This paper aims to investigate the function of structural maintenance of chromosome 4 (SMC4) in the progression of hepatocellular carcinoma (HCC) under hypoxic condition. In this study, we found that suppression of SMC4 could inhibit proliferation and migration of HCC cells through inducing G1 phase arrest and affecting process of epithelial-mesenchymal transition (EMT) under hypoxic condition. Moreover, we demonstrated that SMC4 was transcriptionally regulated by hypoxia-inducible factor-1 (HIF-1) under hypoxic condition. As SMC has been shown to be a target gene of miR-219, we observed that miR-219 was downregulated under hypoxic condition and suppression of HIF-1a could lead to the upregulation of miR-219. We also proved that miR-219 could affect the proliferation and migration of HCC cells under hypoxic condition. In conclusion, our study demonstrated a novel HIF-1-miR-219-SMC4 regulatory pathway under hypoxic condition in HCC cells.
This paper aims to investigate the function of structural maintenance of chromosome 4 (SMC4) in the progression of hepatocellular carcinoma (HCC) under hypoxic condition. In this study, we found that suppression of SMC4 could inhibit proliferation and migration of HCC cells through inducing G1 phase arrest and affecting process of epithelial-mesenchymal transition (EMT) under hypoxic condition. Moreover, we demonstrated that SMC4 was transcriptionally regulated by hypoxia-inducible factor-1 (HIF-1) under hypoxic condition. As SMC has been shown to be a target gene of miR-219, we observed that miR-219 was downregulated under hypoxic condition and suppression of HIF-1a could lead to the upregulation of miR-219. We also proved that miR-219 could affect the proliferation and migration of HCC cells under hypoxic condition. In conclusion, our study demonstrated a novel HIF-1-miR-219-SMC4 regulatory pathway under hypoxic condition in HCC cells.
Hepatocellular carcinoma (HCC) is the most common digestive system tumor, which is highly prevalent in the world and is particularly prominent in China [1]. Because HCC has the characteristics of insidious onset, rapid development, easy recurrence, and metastasis, the overall treatment effect is still unsatisfactory [2]. Therefore, exploring the underlying mechanisms of invasion, metastasis, and recurrence has become the focus of oncology research. Hypoxia is one of the basic features of malignant solid tumors, which generates a variety of biological effects by stabilizing hypoxia-inducible factors (HIFs), avoiding their degradation and activating transcriptional programs of a series of genes. Tumor tissue hypoxia has been proved to be an important factor in promoting malignant progression of tumors, resistance to chemotherapy and radiotherapy, recurrence, and even metastasis. Therefore, the study of tumor hypoxia is of great significance in tumor therapy.Structural maintenance of chromosome 4 (SMC4), a core subunit of condensins I and II, large protein complexes, is highly conserved from bacteria to human beings and acts as a vital role in regulating chromosome organization and dynamics [3]. Recent studies demonstrated that SMC4 was associated with tumor dedifferentiation, advanced stage, and vascular invasion of primary liver cancer, and further study proved that SMC4 was a target gene regulated by miR-219 and affected the progression of HCC through activating JAK2/Stat3 pathway [4, 5]. Thus, SMC4 acted as a vital role in progression of HCC.Recent studies have demonstrated that hypoxia is a common phenomenon in HCC, which could change gene transcription through stabilizing hypoxia-inducible factor (HIF) [6]. HIF-1 is a key transcription factor involved in the hypoxic response of cancer cells, which activates transcription of genes responsible for angiogenesis, glucose metabolism, proliferation, invasion, and metastasis in HCC [7]. However, the function of SMC4 under hypoxic condition and the relationship between HIF-1 and SMC4 is unclear.In this study, we observed that suppression of SMC4 could inhibit proliferation and migration of HCC cells under hypoxic condition. Then we demonstrated that SMC4 was transcriptionally regulated by HIF-1. Further study showed that hypoxia could regulate the expression of SMC4 through inhibiting the expression of miR-219. In conclusion, our study found a novel HIF-1-miR-219-SMC4 regulatory pathway under hypoxic condition in HCC cells.
2. Materials and Methods
2.1. Cell Lines and Cell Culture
HCC cell line Huh7 and HCC-LM3 were obtained from the Chinese Academy of Science Cell Bank (Shanghai, China). These cells were maintained in MEM medium, supplemented with 10% FBS at 37°C in a humidified atmosphere of 5% CO2. To make hypoxic condition, cells were cultured in the atmosphere of 1% O2, 5% CO2, and 94% N2.
