Literature DB >> 31832018

SWAP-70 promotes glioblastoma cellular migration and invasion by regulating the expression of CD44s.

Lin Shi1, Huize Liu1, Yifeng Wang1, Rutong Yu1,2, Xuejiao Liu1,2, Yulong Chong1,3, Jie Wang1, Guanzheng Liu1, Xu Zhang2, Xiangyu Chen1, Huan Li1, Mingshan Niu1,4, Jun Liang2.   

Abstract

BACKGROUND: Switch-associated protein 70 (SWAP-70) is a guanine nucleotide exchange factor that is involved in cytoskeletal rearrangement and regulation of migration and invasion of malignant tumors. However, the mechanism by which SWAP-70 regulates the migration and invasion of glioblastoma (GB) cells has not been fully elucidated.
METHODS: This study used an online database to analyze the relationship between SWAP-70 expression and prognosis in GB patients. The in vitro wound healing assay and transwell invasion assay were used to determine the role of SWAP-70 in GB cell migration and invasion as well as the underlying mechanism.
RESULTS: We found that patients with high SWAP-70 expression in the GB had a poor prognosis. Downregulation of SWAP-70 inhibited GB cell migration and invasion, whereas SWAP-70 overexpression had an opposite effect. Interestingly, SWAP-70 expression was positively correlated with the expression of the standard form of CD44 (CD44s) in GB tissues. Downregulation of SWAP-70 also reduced CD44s protein expression, whereas SWAP-70 overexpression enhanced CD44s protein expression. However, downregulation of SWAP-70 expression did not affect the mRNA expression of CD44s. Reversal experiments showed that overexpressing CD44s in cell lines with downregulated SWAP-70 partially abolished the inhibitory effects of downregulated SWAP-70 on GB cell migration and invasion.
CONCLUSIONS: These results suggest that SWAP-70 may promote GB cell migration and invasion by regulating the expression of CD44s. SWAP-70 may serve as a new biomarker and a potential therapeutic target for GB.
© The Author(s) 2019.

Entities:  

Keywords:  CD44s; Glioblastoma; Invasion; Migration; SWAP-70

Year:  2019        PMID: 31832018      PMCID: PMC6873484          DOI: 10.1186/s12935-019-1035-3

Source DB:  PubMed          Journal:  Cancer Cell Int        ISSN: 1475-2867            Impact factor:   5.722


Background

Glioblastoma (GB) is the most common and malignant type of brain tumor in adults. GB is a highly invasive tumor and its mortality is among the highest of all malignancies in humans [1, 2]. Although comprehensive therapeutic regimens, such as a combination of surgery with radiotherapy and chemotherapy, are used to treat GB in clinical practice, the prognosis of patients is still poor, with a median survival of only 12–15 months and a 5-year overall survival (OS) of less than 6% [3, 4]. The invasive growth of GB represents one of the key challenges for complete resection of such tumors. Hence, there is an urgent need to better understand the molecular mechanisms underlying GB cellular migration and invasion in order to identify potential targets for GB treatment. Cellular invasion is a complex cellular process that includes cell-to-cell and cell-to-extracellular matrix (ECM) interactions, as well as cellular migration and degradation of ECM enzymes [5-7]. The molecular mechanisms underlying the high migration and invasion of GB have not been fully elucidated. However, migration and invasion must involve a balance between the external environment and intracellular responses, the processes of which dynamically regulate actin filaments, microtubules, and intermediate filaments [8, 9]. Cellular movement is usually driven by the dynamic reorganization of the actin cytoskeleton, which projects to the anterior part of the cell and contracts in the posterior part of the cell [8]. Previous studies have shown that filaments that present inside pseudopods and membranous folds are associated with and are regulated by switch-associated protein 70 (SWAP-70) [10, 11]. SWAP-70 overexpression alters the actin arrangement and morphology of lamellipodia [12]. It has been shown that deletion of SWAP-70 in mouse embryonic fibroblasts results in impaired membrane wrinkles, suggesting that SWAP-70 plays a crucial role in the formation of the membranous cellular folds [13, 14]. SWAP-70 is a phosphatidylinositol triphosphate (PIP3)-binding protein, belonging to the family of guanine-nucleotide exchange factors (GEFs) [15]. SWAP-70 regulates cytoskeletal rearrangement through PIP3-mediated signaling and is expressed in a variety of tissues and cells [9, 16]. SWAP-70 also plays an important role in the oncogenesis of GB, prostate cancer, and other malignant tumors [17-19]. SWAP-70 expression in malignant tumors is higher than that in normal tissues, indicating that it may be closely related to oncogenesis in vivo. Although studies have reported that SWAP-70 regulates cellular movement and tumor-cell migration and invasion, the underlying mechanisms have not been extensively studied. It has only been reported that SWAP-70 is involved in phosphoinositide-3-kinase (PI3K) downstream signaling and activation of Rac, which subsequently regulates cytoskeletal changes that affect membranous cellular fold formation, thereby regulating tumor cell migration and invasion [16, 17]. SWAP-70 is a GEF that is involved in cytoskeletal rearrangement; however, it is unclear if SWAP-70 regulates GB cellular migration and invasion through other mechanisms. The present study investigated the roles and underlying mechanisms of SWAP-70 in GB cellular migration and invasion. We found that high SWAP-70 expression in high-grade glioma tissues was associated with a poor prognosis of glioma patients. We also found that SWAP-70 regulated the expression of the standard form of CD44 (CD44s) to promote GB cellular migration and invasion. Collectively, our findings provide an experimental basis for the applicability of SWAP-70 as a potential therapeutic target for GB.

