSR markers in related species. In the recent past, cross species amplification has been used in several crops for genetic and evolutionary studies [34-40]. We recently have sequenced the draft genome of the black pepper (P. nigrum) using the Illumina, PacBio (NCBI GenBank: PRJNA412127) and IRYS sequencing platforms to generate a draft genome comprising of 916 scaffolds at a genome coverage of 80X (manuscript under preparation) and used the sequence information for genome wide mining and characterization of SSR in black pepper. This is the first report of large scale generation of genomic SSR sequences in black pepper. The SSR markers developed from Piper nigrum were tested for cross amplification in nine Piper species. The polymorphic SSR markers identified in the present study can be directly used in other species for diversity analysis and genetic and evolutionary studies especially in the species where they are not available.

Materials and methods

The plant material included 30 accessions of Piper nigrum and eighteen accessions belonging to ten Piper species (including two accessions of P. nigrum). The leaf samples were collected from ICAR-NBPGR regional station, Thrissur, Kerala, India. The leaf samples were fixed in liquid nitrogen and stored at -80°C until extraction. The list of accessions (P. nigrum and Piper sps.) used for diversity analyses and cross species transferability study have been shown in Table 1 and Table 2, respectively.
Table 1

List of Piper nigrum accessions used for validation of SSRs and diversity analysis.

S. No.Accession no.Cultivar nameVillageDistrict
1IC85318NadanKuttampuzha, AdimaliIdukki
2IC85320KarimundaPuyamkuttiIdukki
3IC85354VattamundiNedunkandamIdukki
4IC85375Narayakkodi55mile PeermedIdukki
5IC85386MalamundiThadiyanpadIdukki
6IC85387KarimundaThadiyanpadIdukki
7IC85388NeelamundiThadiyanpadIdukki
8IC85396ChomalaMekkazhoorPathanamthitta
9IC85397KarimundaPerinaduPathanamthitta
10IC85402PalikkodiKochandiPathanamthitta
11IC85410ThottamundaChittarPathanamthitta
12IC85418KarivalliKonniPathanamthitta
13IC85433CholakkodiChambakkaraKottayam
14IC85434OttanadanKallaraKottayam
15IC85543KureidmundiPanniyurCannanore
16IC360238ValiyaramundaArikkakavuIdukki
17IC360239NarayakkodiPadayinipparaIdukki
18IC266410KarimundaMandiram, RanniPathanamthitta
19IC266409KottakkodiMandiram, RanniPathanamthitta
20IC266446VallyPanniyur, KAUCannanore
21IC266457PerumkkodiPanniyur, KAUCannanore
22IC373832ThottumuriyanMavilaKollam
23IC373837AnnarvarayanUmmannoor, KottarakarKollam
24IC373831NarayakkodiAriyankavu, ThenmalaKollam
25IC373755VadakkanKulathur, KottarakaraKollam
26IC373782MundaVeerapuliKanyakumari
27TCR 353
28P1Panniyur 1
29TCR 229
30TCR 383Karimunda
Table 2

List of accessions in different Piper species used for cross species amplification.

S. No.Species NameTCR No.
1Piper nigrumTCR 419
2Piper nigrumTCR 8
3Piper longumTCR 212
4Piper longumP25
5Piper arboreumTCR 267
6Piper arboreumPiper arboreum
7Piper argyrophyllumTCR 302
8Piper argyrophyllumTCR 365
9Piper attenuatumTCR 171
10Piper betelTCR 166
11Piper betelTCR357
12Piper betelPiper betel Lakshdweep
13Piper chabaTCR 149
14Piper chabaTCR265
15Piper hymenophyllumTCR345
16Piper trichostachyonTCR363
17Piper trichostachyonTCR279
18Piper wallichiPiper wallichi Andaman

Identification of microsatellites from Piper nigrum

Total genomic DNA was isolated from the leaf samples using CTAB extraction method [41]. The purified DNA was checked on 1% agarose gel and quality checked on Nanodrop (DS-11 spectrophotometer, DeNovix, Wilmington, Delaware). Finally DNA was quantified using Qubit 2.0 fluorescence spectrophotometer (Life Technologies) for preparing genomic libraries. Draft genome sequence of black pepper (unpublished data) generated using short reads, long reads and optical mapping, assembled into less than 1200 scaffolds with a N50 of more than 5 Mb was used for mining microsatellites. The genome sequence of Piper nigrum was searched for presence of different microsatellite repeats from di to hexa nucleotide simple as well as complex repeats following the default parameter of MISA -MIcroSAtellite identification tool (http://pgrc.ipk-gatersleben.de/misa/). The SSRs were identified from the draft genome using MISA perl scripts [42]. The search criteria included minimum of six repeats of dinucleotides, minimum five repeats for trinucleotides, tetranucleotides, pentanucleotides and hexanucleotides. The identified SSRs were then classified into perfect and compound and on the basis of type of repeat motif present. The genome sequence annotation (.GFF files) was used for defining SSRs in the genic and intergenic regions.