2.2. Transfection of Interference RNA
Interference RNA (siRNA) of SMC4 and that of HIF-1a were purchased from Jima Biotech Co (Shanghai, China). SMC4: 5′-AGUAUUAUCUCUGCAGGCCTT-3′. HIF-1-a: 5-GGAAATGAGAGAAATGCTTAC-3. miR-219 inhibitor 5′-AGAAUUGCGUUUGGACAAUCA-3′; miR-219 mimics 5′- UGAUUGUCCAAACGCAAUUCU AAUUGCGUUUGGACAAUCAUU-3′ Lipofectamine 2000 (Invitrogen) was used to perform transfection.
2.3. Total RNA Extraction and RT-PCR
Total RNA was extracted by Trizol reagent and reverse transcription through Superscript III RT (Invitrogen). Real-time PCR was performed with SYBR Green PCR Master Mix (Applied TaKaRa, Otsu, Shiga, Japan). The nucleotide sequences of the primers were as follows: GAPDH, forward 5′-ATGGGGAAGGTGAAGGTCG-3′ and reverse 5′-GGGGTCATTGATGGCAACAATA-3; SMC4, forward 5′-GAGAAAATTCTGGGACCTTT-3′ and reverse 5′-TCTGAATGTCCTTGTGTTCA-3′; mir-219 forward 5′-TGATTGTCCAAACGCA-3′ Reverse 5′-TTTGGCACTAGCACATT-3′. The results were analyzed by 2−ΔΔCT method and the GAPDH was as the internal control for SMC4. The primer of U6 was bought from Qiagen and as the internal control for SMC4. Each sample was taken in triplicate.
2.4. Western Blot Analysis
Total proteins in HCC cells were extracted by lysis buffer and the protein concentration was measured by Bicinchoninic acid (BCA) assay. The SDS-PAGE was conducted according to the protocol. After transfering to a PVDF membrane, membranes were incubated with primary antibodies at 4°C overnight in a buffer containing 5% skim milk. The primary antibodies were as follows: HIF-1a (1 : 1,000 dilution, Abcam); SMC4 (1 : 1,000 dilution, Abcam); β-actin (1 : 3000 dilution, Abcam); CDK2, CDK4, and CyclinB1 (1 : 1000 dilution, Proteintech, USA); and E-cadherin and Vimentin (1 : 1000 dilution, CST).
2.5. Immunofluorescence
Immunofluorescence was used to observe E-cadherin and Vimentin expression. HCC cells were seeded into confocal dishes containing a sterile coverslip on the bottom. After transfected with SMC4 siRNA or NC for 48 h under hypoxic condition, cells were washed with PBS, fixed using 2% paraformaldehyde for 5 min, permeabilised using Triton X-100 0.1% for 10 min, and blocked using 10% FBS for 1 h at room temperature. Next, the cells were incubated with a 1 : 200 dilution of anti-E-cadherin monoclonal antibody or anti-Vimentin monoclonal antibody overnight at 4°C. All samples were washed twice in PBS and incubated with goat-anti-rabbit CY3 at 1 : 200 dilution as the secondary antibody. Finally, the samples were incubated with DAPI for 5 min, then washed twice in PBS, and examined by confocal microscopy (Olympus, Tokyo, Japan) to produce a merged image [8].
2.6. Cell Viability Assay
To detect the relative cell viability, HCC cells treated with SMC4 siRNA or NC or miR-219 mimics or miR-219 inhibitor were seeded into 96-well microplates with 5 ∗ 103/well under hypoxic condition. Then cell viability was detected in 24 h, 48 h, and 72 h by cell counting kit-8 (CCK-8) assay according to the manufacturer's instructions.
2.7. Cell Migration Assay
Basement membrane migration assays were conducted by using the transwell plates (Corning, NY). Huh7 and HCC-LM3 cells transfected with “SMC4 siRNA or control vectors” or “miR-219 mimics, miR-219 inhibitor, and negative control” were trypsinized and collected. Cells were cultured without matrigel for 48 h under hypoxic condition. In the lower compartment, medium was changed with MEM complete medium. After fixation and staining, cells on the bottom surface that invaded across the membranes were counted and photographed. All experiments were performed in triplicate.