Materials and methods

Patient tissue samples

A total of 62 patient tissue samples including 15 cases of non-tumorous brain tissues and 47 cases of gliomas tissues (Grade II: 15, Grade III: 18, Grade IV: 14) were used in this study. All the specimens were obtained from the Affiliated Hospital of Xuzhou Medical University (Xuzhou, China). Glioma patients were histologically diagnosed according to World Health Organization (WHO) criteria. None of the patients received any therapies before sample collection, such as radiation, immunotherapy or chemotherapy. Written informed consent was obtained from all of the patients, and this study was approved by the Research Ethics Committee of the Affiliated Hospital of Xuzhou Medical University. All the tissue samples were frozen in liquid nitrogen.

SWAP-70 expression and survival in patients with glioma

Total protein extracts from non-tumorous brain tissues and glioma tissues (WHO II-IV) were subjected to Western blot analysis as described previously [20]. The expression patterns of SWAP-70 and CD44s were detected using specific antibodies and β-actin was used as the loading control. Kaplan–Meier analysis was performed online with TCGA and GEO databases, and truncation values of the high expression group and the low expression group were determined by automatic scanning. The Kaplan scanner is used to determine the optimal cutoff for gene expression levels.

Cell lines and antibodies

Cell lines 293T, U251 and U87 were purchased from the Shanghai Cell Bank, Chinese Academy of Sciences for this study. These cell lines were cultured in DMEM supplemented with 10% FBS at 37 °C in a humidified incubator with 5% CO2. Antibodies against SWAP-70 (ab89532) and CD44s (ab51037) were obtained from Abcam. Antibodies specific for β-actin (A1978) and Flag (F7425) were purchased from Sigma.

Lentiviral vector construction

For SWAP-70 silencing, two short hairpin RNA (shRNA) duplexes were designed to target human SWAP-70 gene. The shRNA oligomers were annealed and then subcloned into the pLB plasmid by the HpaI and XhoI cloning site. For overexpression of SWAP-70, the cDNA encoding human SWAP-70 gene was inserted into the pWPXLd-puro lentiviral vector using BamHI and MluI sites. For silencing of CD44s, a pair of shRNA sequences were synthesized and incubated in annealing buffer. Annealed shRNA oligomers were inserted into pLVshRNA-EGFP plasmid digested with BamHI and EcoRI. The CD44s gene fragment was obtained by PCR amplification with the unique restriction sites EcoRI and NotI. After amplification, the PCR product was inserted into the lentiviral vector pLV-EGFP-N. The primers for CD44s overexpression contained a Flag tag. The primers used in this study were shown in Table 1.
Table 1

Primer sequences for amplification of SWAP-70 or CD44s using in this study

PrimerSequences (5′–3′)
sh-SWAP-70 #1 sense

TGCTGGAAGACATGTACCTATTCAAGAGATAGG

TACATGTCTTCCAGCTTTTTC

sh-SWAP-70 #1 antisense

TCGAGAAAAAAGCTGGAAGACATGTACCTATCT

CTTTGAATAGGTACAGTTCCAGCA

sh-SWAP-70 #2 sense

TGCCCATCATGAAGGATTAATTCAAGAGATTAA

TCCTTCATGATGGGTTTTTTC

sh-SWAP-70 #2 antisense

TCGAGAAAAAAGCCCATCATGAAGGATTAATCT

CTTGAATTAATCCTTCATGATGGGCA

sh-CD44s sense

ATCGTATGACACATATTGCTTCTTCAAGAGAGA

AGCAATATGTGTCATACTTTTTTG

sh-CD44s antisense

TTCAAAAAAGTATGACACATATTGCTTCTCTCTT

GAAGAAGCAATATGTGTGTCATAC

pWPXLd-SWAP-70 senseCGGGATCCATGGGGAGCTTGAAGGAGGA
pWPXLd-SWAP-70 antisenseCGACGCGTCCCTCCGTCCTCTTTTTCTCTTT
pLV-EGFP-CD44s senseCGGAATTCATGGACAAGTTTTGGTGGC
pLV-EGFP-CD44s antisense

