Literature DB >> 31825310

Agonist-specific voltage-dependent gating of lysosomal two-pore Na+ channels.

Xiaoli Zhang1, Wei Chen1, Ping Li1,2, Raul Calvo3, Noel Southall3, Xin Hu3, Melanie Bryant-Genevier3, Xinghua Feng2, Qi Geng1, Chenlang Gao1, Meimei Yang1,4, Kaiyuan Tang1, Marc Ferrer3, Juan Jose Marugan3, Haoxing Xu1.   

Abstract

Mammalian two-pore-channels (TPC1, 2; TPCN1, TPCN2) are ubiquitously- expressed, PI(3,5)P2-activated, Na+-selective channels in the endosomes and lysosomes that regulate luminal pH homeostasis, membrane trafficking, and Ebola viral infection. Whereas the channel activity of TPC1 is strongly dependent on membrane voltage, TPC2 lacks such voltage dependence despite the presence of the presumed 'S4 voltage-sensing' domains. By performing high-throughput screening followed by lysosomal electrophysiology, here we identified a class of tricyclic anti-depressants (TCAs) as small-molecule agonists of TPC channels. TCAs activate both TPC1 and TPC2 in a voltage-dependent manner, referred to as Lysosomal Na+ channel Voltage-dependent Activators (LyNa-VAs). We also identified another compound which, like PI(3,5)P2, activates TPC2 independent of voltage, suggesting the existence of agonist-specific gating mechanisms. Our identification of small-molecule TPC agonists should facilitate the studies of the cell biological roles of TPCs and can also readily explain the reported effects of TCAs in the modulation of autophagy and lysosomal functions.

Entities:  

Keywords:  lysosomal Na+ channels; lysosomal two-pore channels; neuroscience; none; tri-cyclic antidepressants; whole-endolysosome patch clamp

Mesh:

Substances:

Year:  2019        PMID: 31825310      PMCID: PMC6905855          DOI: 10.7554/eLife.51423

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Lysosomes are the cell’s recycling center equipped with the most important nutrient-sensing machinery in the cell (Lawrence and Zoncu, 2019; Li et al., 2019). Ion channels in the lysosome play essential roles in the regulation of various lysosomal functions, including cargo import, lysosomal degradation, and catabolite export (Li et al., 2019; Xiong and Zhu, 2016). Patch-clamp studies of isolated lysosomal membranes have recently discovered multiple lysosomal channels that are selective for Na+, K+, Ca2+, and Cl- (Cang et al., 2015; Cang et al., 2013; Cao et al., 2015; Dong et al., 2010; Li et al., 2019; Wang et al., 2012; Xiong and Zhu, 2016). How these lysosomal channels are activated by endogenous nutrient-dependent signals remain largely unknown (Li et al., 2019). On the other hand, membrane-permeable small-molecule modulators, that is synthetic agonists and inhibitors, have proved extremely helpful in probing the cell biological functions of intracellular channels, including lysosomal channels (Cao et al., 2015; Dong et al., 2010; Li et al., 2019; Wang et al., 2012; Xiong and Zhu, 2016). For example, small-molecule synthetic agonists of Mucolipin TRP channels (TRPMLs), that is ML-SAs, have been instrumental in revealing the functions of these Ca2+ release channels in lysosomal exocytosis, mobility, and biogenesis (Li et al., 2016; Shen et al., 2012; Zhang et al., 2016). However, such chemical tools are still lacking for most other lysosomal channels. Two-pore channel proteins (TPC1, 2; TPCN1, TPCN2) are ubiquitously expressed, dimeric, two-repeat (2 × 6 TM) cation channels that are localized exclusively in the intracellular endosomes and lysosomes (Calcraft et al., 2009; Grimm et al., 2017; Morgan et al., 2011). At the cellular level, TPCs regulate organellar membrane excitability, membrane trafficking, and pH homeostasis; at the organismal level, TPCs regulate various physiological and pathological processes, including hair pigmentation, Ebola viral infection, and cancer growth (Ambrosio et al., 2016; Nguyen et al., 2017; Sakurai et al., 2015). Early works from several laboratories suggested that TPCs play an essential role in mediating Ca2+ release from endolysosomes in response to cytosolic increases of nicotinic acid adenine dinucleotide phosphate (NAADP) (Brailoiu et al., 2009; Calcraft et al., 2009; Ruas et al., 2010; Zong et al., 2009). However, it remains controversial whether TPCs are the bona fide NAADP receptor (Lin-Moshier et al., 2012; Morgan et al., 2015; Walseth et al., 2012). Indeed, several recent endolysosomal patch-clamp studies have demonstrated that TPCs are Na+-selective channels activated by PI(3,5)P2 (Bellono et al., 2016; Cang et al., 2014; Cang et al., 2013; Guo et al., 2017; Jha et al., 2014; Kirsch et al., 2018; She et al., 2019; Wang et al., 2012), a late endosome and lysosome-specific phosphoinositide that is known to regulate many aspects of lysosome function (McCartney et al., 2014). Recent high-resolution structural studies revealed that several amino acid (AA) residues in the selectivity filter of TPCs confer the selectivity of Na+ over K+ or Ca2+ (Guo et al., 2016; Guo et al., 2017), and that PI(3,5)P2 binds directly to several positively charged AA residues in the S4-S5 linker to induce channel opening (Kirsch et al., 2018; She et al., 2018; She et al., 2019). Sphingosines also reportedly induce TPC1-mediated Ca2+ release from the lysosomes (Höglinger et al., 2015), but direct activation of TPCs by sphingosines was not confirmed in the lysosomal electrophysiological assays (unpublished data in the Xu laboratory) (Li et al., 2019). Lysosomal membrane potential (Δψ) has been proposed to regulate an array of lysosomal functions, including metabolite transport and membrane trafficking, but the underlying mechanisms are poorly understood (Li et al., 2019; Xu and Ren, 2015). Na+ flux mediated by TPCs may cause rapid changes of lysosomal Δψ , which may in turn modulate the functions of TPCs and other lysosomal channels (Cang et al., 2014). Like canonical voltage-gated cation channels, TPCs contain multiple positively-charged AA residues in their voltage sensor domains (S4), which are believed to confer voltage-dependent activation of plant and animal TPC1 channels (Cang et al., 2014; She et al., 2019). In a sharp contrast, TPC2 activation is completely voltage-independent, despite the presence of multiple Arginine/Lysine residues in their S4 helices (Cang et al., 2014; Cang et al., 2013; Wang et al., 2012). In the current study, we identified seven small molecules known to act as tri-cyclic anti-depressants (TCAs) that activate both TPC1 and TPC2 in a voltage-dependent manner.