SSR primer design and validation

The primers were designed from the flanking sequences of identified SSRs using software Primer 3 [43]. Primers were designed for 66997 of the 69126 identified SSRs. 85 SSR primer pairs were synthesized for wet lab validation. The genomic DNA was isolated from leaf tissue using CTAB DNA extraction method. The quality of DNA was checked on 1% agarose gel and quantified using nanodrop spectrophotometer. The PCR reaction consisted of total volume of 20μl comprising of 1X PCR buffer, 2.5mM MgCl2, 1μM primer, 0.2mM of each dNTPs, 1U Taq DNA polymerase (NEB) and 15 ng template DNA. The PCR reaction was carried out in thermal cycler (Eppendorf) with the following program: Initial denaturation at 95°C for 5min followed by 35 cycles of denaturation at 95°C for 1min, annealing at 50–58°C for 1min and extension at 72°C for 1min followed by final extension at 72°C for 10min. The amplification products were resolved on 3% metaphor gel. A 50bp DNA ladder was used as size standard. For diversity analyses, amplified products were resolved on QIAxcel multi-capillary system using QIAxcel High Resolution Kit 1200 (QIAGEN, No 929002), 50-800bp v2.0 Qx DNA size marker (QIAGEN, No 929561) and 15bp/1000bp Qx alignment marker (QIAGEN, No. 929521). PCR products were separated with high resolution run method OM700 with a sample injection time of 10 seconds. The allelic sizes of each sample were resolved and calculated in the form of gel profiles and peaks using QIAxcel Screengel Software (QIAGEN, v1.5).

Data analysis

The SSR amplification products (bands) were scored across the lanes according to their molecular weight. The alleles were scored as present (1) or absent (0) in the binary format to assess diversity and genetic relationship among the P. nigrum accessions. The data was analysed using software program NTSYS-pc ver. 2.1 [44]. The Jaccard’s similarity index was calculated between pairs of genotypes. The genotype x allele similarity index was subjected to UPGMA (unweighted pair group method for arithmetic mean) analysis and a dendrogram was generated. To study cross species transferability of SSR, the bands were scored across the ten Piper species (including P. nigrum) and scored as present (+) and absent (–).

Results

The assembled genome sequence of Piper nigrum was searched for presence of different microsatellite repeats from dinucleotides to hexanucleotides, simple as well as complex repeats. Total 69,126 SSRs were identified from 430 Mb assembled genome sequence of P. nigrum. The frequencies of SSRs were 158 per Mbp making it one SSR for every 6.3 kb in the assembled genome sequence. From the total 69,126 SSRs, 54,869 (79.4%) were perfect SSRs and 14,257 (20.6%) were compound SSRs. Among the perfect SSRs, dinucleotide repeats were highest in number 33,594 (61.2%), followed by trinucleotide 16,375 (29.8%) and tetranucleotide repeats 4205 (7.6%). Pentanucleotide repeats were the least in number 278 (0.5%) (Fig 1). Among different types of repeats, it was observed that in each type, one particular motif was predominant. From the identified SSRs, 41% of the total dinucleotide repeats (33594) was ‘TA’, 12.9% of the trinucleotide repeats (16375) was ‘AAT’, 18.1% of the tetranucleotides repeats (4205) was ‘AATA’, 11.9% of the pentanucleotide repeats (278) was ‘AAAAT’ and 29.5% of the hexanucelotide repeats (417) was ‘CCGAAT’ (Fig 2). In case of compound SSRs, a majority (71.9%) were interrupted whereas 28.1% were uninterrupted compound repeats. In terms of genic and inter genic regions, distribution of SSRs were 21658 and 47468 respectively. Among the individual repeats type, distribution of dinucleotide, trinucleotide and tetra nucleotide SSRs in genic regions were 27%, 46.4% & 21.4%, respectively (Fig 3). The penta and hexa repeats were 33.8% and 35.2%, respectively, whereas the compound SSRs were present to the tune of 30% of the total in the genic regions.
Fig 1

Distribution of simple sequence repeats in the draft genome sequence of black pepper (Piper nigrum).

Fig 2

Abundance of specific SSR motifs in di- to hexanucleotides repeats in the Piper nigrum genome.

Fig 3

Distribution of SSRs identified in genic and intergenic regions of Piper nigrum.