TAAGAATGCGGCCGCGCTACTTGTCATCGTCAT

CCTTGTAGTCGATCACCCCAATCTTCATGTCCACs

Primer sequences for amplification of SWAP-70 or CD44s using in this study TGCTGGAAGACATGTACCTATTCAAGAGATAGG TACATGTCTTCCAGCTTTTTC TCGAGAAAAAAGCTGGAAGACATGTACCTATCT CTTTGAATAGGTACAGTTCCAGCA TGCCCATCATGAAGGATTAATTCAAGAGATTAA TCCTTCATGATGGGTTTTTTC TCGAGAAAAAAGCCCATCATGAAGGATTAATCT CTTGAATTAATCCTTCATGATGGGCA ATCGTATGACACATATTGCTTCTTCAAGAGAGA AGCAATATGTGTCATACTTTTTTG TTCAAAAAAGTATGACACATATTGCTTCTCTCTT GAAGAAGCAATATGTGTGTCATAC TAAGAATGCGGCCGCGCTACTTGTCATCGTCAT CCTTGTAGTCGATCACCCCAATCTTCATGTCCACs

Establishment of stable cell lines

A lentiviral packaging system was used in this study as previously described [2]. Briefly, lentiviruses were generated by co-transfecting lentiviral vector and two packaging vectors in a 3:2:1 ratio in 293T cells by use of PolyJet™ transfection reagent. Supernatants were collected 48 h after transfection, passed through a 0.45-μm filter membrane, and used directly to infect cells (U87 or U251 cells).

Cell migration assay

Cell migration was assessed by a scratch wound assay. Briefly, cells were seeded in 6-well plates and grown to confluency. A scratch wound was created using a plastic pipette tip, detached cells were washed away with PBS, and then the remaining cells were incubated in serum-free media. After 24 h and 48 h incubation, five random fields were photographed using an Olympus IX-71 inverted microscope. The number of migrating cells across the wound was counted on these images.

Cell invasion assay

Cell invasion assay was performed using a transwell system. Diluted Matrigel with cold distilled water was applied to 8 μm pore size polycarbonate membrane filters. Cells in serum-free medium were plated added to the upper chamber at a density of 10,000 cells/well. In the lower chamber, the DMEM media containing 10% FBS was added. Cells were incubated for 36 h and then the non-invading cells were removed with cotton swabs. Cells that invaded to the bottom of the membrane were fixed in 4% methanol for 20 min and stained with a 0.3% crystal violet solution for 30 min. The number of invading cells was analyzed by a microscope.

RNA extraction and real-time quantitative PCR

Total RNA was extracted from control and SWAP-70-downregulated cells using Trizol (Invitrogen) according to the manufacturer’s protocol. Reverse transcription was performed by Transcriptor First Strand cDNA Synthesis Kit (Roche). qPCR was performed as our previous study protocol [21]. The following gene-specific primers were used according to previous published study: SWAP-70: 5′-TCCACCATCCATCTGTTGAA-3′ (forward) and 5′-GCGTTTCTTTTCCTCGTCTG-3′ (reverse); CD44s: 5′-TCCAACACCTCCCAGTATGACA-3′ (forward) and 5′-GGCAGG TCTGTGACTGATGTACA-3′ (reverse); GAPDH: 5′-TCAGTGGTGGACCTGACCTG-3′ (forward) and 5′-TGCTGTAGCCAAATTCGT TG-3′ (reverse). GAPDH mRNA levels were used for normalization.

Statistical analysis

Each experiment was performed at least three times. Results are expressed as the mean ± SEM. The statistical analysis was performed by using GraphPad Prism 6.0 software. Differences between control and experimental groups were assessed by Student’s t-test or One-way ANOVA. P < 0.05 were considered to be statistically significant.