2.8. Luciferase Reporter Assay
HRE sequence (5′-GCGGCACGT-3′) of SMC4 promoter was predicted by ALGGEN-PROMO, and then the mutant type and wild type of HRE sequence were constructed with luciferase reporter system. The Huh7 cells were transfected with pGL4.10-SMC4-Promotor (wt), pGL4.10-Promotor (mut), pGL4.10-SMC4-Promotor (wt)-vector, or pGL4.10-Promotor (mut)-vector. After 24 hours, these cells were seeded in 24-well plates under hypoxic condition. After incubation for 48 h, dual-luciferase reporter assay (promega, E2920) was used to detect luciferase activities.
2.9. Statistical Analysis
Data are presented as means ± standard deviation (SD). For comparisons, Student's t-test, paired-samples t-test, and ANOVA analysis were performed as appropriate. All analyses were performed with SPSS 18.0 software (SPSS Inc., Chicago, IL). Differences were considered significant at P < 0.05.
3. Result
3.1. Suppression of SMC4 Inhibits Proliferation and Migration of HCC Cells under Hypoxia
SMC4 has been proved to be overexpressed in HCC tissues and associated with prognosis of HCCpatients [9, 10], and our study also verified it via analyzing oncomine and TCGA database (Supplement Figures –). Though the function of SMC4 was proved under normoxia in HCC cells [5], hypoxia was an important tumor microenvironment for HCC, and the function of SMC4 under hypoxia was unclear. Our study found that the expression of SMC4 was higher under hypoxia than normoxia (Supplement Figures –). Thus, we imaged that SMC4 was acted as an important role under hypoxia in HCC cells. To investigate the function of SMC4 in HCC cells under hypoxic condition, SMC4 was suppressed by siRNA and the transfect efficiency was verified by western blot and RT-PCR (Figures 1(a) and 1(b)). Then loss of function experiment was conducted under hypoxic condition, and we observed that suppression of SMC4 could significantly inhibit the proliferation and migration ability of HCC cells (Figures 1(c)–1(d)). Thus, we proved that SMC4 could act an important role in progression of HCC under hypoxic condition.
Figure 1
SMC4 could regulate proliferation and migration of HCC cells under hypoxia. (a-b) Efficiency of SMC4 siRNA was verified on both protein and mRNA levels in HCC cells. n = 3, p < 0.0005. (c) CCK-8 was used to detect cell viability of HCC cells with SMC4 siRNA and negative control under hypoxic condition. The value of 72 h was statistically analyzed. n = 7, p < 0.0005. (d) Transwell assay was used to detect cell migration ability of HCC cells with SMC4 siRNA and negative control under hypoxic condition., n = 3, p < 0.005.
3.2. Suppression of SMC4 Induces G1 Phase Arrest and Inhibits Process of EMT under Hypoxia
As the process of cell cycle was important for the proliferation of HCC cells, flow cytometry was used to analyze the cell number percentage of different cell cycle phases under hypoxic condition. We observed that the cell number percentage of G1 phase in SMC4 siRNA group was higher than that in the NC group, and the G1 phase associated proteins (CDK2, CDK4, and CyclinB1) were downregulated in HCC cells with SMC4 suppression (Figure 2(a)). Since EMT was essential for driving plasticity during the migration of tumor cells, then we detected the expression change of E-cadherin and Vimentin through IF and western blot in HCC cells under hypoxic condition and found that suppression of SMC4 could upregulate the expression of E-cadherin but downregulate the expression of Vimentin (Figure 2(b)). Such results showed that the suppression of SMC4 could inhibit the proliferation and migration of HCC cells under hypoxic condition through inducing G1 phase arrest and suppressing process of EMT.
Figure 2
Suppression of SMC4 induces G1 phase arrest and inhibits process of EMT. (a) Flow cytometry was used to analyze the percentage of different cell cycle phases in HCC cells with SMC4 siRNA and negative control under hypoxic condition. The result of statistical analysis was shown by Histogram. And the expression changes of CDK2, CDK4, and CyclinB1 were detected by western blot, and β-actin was used for internal control. n = 3, p < 0.05. (b) IF and western blot were used to detect expression changes of E-cadherin and Vimentin under hypoxia in HCC cells with SMC4 siRNA and negative control, and β-actin was used for internal control.