There was also significant presence of SSRs in transposable elements. From the total SSRs identified 56% (38382) were from the region with transposable elements. The proportionate abundance of each repeat type (di- to hexa-nucleotide and compound repeats) followed a similar pattern with more number of microsatellites being present in the transposable element region than in the non-transposable element region (Fig 4).
Fig 4

Distribution of SSRs identified in regions with transposable elements in Piper nigrum.

Development and validation of SSR primers

In order to use the genome wide SSRs mined from the black pepper genome as PCR based SSR markers, forward and reverse primers were designed for 66997 SSRs using Primer3 program. For each SSR, five different sets of primers were designed (S1 Table). In order to validate the identified SSRs, a set of 85 SSR primers were custom synthesized (Table 3) and checked for PCR amplification. Out of 85 primer pairs, 74 primer pairs produced amplification product of expected size. For diversity analysis, 50 of the validated 74 SSR markers were used on 30 landraces of black pepper. All these 50 SSR loci were polymorphic in nature. A representative amplification profile of 30 black pepper accessions with SSR primer BPSSR27 as resolved on QIAxcel multi-capillary system is shown in Fig 5. From the 50 primers, a total of 215 alleles were detected with an average of 4.3 alleles per locus. The allelic data was used to calculate pairwise Jaccard’s similarity coefficients that ranged from 0.08 to 0.69 with an average of 0.34. The similarity index was subjected to UPGMA analysis and a dendrogram was generated. The dendrogram grouped 30 landraces into four major clusters (Fig 6).
Table 3

List of 74 validated SSR primer pairs from black pepper used for diversity analysis and cross species transferability.