Results

High SWAP-70 expression in high-grade glioma tissues leads to poor prognoses in glioma patients

To study the role of SWAP-70 in the pathogenesis of glioma, Western blot analysis was used to measure the SWAP-70 protein expression in glioma tissues and non-tumor brain tissues. As shown in Fig. 1a, SWAP-70 was highly expressed in the high-grade glioma tissues compared to normal brain tissues. Further analysis of the relationship between SWAP-70 expression and the prognosis of glioma patients using online TCGA and GEO databases showed that patients with high SWAP-70 expression in glioma tissues had a poorer prognosis than those with low expression (Fig. 1b, c). High SWAP-70 expression in the high grade glioma tissues was associated with a poor prognosis in high-grade glioma patients, suggesting that high SWAP-70 expression is a poor prognostic marker in the high-grade glioma.
Fig. 1

High expression of SWAP-70 correlates with poor outcomes in glioblastoma patients. a SWAP-70 expression in non-tumor brain tissues and glioma tissues measured by Western blotting. b Kaplan–Meier survival analysis of glioma patients using the Gene Expression Omnibus dataset. Among the 273 glioma cases, 144 tissues had high SWAP-70 expression. c Overall survival analysis of glioblastoma patients using The Cancer Genome Atlas glioblastoma dataset

High expression of SWAP-70 correlates with poor outcomes in glioblastoma patients. a SWAP-70 expression in non-tumor brain tissues and glioma tissues measured by Western blotting. b Kaplan–Meier survival analysis of glioma patients using the Gene Expression Omnibus dataset. Among the 273 glioma cases, 144 tissues had high SWAP-70 expression. c Overall survival analysis of glioblastoma patients using The Cancer Genome Atlas glioblastoma dataset

Downregulation of SWAP-70 inhibits GB cellular migration and invasion

To investigate the role of SWAP-70 in GB cellular migration and invasion, SWAP-70 expression was downregulated in GB cells using SWAP-70 gene sequence-specific short hairpin RNA (shRNA). The effects of SWAP-70 downregulation on GB cellular migration and invasion were tested using an in vitro scratch assay and transwell invasion assay. First, GB U87 and U251 cell lines with stably downregulated SWAP-70 expression were constructed. Western blotting was used to detect the downregulating efficiency of SWAP-70. As shown in Fig. 2a, the silencing efficiency of shRNA sequence #2 was better than that of any of the other shRNAs, and SWAP-70 protein expression was downregulated by approximately 70–80%. Thus, the shRNA-SWAP-70 #2 cell line was used for the subsequent in vitro scratch and transwell invasion assays.
Fig. 2

Downregulation of SWAP-70 inhibits glioblastoma cellular migration and invasion. a Downregulation efficiency of SWAP-70 in U251 and U87 cells validated by Western blotting. b, c Migratory abilities of U251 and U87 cells after downregulating SWAP-70 expression detected with the in vitro scratch assay. The number of migrated cells was counted. d, e Invasive abilities of U251 and U87 cells after downregulating SWAP-70 expression assessed with the transwell invasion assay. The number of invading cells was counted. All data are expressed as the mean ± SEM (n = 3 per group; *P < 0.05)

Downregulation of SWAP-70 inhibits glioblastoma cellular migration and invasion. a Downregulation efficiency of SWAP-70 in U251 and U87 cells validated by Western blotting. b, c Migratory abilities of U251 and U87 cells after downregulating SWAP-70 expression detected with the in vitro scratch assay. The number of migrated cells was counted. d, e Invasive abilities of U251 and U87 cells after downregulating SWAP-70 expression assessed with the transwell invasion assay. The number of invading cells was counted. All data are expressed as the mean ± SEM (n = 3 per group; *P < 0.05) Results of the in vitro scratch assay showed that the wound healing rate of the control group was faster than that of the SWAP-70 downregulation group at 24 and 48 h after scratching. Statistical analysis showed that after SWAP-70 downregulation, the migration rates of U251 cells decreased by approximately 40% and 57% at 24 and 48 h, respectively, after cell scratching. The migratory rates of U87 cells decreased by approximately 35% and 52% at 24 and 48 h, respectively, after cell scratching (Fig. 2b, c). Similarly, results of the transwell invasion assay showed that after SWAP-70 downregulation, GB cellular invasion was significantly decreased compared to that of the control group. Additionally, compared with those of the control group, the numbers of U251 and U87 cells that penetrated the Matrigel upon SWAP-70 downregulation were reduced by 62% and 48%, respectively (Fig. 2d, e). These results indicated that SWAP-70 downregulation significantly reduced the migratory and invasive abilities of GB cells.