3.3. SMC4 Was Transcriptionally Regulated by HIF-1 under Hypoxic Condition
To investigate the relationship between SMC4 and HIF-1, firstly, we analyzed the expression relationship between SMC4 and HIF-1a through TCGA database. The result of the coexpression analysis showed that the mRNA level of SMC4 was positive correlated with HIF-1a, which was demonstrated by regulating hypoxia and affecting the activity of HIF-1 (p < 0.05, r = 0.4201) (Figure 3(a)). To prove that SMC4 was transcriptionally regulated by HIF-1 under hypoxic condition, we used ALGGEN-PROMO to predict the candidate HRE element in the promoter of SMC4. Then we found that the base sequence in the position of 1953–1961 (5′-GCGGCACGT-3′) was the most likely HRE. Based on this, we designed the luciferase reporter system and the result showed that HIF-1 could combine to this specific sequence under hypoxic condition (Figure 3(b)). To verify that SMC4 was transcriptionally regulated by HIF-1, we compared the expression of SMC4 and HIF-1a under the condition of hypoxia, normoxia, and hypoxia + HIF-1a siRNA. The results showed that the expression of SMC4 was positive correlated with the expression of HIF-1a among these three conditions. Besides, the expressions of CDK2, CDK4, and Vimentin were decreased under the condition of hypoxia + HIF-1a siRNA, while the expression of E-cadherin was increased (Figure 3(c)). Taken together, we found that SMC4 was transcriptionally regulated by HIF-1 under hypoxic condition.
Figure 3
SMC4 was transcriptionally regulated by HIF-1 under hypoxic condition. (a) The result of coexpression analysis between SMC4 and HIF-1a was shown. r = 0.4201, p value = 2.691e − 17. (b) Huh7 cells were cotransfected with HRE-wild-vector or HRE-wild and HRE-mutant-vector or HRE-mutant, and the luciferase activities were examined. The firefly luciferase activity of each sample was normalized to the Renilla luciferase activity. n = 3, p < 0.0005. (c) Expressions of HIF-1a, SMC4, CDK2, CDK4, E-cadherin, and Vimentin were detected by western blot under hypoxia or normoxia or hypoxia + HIF-1a siRNA.
3.4. Hypoxia Increases the Expression of SMC4 through Inhibiting the Expression of miR-219
It has been reported that SMC4 was a target gene regulated by miR-219; however, the relationship between miR-219 and hypoxia was not clear. Firstly, we compared the expression of miR-219 between hypoxia and normoxia, and the result showed that hypoxic condition could inhibit the expression of miR-219 (Figure 4(a)). We also found that the expression of miR-219 was negative correlated with HIF-1a in HCC tissues (Supplement ). When we suppressed the expression of HIF-1a by siRNA under hypoxic condition, the expression of miR-219 could be higher than hypoxic condition alone (Figure 4(b)). In addition, we found that miR-219 mimics could decrease the expression of SMC4 while miR-219 inhibitor could increase the SMC4 level under hypoxia (Figure 4(c)). Moreover, we also found that miR-219 mimics could inhibit the proliferation and migration ability of HCC cells while miR-219 inhibitor was opposed (Figures 4(d)–4(e)). Thus we proved that miR-219 could inhibit the proliferation and migration ability of HCC cells under hypoxia, and hypoxia could increase the expression of SMC4 by suppressing miR-219 level.
Figure 4
Hypoxia increases the expression of SMC4 through inhibiting the expression of miR-219. (a) mRNA level of SMC4 was detected under hypoxic or normoxic condition in HCC cells. n = 3, p < 0.005. (b) The expression of miR-219 was detected under hypoxia or normoxia or hypoxia + HIF-1a siRNA in HCC cells. n = 3, p < 0.05, p < 0.005.(c) Expression of SMC4 was detected under treatment of miR-219 mimics, inhibitor, or negative control, and β-actin was used for internal control. (d) CCK-8 was used to detect cell viability of HCC cells with miR-219 mimics, inhibitor, or negative control under hypoxic condition. The value of 72 h was statistically analyzed. n = 7, p < 0.0005. (e) Transwell assay was used to detect cell migration ability of HCC cells with miR-219 mimics, inhibitor, or negative control under hypoxic condition. n = 3, p < 0.05.