Primer IDSSR motifForward primer (5’-3’)Reverse primer (5’-3’)Annealing Temperature (ºC)Product size (bp)
BPssr_1GTGCTGGGTCACACATAGGTCCTTGAGGCTATGGCGGTAAGT57277
BPssr_2TCTTAGCAAAGCGCAAACCCACACCAACTGATCGTGACCGTC57272
BPssr_3GATAGGCGGTGGCAAAACAGTTGCATACCCACCACATACGT57280
BPssr_4GACTTCTGTGATGGGCGAAGGTGTGATGACCAGCTCTTGCCT56231
BPssr_5ACGGCCCCAACTCTCCTACAACCCAACACACACACATCAGCC57167
BPssr_6TGTTGTGCATGTGTGGAGGTGTCGCCAGCGTTGTCCTACATA57214
BPssr_7TAGGGAGAGAAGGGGTGAGATGCCCTCTCTTATCAATGCGCCT57158
BPssr_8CACACTATTGTCGGGATGGCCAACCGATGACGTCCTCGACTA56153
BPssr_9GATGTTCTAGAGCCTGGACCCATTCCTGTGCGTTGGTAGCAT54162
BPssr_10TCAGGCGGTAATGGATTGGGTGGTTCTTCTCGCCTTGGTCCA56201
BPssr_11TGCCTACCGAGAGCTTGAGCACGCAGTCGGGCACTCTACATT57214
BPssr_12ATCCCAGGTTGAGGGTGGAAAAAGTCGTAGCGGGAAAAACAGA57193
BPssr_13ACACGGTGATGTCGGTTCCATTTCCTCTTCGGCATGGTACCT56218
BPssr_14GTCACTGCTGCCCTAGTTCGAAATCACCATCCACTCGGTGTG55180
BPssr_15ATGTTGCACCGACCATGCTTTTAGGAGCCGAGAAAGCAGAAG55176
BPssr_16TAGTTGAGCCCGTCACATACCAGCTCCTTTCTGACCTGCCAT55216
BPssr_17ATCCATTCGCCGACCCATATGAATGATCAACCCGGCGAACTT57210
BPssr_18ATTGCCTATCGTTATTTTTGTGAGCTAAGTTGGCTTCCCACGAGAG54220
BPssr_19TCATGCCCGGTATGACTTGGACGACGTGGAATGCTGCCTAGA55192
BPssr_20ATTTCTGACCGTGTCCGATTGTATCACTCCGAGTTGGCTTGG57187
BPssr_21TATTGAGATTGGCCCCTTCGAACCCGTATCCAGAAGAACGCGA56177
BPssr_22CCTACGTTCTCACCGCTTCACTTTCCGCCACTTCGATTTTCCA57193
BPssr_23CCGTCTCGTGAAACATGGACGGGGCTAATGGGCTGCGGTTTTT58173
BPssr_24GGCACTTTGGCTCGATCGAAGGGATCCCAGGAAGCCATTGACG58162
BPssr_25ATTTCAATTGACGTGGGCACTGTGATCAGACCAGCCCACCTTC58241
BPssr_26ATTCGACGTGTCGCGCAATTTATACCCAACCTGCACTCGAATT54208
BPssr_27TATTAAACAGCAAGGCCCCAAGTACCAAAAATTCCACGGCAGC55234
BPssr_28ATTCATCCATAATGTCCCCGGCAGGAGCGACCAGTAGTGATGG55272
BPssr_29ATTTGCATGCGTACCTTCACCTTAAGTGCATCACAATGGCCCT57245
BPssr_30ATTTCCTTGTTTGGAGGGGAGGAGGATGCAAATCAATGGCCGG57244
BPssr_31TTAGCGCTGCTGACATCAATGAGTACAGCGTAGGTTTGCACGT57163
BPssr_32ATTAAGCTTGATGCCTTCCCTCATGACATCCAAATCTGGCCGT57250
BPssr_33TTAGAGTTCCACCACCAGCTACCATTACATAAGCCGGCTCGCA57226
BPssr_34TAAGTGACAAGAAGCTTCGCTGCTCAGCCTTCAAGAGAGGGGA57207
BPssr_35TTAAAAAGGGTATGGGATGGCGGTAGGCACGTAGAAGCAGTGC55160
BPssr_36TATGGTTGGGGCACAAGTAGGTTTGGATCGGGAGGTGTGGTAT55157
BPssr_37AGAGCACATGAAGCCATTCGACCATCCAGTACACCAGCCAACG57174
BPssr_38TTAACGCACAAAGCATGCATGAGTGCGCACAGATTAGCCTTCA57275
BPssr_39AATCCTACAGAGGTTGCAGCACTATGGGTGCCGGTCCTCTATA56220
BPssr_40TAATCTGCTCTTGATGGTGGCAGACACGTGTCAGGAAATCCCC58262
BPssr_41(TA)T(TA)TTGAACCCACAACCTTGAGGGTGGTGACAGATAGGGCTGC55207
BPssr_43(ATAG)(AT)A(AT)TTCTCATTCACACGTGCACGCTTGCAAGTCATGGCATGCA55186
BPssr_44AATAACTCTGGAGCCTACATCGGATGCACATGTCTCGTTTTGCA57156
BPssr_45TATCAACAGGATGAGCTAATGGGAGACTGAATCGTTGGCCTGGA55201
BPssr_48TTATGGTTTGTGGTAGATTCAGACTATGAGTCGAGGCAAATGCTG57227
BPssr_49(AT)A(AT)AAATGCAATTAGGGGCCACCCTAGACGGAGGAGCAACGAG55183
BPssr_50(TC)(TA)TGGACGGCCTAGATTTGCTGAGGTCGTTGCAACATTTAGTGT57196
BPssr_51ATCCCCAACAAACCATTTGGCATTTTGAGAGGAGCCAAGCCG55195
BPssr_54ATGGACGTTGGCTAGGCTCTTAGATGCTAATGGAGACGCCGT57211
BPssr_55(TTC)(TCT)TTTTAACTCGACCGTGCCGAATGCTGTCCTGAGGTTGGTG57199
BPssr_56(TA)(TTTA)TCAGCTCTTTTTCAACCGCTAAACAAGGATTCCACTCATAGATATTT57285
BPssr_57TATTACTCTCCCTCTTTGCTTGGCTCAGTTCAAAAACCAACAAGGGA55170
BPssr_58(TATC)(TA)GCTGACTTTGTGCCCAACATCAAGATAAGCTGGAGGGGGC57251
BPssr_60ACCACACACACCCTCCCATGAATTTCCTCAGGGAGCTGTTGA57196
BPssr_61(TC)(AC)CACACACACACACACACAGGTTTGGATACGCGGGGTAAGC57196
BPssr_62ATGCGGGTAAGGATTTCTGCCTTGTGTGTGTGAGGGCCATTT57201
BPssr_64TAGGCAGTGTTCGACTCGGTTAAATGGGCTCGAGATGGAACG57227
BPssr_65AATCACACCATGCAGACAACTGTTCGTCGGTACAAGATGAACCA53290
BPssr_66TAACACACCATGCAGACAACTGTTCGTCGGTACAAGATGAACCA53245
BPssr_67TAAAGCCAATCGCATTAAGCCAAAAGCCAGAACCTAGGTGCC57202
BPssr_70GCGAACTGTTGAAACTGCTGCCGATAAGTAAATTCGCCGCCGC53206
BPssr_71AATAGGCCTCAAAAAGTGCAGGAATCAATCTTGCTCGGGGCTT53239
BPssr_72TTAACGTCATCAATCCGAGCTTGTGAGCCAAGCCAACCCAAAAT53204
BPssr_73ATCACGCGATCACGATCACGATCACGACGAACAGAGTCGAGGAGGA57199
BPssr_75TTACCCACCGAGTCGAACGTTATTCTGATGAGACACCCACAACT57230
BPssr_77TATATTGCCTCCCAAGAAGCGCACAGTTTTCCCACATGGTGC57191
BPssr_78ATATCTTGCACCTTTCTGATTGCAACAGCTTGCTCTTAATGTTACTCT57200
BPssr_79(AT)(AGTT)GCCATGTAGAGCGATCTGGTTCTTGCTCATGTTAGCTCACGT57233
BPssr_80(TG)(TA)CCAACCTGTCCACACAAGGATCCGGACCAGTAACACTTGT57169
BPssr_81ATAGTAGTGAGCGAATGAGGCTCTGGCGCACGTCAACTTTAT53223
BPssr_82TAATGGGTTAAGTGCTGGTAGTGTACTTGCATTATTGACATGAACATCA53205
BPssr_83TATCTTCGACTTCCCCTGGTCTGGTCGGTGCTACAACTGTGGA57152
BPssr_84CCTTCCAAGAAGCGCATCATCCAGGTTCGACACTTGGTCCGTT57197
BPssr_85TACCAACGGGAATGGAACAACCGGAGCTCGTCACCTATGTGG57198
Fig 5