SWAP-70 overexpression promotes GB cellular migration and invasion

A gain-of-function approach was used in the following experiments to determine the effects of SWAP-70 overexpression on GB cellular migration and invasion. A lentiviral vector system was used to construct U251 and U87 cell lines that stably overexpressed SWAP-70. Western blotting was used to detect the overexpression efficiency of SWAP-70. As shown in Fig. 3a, the significant expression of exogenous SWAP-70 was detected in the SWAP-70 overexpression group compared with that of the control group, indicating successful construction of the U251 and U87 cell lines with SWAP-70 overexpression. The in vitro scratch assay showed that the number of SWAP-70-overexpressing U251 cells migrating to the scratch area was significantly higher than that of the control group, and the migration rates of U251 cells in this experimental group increased by approximately 3.3- and 6.2-fold at 24 h and 48 h, respectively (Fig. 3b, f). Similar results were found in U87 cells, indicating that SWAP-70 overexpression enhanced GB cellular migration (Fig. 3c, g). Similarly, in the transwell invasion assay, the numbers of SWAP-70-overexpressing U251 and U87 cells that penetrated the Matrigel of the transwell chamber increased by 2.1- and 2.3-fold, respectively, compared to those of the control group (Fig. 3d, e, h, i). The above-mentioned results suggest that SWAP-70 overexpression promoted GB cellular migration and invasion.
Fig. 3

SWAP-70 overexpression promotes glioblastoma cellular migration and invasion. a Overexpression efficiency of SWAP-70 in U251 and U87 cells verified by Western blotting. b, c Migratory abilities of U251 and U87 cells after overexpressing SWAP-70 determined with the in vitro scratch assay. d, e Invasive abilities of U251 and U87 cells after overexpression of SWAP-70 measured with the transwell invasion assay. f–i Quantitative analysis of the numbers of invading and migrating cells compared with those of the control group. All data are presented as the mean ± SEM (n = 3 per group; *P < 0.05)

SWAP-70 overexpression promotes glioblastoma cellular migration and invasion. a Overexpression efficiency of SWAP-70 in U251 and U87 cells verified by Western blotting. b, c Migratory abilities of U251 and U87 cells after overexpressing SWAP-70 determined with the in vitro scratch assay. d, e Invasive abilities of U251 and U87 cells after overexpression of SWAP-70 measured with the transwell invasion assay. f–i Quantitative analysis of the numbers of invading and migrating cells compared with those of the control group. All data are presented as the mean ± SEM (n = 3 per group; *P < 0.05)

SWAP-70 regulates protein expression of CD44s in GB

Research has shown that binding between CD44s and hyaluronic acid, as well as other adhesion receptors, is a key step in the formation of intracranial inflammatory lesions, in which lymphocytes adhere to the ECM of the brain, penetrate the white matter, and continue to spread [22, 23]. CD44s are key regulators of GB invasive growth and are involved in GB cellular migration and invasion [24-26]. In the present study, SWAP-70 and CD44s were highly expressed in GB tissues. Interestingly, statistical analysis of SWAP-70 and CD44s protein levels showed that SWAP-70 protein expression in GB tissues was significantly and positively correlated with CD44s protein expression in GB tissues with a correlation coefficient of r = 0.683, suggesting that SWAP-70 and CD44s may have a regulatory relationship in the development and progression of GBs (Fig. 4a, b).
Fig. 4

SWAP-70 regulates the expression of CD44s in glioblastoma cells. a Correlation analysis of SWAP-70 and CD44s expression in glioblastoma tissues. b, c Effects of downregulated or overexpressed SWAP-70 on CD44s protein expression analyzed by Western blotting. d, e Effects of downregulated or overexpressing CD44s on SWAP-70 protein expression assessed by Western blotting. f Effects of downregulated SWAP-70 on CD44s mRNA expression determined by semi-quantitative PCR. g Relative mRNA expression of CD44s in cells with stable SWAP-70 downregulation measured by quantitative PCR