Results

High-throughput screening of small-molecule agonists of TPC2 channels

We recently used a Ca2+-imaging-based high-throughput screening (HTS) method to identify small-molecule agonists for lysosomal TRPML1 channels (Wang et al., 2015). Although TPCs are Na+-selective channels with limited Ca2+ permeability (Cang et al., 2014; Guo et al., 2017; Li et al., 2019; Wang et al., 2012), in a number of cell-based studies, TPCs reportedly mediate Ca2+ release from lysosomes (Brailoiu et al., 2009; Calcraft et al., 2009; Jha et al., 2014; Morgan et al., 2015; Patel, 2015; Ruas et al., 2015; Zong et al., 2009), and it is conceivable that the small Ca2+-permeability of TPCs, or activation of Na+-dependent Ca2+ flux mechanisms (e.g., Na+-Ca2+ exchanger) secondary to Na+ flux may be sufficient to elevate intracellular Ca2+. We thus screened HEK293 cells stably expressing human TPC2 (hTPC2) channels with the Library of Pharmacologically Active Compounds (LOPAC) (Liu et al., 2010), the same library of chemicals that were previously tested on TRPML1 channels. Among the positive hits, 23 compounds induced Ca2+ increases in TPC2 stable cells (Figure 1A and B and Figure 1—figure supplement 1A), but not in cells stably expressing TRPML14A (a surface-expressing mutant TRPML1 [Shen et al., 2012]) channels (data not shown).
Figure 1.

Screening of small-molecule agonists of TPC2.

(A) High-throughput screening of the LOPAC library with Fluo-4 Ca2+ imaging in HEK293 cells stably expressing hTPC2 (Dryad, http://doi.org/10.5061/dryad.s5f6j9h). Each trace represented the average Ca2+ response to individual LOPAC compound. Only positive hits confirmed with electrophysiology were color-coded. (B) An example of a positive responder (chlorpromazine, CPZ), which elevated intracellular Ca2+ levels at the concentration of 46 µM. Note a similar response was seen with a repeated (re) drug application. (C) Representative whole-cell currents in a HEK293 cell upon bath application of clomipramine (100 µM). Both pipette and bath solutions contained symmetric 150 mM Na+. Currents were elicited by repeated voltage ramps (−140 to +100 mV; 200 ms) with a 4 s inter-step interval. Holding potential (HP) = 0 mV. (D) Representative TPC2-mediated currents (I) activated by clomipramine (100 µM; LyNa-VA1.1) in a HEK293 cell transfected with a surface-expressing mutant TPC2 channel (EGFP-TPC2LL/AA; Wang et al., 2012). (E) Dose-dependent activation of TPC2 by Lysosomal Na+ channel Voltage-dependent Activators (LyNa-VAs). (F) The effect of clomipramine (100 µM) on surface-expressing mutant TRPML1 channels (TRPML14A; Shen et al., 2012). (G) Summary of clomipramine effects on whole-cell I and I. Individual data and Mean ± S.E.M are presented. **, p<0.01. (H) Activation of I by LyNa-VA1.2 and Lysosomal Na+ channel Agonist 1 (LyNA1; see Figure 1—figure supplement 2). Individual data for (A), (E) and (G) are presented in Figure 1—source data 1.