Validation of SSR markers in germplasm accessions of black pepper (Piper nigrum).

Gel image of PCR amplification of SSR marker BPSSR27 on 30 germplasm accessions of P. nigrum as captured on QIAxcel ScreenGel software is shown on the left side. Numbers refer to accession numbers as mentioned in Table 1. The lane marked ‘M’ is DNA molecular weight standard 50-800bp v2.0 Qx DNA size marker. A representative electropherogram showing allele sizes of 234 bp (sample 25) and 234, 243 and 249bp (sample 26) has been shown on right side of the figure.

Fig 6

Genetic relationship of germplasm accessions as revealed by SSR markers in black pepper.

Dendrogram was constructed using SSR profiles for 30 black pepper (Piper nigrum) accessions. The pairwise Jaccard’s similarity coefficients was used for construction of phylogenetic tree.

Validation of SSR markers in germplasm accessions of black pepper (Piper nigrum).

Gel image of PCR amplification of SSR marker BPSSR27 on 30 germplasm accessions of P. nigrum as captured on QIAxcel ScreenGel software is shown on the left side. Numbers refer to accession numbers as mentioned in Table 1. The lane marked ‘M’ is DNA molecular weight standard 50-800bp v2.0 Qx DNA size marker. A representative electropherogram showing allele sizes of 234 bp (sample 25) and 234, 243 and 249bp (sample 26) has been shown on right side of the figure.

Genetic relationship of germplasm accessions as revealed by SSR markers in black pepper.

Dendrogram was constructed using SSR profiles for 30 black pepper (Piper nigrum) accessions. The pairwise Jaccard’s similarity coefficients was used for construction of phylogenetic tree. Further, cross species transferability of 50 SSR loci was checked in nine other Piper species namely, P. longum, P. arboreum, P. argyrophyllum, P. attenuatum, P. betel, P. chaba, P. hymenophyllum, P. trichostachyon and P. wallichi. One to three accessions from each Piper species were included in the study. The amplification profile of 18 black pepper accessions, representing nine Piper species and P. nigrum using two representative SSR primers have been shown in Fig 7A. Out of 50 SSRs screened, 19 primer pairs produced amplification in all nine other Piper species (Table 4). Total 31 primers showed amplification in at least seven Piper species. Among nine Piper species, highest rate of SSR transferability of P. nigrum was observed in P. trichostachyon (96%) followed by P. wallichi (82%); whereas least transferability was seen in P. arboreum (50%) (Fig 7B). Out of 50 SSRs tested for cross species amplification, 39 primers were polymorphic in nature with respect to the allele size amplified in P.nigrum.
Fig 7

Cross-species transferability of SSR from P. nigrum in other species of Piper.

A. Amplification profile of SSRs in different Piper species with primer BPSSR17 and BPSSR25. Name of the species have been mentioned in the top of the gel image. The numbers under the species name indicate different accessions from the species. M is the DNA molecular weight standard, 50bp ladder (MBI Fermentas). Primer names have been indicated at the bottom of each gel. B. Species wise transferability of SSRs from P. nigrum in nine different Piper species.

Table 4

Cross species amplification of 50 SSRs from P. nigrum in 9 other Piper species.