SWAP-70 regulates the expression of CD44s in glioblastoma cells. a Correlation analysis of SWAP-70 and CD44s expression in glioblastoma tissues. b, c Effects of downregulated or overexpressed SWAP-70 on CD44s protein expression analyzed by Western blotting. d, e Effects of downregulated or overexpressing CD44s on SWAP-70 protein expression assessed by Western blotting. f Effects of downregulated SWAP-70 on CD44s mRNA expression determined by semi-quantitative PCR. g Relative mRNA expression of CD44s in cells with stable SWAP-70 downregulation measured by quantitative PCR Furthermore, cells with downregulated SWAP-70 also had reduced CD44s protein expression, whereas cells overexpressing SWAP-70 demonstrated increased CD44s protein expression (Fig. 4c, d). To determine the upstream and downstream regulation relationship of SWAP-70 and CD44s, we established GB cell lines with downregulated and overexpressing CD44s. Western blotting was used to determine the downregulating and overexpressing efficiencies of CD44s. The changes in CD44s protein expression did not affect SWAP-70 protein expression, suggesting that SWAP-70 is upstream of CD44s and regulates its protein expression (Fig. 4e, f). To clarify whether SWAP-70 regulates the expression of CD44s at the protein or nucleic acid level, we conducted semi-quantitative PCR and quantitative PCR experiments to determine whether the expression of CD44s is regulated by SWAP-70 at the mRNA level. As shown in Fig. 4g, h, SWAP-70 mRNA expression was significantly reduced after downregulation of SWAP-70; however, downregulation did not affect the mRNA expression of CD44s, suggesting that SWAP-70 regulates CD44s protein expression but does not affect its mRNA expression.

CD44s overexpression reverses the inhibitory effects of downregulated SWAP-70 on GB cellular migration and invasion

To determine if SWAP-70 promoted GB cellular migration and invasion by regulating CD44s, we overexpressed CD44s in U251 cells with stable downregulation of SWAP-70 to test whether the overexpression of CD44s reversed the inhibitory effects of downregulated SWAP-70 on GB cellular migration and invasion. First, Western blotting was used to identify the efficiency of transient transfection of the CD44s overexpression vector. As shown in Fig. 5a, compared with that of the control group, the sh-control cells transfected with CD44s-overexpression plasmids had significantly higher CD44s protein expression. In contrast, cells with downregulated SWAP-70 that were transfected with the CD44s-overexpression plasmid demonstrated less CD44s overexpression, which was a consequence of SWAP-70-mediated downregulation. These results further confirmed that SWAP-70 regulates the protein expression of CD44s (Fig. 5a, b). Subsequently, we performed an in vitro scratch assay and transwell invasion assay (reversal test), and results showed that CD44s overexpression in the cells with downregulated SWAP-70 partially reversed the inhibitory effects of downregulated SWAP-70 on GB cellular migration and invasion (Fig. 5c–e). In summary, our results suggested that SWAP-70 may promote GB cellular migration and invasion by regulating CD44s expression.
Fig. 5

CD44s overexpression partially reverses the inhibitory effect of downregulated SWAP-70 on glioblastoma cellular migration and invasion. a Transient transfection of the CD44s-overexpression plasmid in U251 cells with stable SWAP-70 downregulation. Transfection efficiency and protein expression of SWAP-70 and CD44s were assessed by Western blotting. b Statistical analysis of SWAP-70 and CD44s protein levels. c Effect of CD44s overexpression on the migratory ability of glioblastoma cells after downregulating SWAP-70 determined with the in vitro scratch assay. d Effect of CD44s overexpression on the invasive ability of glioblastoma cells after downregulating SWAP-70 analyzed with the transwell invasion assay. e Statistical analysis of the numbers of migrating and invading cells. All data are presented as the mean ± SEM (n = 3 per group; *P < 0.05)

CD44s overexpression partially reverses the inhibitory effect of downregulated SWAP-70 on glioblastoma cellular migration and invasion. a Transient transfection of the CD44s-overexpression plasmid in U251 cells with stable SWAP-70 downregulation. Transfection efficiency and protein expression of SWAP-70 and CD44s were assessed by Western blotting. b Statistical analysis of SWAP-70 and CD44s protein levels. c Effect of CD44s overexpression on the migratory ability of glioblastoma cells after downregulating SWAP-70 determined with the in vitro scratch assay. d Effect of CD44s overexpression on the invasive ability of glioblastoma cells after downregulating SWAP-70 analyzed with the transwell invasion assay. e Statistical analysis of the numbers of migrating and invading cells. All data are presented as the mean ± SEM (n = 3 per group; *P < 0.05)