4. Discussion
Hepatocellular carcinoma (HCC) is a common digestive system tumor which has higher morbidity and mortality [11]. Current treatments including surgical resection, liver transplantation, and local ablation are eligible and effective for early stage HCCpatients. However, because of the early occurrence and poor prognosis of advanced HCC, even if the patients obtained the above treatments, they need comprehensive treatment supplemented by surgery-based chemotherapy [12]. Thus, realizing the early diagnosis of liver cancer is a major problem in the treatment of liver cancer. With regard to this, a lot of biomarkers have been discovered, such as AFP, Des-γ-carboxy prothrombin, α-l-fucosidase, and GPC-3. Using these biomarkers could improve the diagnosis rate of early liver cancer. However, their sensitivity and specificity are still limited [13-16]. Thus more studies were needed to investigate new biomarkers for HCC.SMC4 is a subunit of condensation which encodes a “structural maintenance of chromosomes” protein. It acts a vital role involved in chromosome condensation and mitosis and is necessary for cell cycle progression from G1 into S phase [17, 18]. Recent study demonstrated that SMC4 could regulate the sensitivity of breast cancer cells to paclitaxel and the response to the combination treatment of SAHA/paclitaxel [19]. Other studies showed that SMC4 could regulate aggressive phenotype of glioma cells through activating TGFβ/Smad signaling and was a target gene regulated by microRNA-124-5p in colorectal cancer [4, 20]. SMC4 was also associated with the prognosis of lung adenocarcinoma, prostate cancer, and acute myeloid leukemia [21-23].SMC4 was associated with the prognosis of HCC and a target gene regulated by miR-219 in HCC cells [5, 10]. However, the function of SMC4 under hypoxic condition in HCC cells is unclear. Hypoxic microenvironment is an important feature of solid tumor. In hypoxic microenvironment, tumor cells can change metabolism to inhibit the antitumor effects of immune cells and enhance proliferation rate, migration ability, and drug resistance capacity [24, 25]. Hypoxia-inducible factor-1 (HIF-1) was reported to be acted as an important role under hypoxic microenvironment and associated with proliferation, migration, and drug resistance of most solid tumors.Under hypoxic culture, we observed that suppression of SMC4 could inhibit the proliferation rate of HCC cells through inducing G1 phase arrest and affecting cell migration ability by affecting the process of EMT. As HIF-1 had a critical role under hypoxic condition, we supposed that SMC4 was regulated by HIF-1. Through the coexpression analysis of GEPIA, we found that the expression of SMC4 was positive correlated with HIF-1a in HCC tissues. We also found that there existed HRE sequence in promoter of SMC4, and the result of luciferase reporter experiment showed that HIF-1 could transcriptionally regulate the expression of SMC4. In addition, suppression of HIF-1a under hypoxic condition could decrease the expression of SMC4, G1 phase associated proteins (CDK2 and CDK4), and EMT associated proteins (E-cadherin and Vimentin). Since SMC4 was proved to be a target gene regulated by miR-219 in HCC cells, we supposed that HIF-1 could affect the expression of SMC4 through inhibiting miR-219. Firstly, we observed that the expression of miR-219 was decreased under hypoxic condition, while its level was increased accompanying suppression of HIF-1a. Then, we found that miR-219 mimics could decrease while miR-219 inhibitor could increase the expression of SMC4 under hypoxia. In addition, functional experiment showed that miR-219 could affect the proliferation and migration of HCC cells under hypoxia.In conclusion, our study found that HIF-1 could increase the expression of SMC4 through transcriptional regulation and inhibiting miR-219 under hypoxia. Such novel HIF-1-miR-219-SMC4 regulatory pathway under hypoxic condition gives new insight into SMC4 function and the mechanisms of growth and invasion in HCC (Figure 5). However, further study was needed to investigate the mechanism of the relationship between miR-219 and HIF-1.
Figure 5
HIF-1-miR-219-SMC4 axis regulates proliferation and migration of HCC under hypoxic condition.
Authors: Jorge A Marrero; Grace L Su; Wei Wei; Dawn Emick; Hari S Conjeevaram; Robert J Fontana; Anna S Lok Journal: Hepatology Date: 2003-05 Impact factor: 17.425
Authors: M Ishii; H Gama; N Chida; Y Ueno; H Shinzawa; T Takagi; T Toyota; T Takahashi; R Kasukawa Journal: Am J Gastroenterol Date: 2000-04 Impact factor: 10.864
Authors: Shuang G Zhao; Joseph R Evans; Vishal Kothari; Grace Sun; Ashley Larm; Victor Mondine; Edward M Schaeffer; Ashley E Ross; Eric A Klein; Robert B Den; Adam P Dicker; R Jeffrey Karnes; Nicholas Erho; Paul L Nguyen; Elai Davicioni; Felix Y Feng Journal: Clin Cancer Res Date: 2015-12-02 Impact factor: 12.531
Authors: Heber L Rocha; Inês Godet; Furkan Kurtoglu; John Metzcar; Kali Konstantinopoulos; Soumitra Bhoyar; Daniele M Gilkes; Paul Macklin Journal: iScience Date: 2021-08-04