Numbers in the first row indicate species name and TCR number as given below. 1: P. nigrum (TCR419), 2: P. nigrum (TCR8), 3: P. longum (P25), 4: P. longum (TCR267), 5: P. arboreum (TCR267), 6: P. arboreum (P. arboreum), 7: P. argyrophyllum (TCR302), 8: P. argyrophyllum (TCR365), 9: P attenuatum (TCR171), 10: P betel (TCR166), 11: P betel (TCR357), 12: P betel (Lakshdweep), 13: P chaba (TCR149), 14: P. chaba (TCR265), 15: P. hymenophyllum (TCR345), 16: P. trichostachyon (TCR363), 17: P. trichostachyon (CR279), 18: P. wallichi (P. wallichi). Plus (+) and minus (-) sign indicate cross species transferability. Monomorhic/polymorphic indicate amplification of same/different allele as P. nigrum.

S. No.SSR marker123456789101112131415161718Nature
1BPSSR1++++----+++----+++Polymorphic
2BPSSR2++----------------Monomorphic
3BPSSR3++++++++++++++++++Polymorphic
4BPSSR4++++--++++++++++++Polymorphic
5BPSSR5++-------+++++-+++Polymorphic
6BPSSR6++----------+++++-Polymorphic
7BPSSR7++--++-----+---+++Polymorphic
8BPSSR9++++-----+++++-+++Polymorphic
9BPSSR10++++--++++++--++++Polymorphic
10BPSSR11++++++++++++++++++Polymorphic
11BPSSR12++++--+++---++++++Monomorphic
12BPSSR13++++--+++---+++++-Polymorphic
13BPSSR14++-------------+++Monomorphic
14BPSSR15++----++++++++-+++Polymorphic
15BPSSR16++--++++++++++++++Polymorphic
16BPSSR17++++--++++++++++++Polymorphic
17BPSSR18++----++------++++Polymorphic
18BPSSR19++----+++-+-++++++Polymorphic
19BPSSR20++++--++-++++++++-Polymorphic
20BPSSR21++++++++++++++++++Polymorphic
21BPSSR22++++++++++++++++++Polymorphic
22BPSSR23++++--------++-+++Polymorphic
23BPSSR24++++++++++++++++++Polymorphic
24BPSSR25++++++++++++++++++Polymorphic
25BPSSR26++----++------++++Polymorphic
26BPSSR27++++++++++++++++++Polymorphic
27BPSSR29++++++++++++++++++Polymorphic
28BPSSR30++++++++++++++++++Monomorphic
29BPSSR31++++-------------+Monomorphic
30BPSSR32++++++++++++++++++Polymorphic
31BPSSR33++++++++++++++++++Polymorphic
32BPSSR36++++++++++++++++++Polymorphic
33BPSSR37++++++++++++++++++Monomorphic
34BPSSR38++++++++++++++++++Polymorphic
35BPSSR40++--+++++++-+++++-Polymorphic
36BPSSR44++----++++---+++++Polymorphic
37BPSSR50++++++++++++++++++Polymorphic
38BPSSR55++++--+++-----+++-Polymorphic
39BPSSR57++++++++++++--++++Monomorphic
40BPSSR61++-------------++-Monomorphic
41BPSSR62++-------------++-Monomorphic
42BPSSR67++++++++++++++++++Polymorphic
43BPSSR71+++---++++++++++++Polymorphic
44BPSSR73++--++---------+++Polymorphic
45BPSSR75++++++++++++++++++Polymorphic
46BPSSR77++++++++++++++++++Monomorphic
47BPSSR78++++-----------++-Monomorphic
48BPSSR80++++--++++++++++++Polymorphic
49BPSSR83++++++++++++++++++Polymorphic
50BPSSR85++++++--++++++++++Polymorphic

Cross-species transferability of SSR from P. nigrum in other species of Piper.

A. Amplification profile of SSRs in different Piper species with primer BPSSR17 and BPSSR25. Name of the species have been mentioned in the top of the gel image. The numbers under the species name indicate different accessions from the species. M is the DNA molecular weight standard, 50bp ladder (MBI Fermentas). Primer names have been indicated at the bottom of each gel. B. Species wise transferability of SSRs from P. nigrum in nine different Piper species.

Cross species amplification of 50 SSRs from P. nigrum in 9 other Piper species.