Discussion

The invasive growth of GB makes complete tumor resection challenging and induces the tumor to be prone to recurrence [27, 28]. Elucidating the molecular mechanisms underlying GB cellular migration and invasion, as well as screening for potential therapeutic targets, have received significant attention in the GB research community. The present study showed that SWAP-70 was highly expressed in human high-grade glioma tissues, and high-grade glioma patients with high expression of SWAP-70 in tumor tissues had a poorer prognosis and shorter median survival time compared to those with low SWAP-70 expression, suggesting that SWAP-70 plays an important role in the degree of malignancy of GBs. To verify these findings, we clarified that SWAP-70 downregulation inhibited GB cellular migration and invasion. In contrast, SWAP-70 overexpression promoted GB cellular migration and invasion. Importantly, our results suggest that SWAP-70 in GB may regulate CD44s protein expression to affect GB cellular migration and invasion. As SWAP-70 is a GEF, it participates in cytoskeletal rearrangement through guanosine triphosphate-guanosine diphosphate conversion and promotes the formation of membrane folds and pseudopods, thereby regulating cellular movement [29, 30]. Recently, many studies have shown that SWAP-70 is involved in the activation of B-cell signaling and may have potential carcinogenic functions in tumorigenesis [18, 19, 31]. Heerema et al. conducted immunohistochemistry on 86 cases of human B-cell neoplasms, and all six cases of nodular lymphocyte-predominant Hodgkin lymphoma had positive SWAP-70 staining [32]. Fukui et al. studied mouse embryo fibroblasts (MEFs) and showed that cells lacking SWAP-70 expression failed to grow on soft agarose, whereas cells overexpressing SWAP-70 were susceptible to cloning. Inoculation of MEFs into nude mice showed that tumor volumes from MEFs lacking SWAP-70 were significantly smaller than those from MEFs expressing exogenous SWAP-70 [33]. These results indicate that the carcinogenesis of MEFs requires the involvement of SWAP-70, suggesting that SWAP-70 may be an oncogene. SWAP-70 is involved in tumor cell migration and invasion in GB [17]; however, the underlying mechanism has not been fully clarified. In the present study, we established GB cell lines with stable SWAP-70 downregulation and SWAP-70 overexpression and used in vitro scratch assays and transwell invasion assays to show that SWAP-70 promoted GB cellular migration and invasion. Interestingly, SWAP-70 expression was positively correlated with the expression of CD44s in GB tissues. Downregulation of SWAP-70 also reduced CD44s protein expression. In contrast, SWAP-70 overexpression enhanced CD44s protein expression. We suspect that there may be a regulatory relationship between the two proteins in GB invasion and metastasis, and that both SWAP-70 and CD44s may be synergistically involved in GB cellular migration and invasion. CD44 is a transmembrane glycoprotein that is expressed in the plasma membrane. The human CD44 gene is located on the short arm of chromosome 11 and has 20 highly conserved exons [34]. CD44 molecules are classified into the following two categories based on the types of exons contained in the CD44 gene: CD44s and the variant isoform of CD44 (CD44v) [35]. The structural difference between CD44s and CD44v is mainly in terms of the extracellular segment. Alternative splicing during transcription of the structural variation region in the extracellular segment results in different protein expression levels [35]. CD44 is involved in intercellular adhesion. CD44 binds to cytoskeletal proteins and participates in cellular movement, as well as intracellular and extracellular signal transduction [36, 37]. Abnormal expression of CD44 significantly enhances tumor cell migration, which is closely related to tumor metastasis [35, 38, 39]. Research has shown that CD44s is the predominant form in human GB, accounting for approximately 83.3% of CD44 types [40]. CD44s plays an important role in GB cellular migration and invasion and is involved in a variety of signaling pathways to promote GB cellular migration and invasion [24, 26]. In addition, the binding of the GEF T-cell lymphoma invasion and metastasis 1 (Tiam 1) to the intracellular domain of CD44v3 promotes breast cancer cellular invasion and migration [41]. The intracellular domain of CD44 is conserved between CD44s and CD44v. SWAP-70, another GEF, may also have a similar mechanism to regulate GB invasion and metastasis. In the present study, our results showed that changes in SWAP-70 expression affected CD44s expression, while CD44s did not affect SWAP-70 expression, suggesting that SWAP-70 may be upstream of CD44s and therefore regulate CD44s protein expression. Further experiments showed that SWAP-70 did not affect the mRNA expression of CD44s but regulated the expression of CD44s protein. The dissociation of CD44 is regulated by protein kinase C, calcium ion flux, and small G-proteins of the Ras homologous (Rho) family. The Rho family molecules recruit metalloproteinases to surround CD44, promote CD44 dissociation, and alter the CD44 distribution on the plasma membrane [42]. SWAP-70 regulates cytoskeletal changes through Rac activation. Further studies will be necessary to determine if SWAP-70 affects CD44s expression through Rho family molecules. In addition, we overexpressed CD44s in GB cell lines with downregulated SWAP-70 and showed that CD44s overexpression partially reversed the inhibitory effect of the downregulated SWAP-70 on GB cellular migration and invasion. The above-mentioned results suggest that SWAP-70 is involved in GB cellular migration and invasion via regulation of CD44s expression.

Conclusion

Taken together, the results of this study demonstrate that high SWAP-70 expression is a biomarker for poor prognosis of GB. SWAP-70 plays an important role in GB cellular migration and invasion. Importantly, SWAP-70 promotes GB cellular migration and invasion by regulating CD44s expression. Thus, SWAP-70 may serve as a novel biomarker and potential target for the treatment of human GB.
  37 in total

Review 1.  The CD44-HA axis and inflammation in atherosclerosis: A temporal perspective.

Authors:  Mia Krolikoski; James Monslow; Ellen Puré
Journal:  Matrix Biol       Date:  2018-05-21       Impact factor: 11.583

2.  CD44 targeted delivery of siRNA by using HA-decorated nanotechnologies for KRAS silencing in cancer treatment.

Authors:  A Tirella; K Kloc-Muniak; L Good; J Ridden; M Ashford; S Puri; N Tirelli
Journal:  Int J Pharm       Date:  2019-02-26       Impact factor: 5.875

3.  Regulated CD44 cleavage under the control of protein kinase C, calcium influx, and the Rho family of small G proteins.

Authors:  I Okamoto; Y Kawano; M Matsumoto; M Suga; K Kaibuchi; M Ando; H Saya
Journal:  J Biol Chem       Date:  1999-09-03       Impact factor: 5.157

4.  Signaling protein SWAP-70 is required for efficient B cell homing to lymphoid organs.

Authors:  Glen Pearce; Veronique Angeli; Gwendalyn J Randolph; Tobias Junt; Ulrich von Andrian; Hans-Joachim Schnittler; Rolf Jessberger
Journal:  Nat Immunol       Date:  2006-07-16       Impact factor: 25.606

Review 5.  Comparison of glioblastoma (GBM) molecular classification methods.

Authors:  Eunjee Lee; Raymund L Yong; Patrick Paddison; Jun Zhu
Journal:  Semin Cancer Biol       Date:  2018-07-19       Impact factor: 15.707

6.  SWAP-70 is required for oncogenic transformation by v-Src in mouse embryo fibroblasts.

Authors:  Yasuhisa Fukui; Takayuki Tanaka; Hiroyuki Tachikawa; Sayoko Ihara
Journal:  Biochem Biophys Res Commun       Date:  2007-03-08       Impact factor: 3.575

Review 7.  The role of CD44 in epithelial-mesenchymal transition and cancer development.

Authors:  Hanxiao Xu; Yijun Tian; Xun Yuan; Hua Wu; Qian Liu; Richard G Pestell; Kongming Wu
Journal:  Onco Targets Ther       Date:  2015-12-16       Impact factor: 4.147

8.  Regulation of CD44 expression and focal adhesion by Golgi phosphatidylinositol 4-phosphate in breast cancer.

Authors:  Takeshi Ijuin; Yukiko Takeuchi; Yohei Shimono; Miki Fukumoto; Emi Tokuda; Tadaomi Takenawa
Journal:  Cancer Sci       Date:  2016-06-24       Impact factor: 6.716

Review 9.  Treatment of Glioblastoma (GBM) with the Addition of Tumor-Treating Fields (TTF): A Review.

Authors:  Denise Fabian; Maria Del Pilar Guillermo Prieto Eibl; Iyad Alnahhas; Nikhil Sebastian; Pierre Giglio; Vinay Puduvalli; Javier Gonzalez; Joshua D Palmer
Journal:  Cancers (Basel)       Date:  2019-02-02       Impact factor: 6.639

10.  SWAP-70: a new type of oncogene.

Authors:  Chung-Li Shu; Liang-Cheng Su; Chih-Pin Chuu; Yasuhisa Fukui
Journal:  PLoS One       Date:  2013-03-12       Impact factor: 3.240

View more
  2 in total

1.  Switch-associated protein 70 protects against nonalcoholic fatty liver disease through suppression of TAK1.

Authors:  Qiaofeng Qian; Yang Li; Jiajun Fu; Dewen Leng; Zhe Dong; Jiajun Shi; Hongjie Shi; Dengwei Cao; Xu Cheng; Yufeng Hu; Qiujie Luo; Manli Hu; Yong Ran; Hao Tang; Hui Liu; Jinping Liu
Journal:  Hepatology       Date:  2022-04-25       Impact factor: 17.298

Review 2.  The Role of Rho GTPases in Motility and Invasion of Glioblastoma Cells.

Authors:  Houssam Al-Koussa; Oula El Atat; Leila Jaafar; Hagop Tashjian; Mirvat El-Sibai
Journal:  Anal Cell Pathol (Amst)       Date:  2020-01-31       Impact factor: 2.916

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.