Numbers in the first row indicate species name and TCR number as given below. 1: P. nigrum (TCR419), 2: P. nigrum (TCR8), 3: P. longum (P25), 4: P. longum (TCR267), 5: P. arboreum (TCR267), 6: P. arboreum (P. arboreum), 7: P. argyrophyllum (TCR302), 8: P. argyrophyllum (TCR365), 9: P attenuatum (TCR171), 10: P betel (TCR166), 11: P betel (TCR357), 12: P betel (Lakshdweep), 13: P chaba (TCR149), 14: P. chaba (TCR265), 15: P. hymenophyllum (TCR345), 16: P. trichostachyon (TCR363), 17: P. trichostachyon (CR279), 18: P. wallichi (P. wallichi). Plus (+) and minus (-) sign indicate cross species transferability. Monomorhic/polymorphic indicate amplification of same/different allele as P. nigrum.

Discussion

SSR markers have played pivotal role in genetic analysis, mapping, gene tagging and marker assisted breeding in several crop plants. Availability of SSRs in crop plants have in a way proved a ‘stepping stone’ for the rapid genetic dissection of complex traits including resistance to biotic and abiotic stress, identification of QTLs for several important traits, genetic enhancement and varietal development. In spite of immense economic importance, black pepper lacked abundance of SSRs in general and genic SSRs in particular. The present reports of genomic SSRs in black pepper would meet researchers/geneticist/plant breeders requirement and therefore is expected to pave way forward for downstream application in genetic dissection, diversity studies, QTL identification, marker assisted breeding etc. In recent past, SSRs have been reported in black pepper using transcriptome approach [23-24]. SSRs identified using transcriptome based approach gives information only about expressed region of the genome leaving large inter genic region unrepresented thus limiting pan genome applications. Such EST-SSRs although have been useful for genetic analysis in other plants species, however, were found to be relatively low polymorphic and concentrated in gene-rich regions of the genomes, which could limit their applications especially in the linkage maps construction [45-48]. On the other hand, the genomic SSRs are highly polymorphic and have pan genome distribution which facilitates the better map coverage [45, 48–49]. Owing to their polymorphic nature over genic SSRs, intergenic SSRs were also found to have greater application in DNA fingerprinting and varietal identification [50]. Among the different SSRs identified, frequency of the dinucleotide was highest in the P. nigrum genome. Predominance dinucleotide SSRs among the other SSRs was also observed in other plants such as Mung bean, Cranberry, Pigeonpea, black alder and Maqui [32, 51–53]. The next abundant SSR were with tri, tetra and hexa repeats and the least abundant SSRs were with penta nucleotide repeats. Frequency of identified SSR in the Black pepper genome is 158/MB (one SSR for every 6.3 kb region of DNA) is significantly high compared to other plants genomes such as of Gossypium species. In the assembled genome of G. hirsutum, G. arboreum, and G. raimondii frequency of SSR is reported as one every 24.3, 20.4 and 13.4 Kb, respectively [28]. Microsatellites are markers of choice for diversity analysis, mapping and other genetic studies because of their abundance, reproducibility and polymorphism. In black pepper, there are relatively less number of diversity studies reported using SSRs compared to other crop plants. In the present study, from the identified SSRs, 50 SSRs were used to study diversity in 30 germplasm accessions of black pepper, mostly from the Kerala state of India. The primers were validated in a set of 30 P. nigrum accessions. Total number of alleles detected at 50 loci was 215 with an average number of 4.3 alleles per locus. The dendrogram generated using SSR data grouped 30 landraces into four clusters. The clustering pattern does not unravel any relationship between genetic similarity and the place of origin/collection. Overall these markers detected high level of polymorphism and high diversity among accessions of P. nigrum studied. Cross transferability of these markers was checked across nine species and 39 out of 50 primers were polymorphic with respect to the allele size amplified in P. nigrum. In the recent past, few microsatellite markers have been developed and used for different studies in black pepper. Earlier nine microsatellite markers were developed and characterized from an enriched library of P. nigrum and tested for transferability in four distinct Piper species [22]. Out of nine SSRs, five produced amplification in all four species tested. In another study, the molecular characterization carried out using SSR markers could demarcate Indian and exotic Piper species [54]. Genetic diversity assessed using 13 EST SSR markers detected high genetic diversity among 148 black pepper germplasm [13]. These reports are in congruence with the present study in black pepper where a high genetic diversity is observed among the 30 landraces of black pepper at 50 identified SSR loci. The genomic microsatellite markers identified in black pepper in this study would form valuable and long awaited resources for researchers/plant breeders for its wide applications in diversity studies, linkage mapping, evolutionally biology, DNA fingerprinting, trait association study etc. in near future, paving the way for harnessing the potential of marker assisted breeding in black pepper genetic enhancement and improvement.

Conclusion

Non-availability of sufficient number of polymorphic SSRs in black pepper necessitated identification of new markers and their characterization. The recently sequenced genome of black pepper by our group was used for identification and validation of SSRs. Total 69,126 SSRs with frequency of 158 per MB were mined from the assembled draft genome, would fulfil the deficiency of genomic SSRs in black pepper. Validation of the identified SSRs on a set of 30 accessions of P. nigrum and their cross species transferability to nine species shows the potential application of the identified SSR markers not only in P. nigrum but also in other species of Piper where genomic resource is still scarce.

List and sequences of primers of black pepper SSR.

(XLSX) Click here for additional data file.
  39 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

2.  Preliminary study on inhibition of genotoxicity by piperine in mice.

Authors:  K Selvendiran; R Padmavathi; V Magesh; D Sakthisekaran
Journal:  Fitoterapia       Date:  2005-06       Impact factor: 2.882

Review 3.  The impact of next-generation sequencing technology on genetics.

Authors:  Elaine R Mardis
Journal:  Trends Genet       Date:  2008-02-11       Impact factor: 11.639

4.  Microsatellite based analysis of genetic diversity of popular black pepper genotypes in South India.

Authors:  Nisha Joy; V P Prasanth; E V Soniya
Journal:  Genetica       Date:  2011-08-28       Impact factor: 1.082

5.  Genetic diversity in the germplasm of black pepper determined by EST-SSR markers.

Authors:  B D Wu; R Fan; L S Hu; H S Wu; C Y Hao
Journal:  Genet Mol Res       Date:  2016-03-18

6.  Ribosomal DNA spacer-length polymorphisms in barley: mendelian inheritance, chromosomal location, and population dynamics.

Authors:  M A Saghai-Maroof; K M Soliman; R A Jorgensen; R W Allard
Journal:  Proc Natl Acad Sci U S A       Date:  1984-12       Impact factor: 11.205

7.  New cytotoxic cyclobutanoid amides, a new furanoid lignan and anti-platelet aggregation constituents from Piper arborescens.

Authors:  Ian-Lih Tsai; Fan-Pin Lee; Chin-Chung Wu; Chang-Yih Duh; Tsutomu Ishikawa; Jih-Jung Chen; Yu-Chang Chen; Hiroko Seki; Ih-Sheng Chen
Journal:  Planta Med       Date:  2005-06       Impact factor: 3.352

8.  Simple sequences are ubiquitous repetitive components of eukaryotic genomes.

Authors:  D Tautz; M Renz
Journal:  Nucleic Acids Res       Date:  1984-05-25       Impact factor: 16.971

9.  MISA-web: a web server for microsatellite prediction.

Authors:  Sebastian Beier; Thomas Thiel; Thomas Münch; Uwe Scholz; Martin Mascher
Journal:  Bioinformatics       Date:  2017-08-15       Impact factor: 6.937

10.  Identification and Characterization of Microsatellite Loci in Maqui (Aristotelia chilensis [Molina] Stunz) Using Next-Generation Sequencing (NGS).

Authors:  Adriana Bastías; Francisco Correa; Pamela Rojas; Rubén Almada; Carlos Muñoz; Boris Sagredo
Journal:  PLoS One       Date:  2016-07-26       Impact factor: 3.240

View more
  4 in total

1.  Genome-wide microsatellites in amaranth: development, characterization, and cross-species transferability.

Authors:  Kapil K Tiwari; Nevya J Thakkar; Darshan T Dharajiya; Hetal L Bhilocha; Parita P Barvaliya; Bhemji P Galvadiya; N N Prajapati; M P Patel; S D Solanki
Journal:  3 Biotech       Date:  2021-08-04       Impact factor: 2.893

2.  Rapid Genome-Wide Location-Specific Polymorphic SSR Marker Discovery in Black Pepper by GBS Approach.

Authors:  Ankita Negi; Kalpana Singh; Sarika Jaiswal; Johnson George Kokkat; Ulavappa B Angadi; Mir Asif Iquebal; P Umadevi; Anil Rai; Dinesh Kumar
Journal:  Front Plant Sci       Date:  2022-05-27       Impact factor: 6.627

3.  Genome-wide characterization of simple sequence repeats in Palmae genomes.

Authors:  Manee M Manee; Badr M Al-Shomrani; Mohamed B Al-Fageeh
Journal:  Genes Genomics       Date:  2020-04-03       Impact factor: 1.839

4.  Genome-Wide Analysis of Simple Sequence Repeats in Cabbage (Brassica oleracea L.).

Authors:  Yuanyuan Xu; Miaomiao Xing; Lixiao Song; Jiyong Yan; Wenjiang Lu; Aisong Zeng
Journal:  Front Plant Sci       Date:  2021-12-09       Impact factor: 5.753

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.