(A) An example of a negative responder (MDL) in high- throughput screening of the LOPAC library with Fluo-4 Ca2+ imaging in HEK293 cells stably expressing hTPC2. (B, C, D) Representative whole-cell I was evoked by chlorpromazine (100 µM, (B), amitriptyline (100 µM, (C), and desipramine (100 µM, (D) and, but not by carbamazepine (100 µM, (D).

(A) Representative I evoked by LyNa-VA1.2 (200 µM) in an inside-out patch from TPC2LL/AA-transfected cells. (B) Representative time course of LyNa-VA1.2- induced TPC2 activation under whole-cell (WC), inside-out (I/O), and whole-endolysosomal (EL) configurations. (C, D) Comparison of latency (C) and time constant (τ, D) of LyNa-VA1.2 (200 µM)-induced TPC2 activation in whole-cell (latency = 15 ± 2 s, τ = 43 ± 5 s, n = 4), inside-out (latency = 12 ± 1 s, τ = 17 ± 2 s, n = 4), and whole-endolysosome (latency = 7 ± 1 s, n = 5; τ = 8 ± 2 s, n = 4) recordings. Both individual data points and Mean ± S.E.M are presented. **, p<0.01; ***, p<0.001. Individual data for (B–D) are presented in Figure 1—figure supplement 2—source data 1.

(A) Chemical structure of LyNA1. (B) The effects of LyNa-VA1.2 and LyNA1 on whole-cell I under the recording conditions of extracellular 150 mM Na+ and cytosolic 150 mM K+.

Figure 1—figure supplement 1.

TCAs act as TPC agonists.

(A) An example of a negative responder (MDL) in high- throughput screening of the LOPAC library with Fluo-4 Ca2+ imaging in HEK293 cells stably expressing hTPC2. (B, C, D) Representative whole-cell I was evoked by chlorpromazine (100 µM, (B), amitriptyline (100 µM, (C), and desipramine (100 µM, (D) and, but not by carbamazepine (100 µM, (D).

Screening of small-molecule agonists of TPC2.

(A) High-throughput screening of the LOPAC library with Fluo-4 Ca2+ imaging in HEK293 cells stably expressing hTPC2 (Dryad, http://doi.org/10.5061/dryad.s5f6j9h). Each trace represented the average Ca2+ response to individual LOPAC compound. Only positive hits confirmed with electrophysiology were color-coded. (B) An example of a positive responder (chlorpromazine, CPZ), which elevated intracellular Ca2+ levels at the concentration of 46 µM. Note a similar response was seen with a repeated (re) drug application. (C) Representative whole-cell currents in a HEK293 cell upon bath application of clomipramine (100 µM). Both pipette and bath solutions contained symmetric 150 mM Na+. Currents were elicited by repeated voltage ramps (−140 to +100 mV; 200 ms) with a 4 s inter-step interval. Holding potential (HP) = 0 mV. (D) Representative TPC2-mediated currents (I) activated by clomipramine (100 µM; LyNa-VA1.1) in a HEK293 cell transfected with a surface-expressing mutant TPC2 channel (EGFP-TPC2LL/AA; Wang et al., 2012). (E) Dose-dependent activation of TPC2 by Lysosomal Na+ channel Voltage-dependent Activators (LyNa-VAs). (F) The effect of clomipramine (100 µM) on surface-expressing mutant TRPML1 channels (TRPML14A; Shen et al., 2012). (G) Summary of clomipramine effects on whole-cell I and I. Individual data and Mean ± S.E.M are presented. **, p<0.01. (H) Activation of I by LyNa-VA1.2 and Lysosomal Na+ channel Agonist 1 (LyNA1; see Figure 1—figure supplement 2). Individual data for (A), (E) and (G) are presented in Figure 1—source data 1.
Figure 1—figure supplement 2.

Time courses of LyNa-VA1.2-induced TPC2 activation under different recording configurations.

(A) Representative I evoked by LyNa-VA1.2 (200 µM) in an inside-out patch from TPC2LL/AA-transfected cells. (B) Representative time course of LyNa-VA1.2- induced TPC2 activation under whole-cell (WC), inside-out (I/O), and whole-endolysosomal (EL) configurations. (C, D) Comparison of latency (C) and time constant (τ, D) of LyNa-VA1.2 (200 µM)-induced TPC2 activation in whole-cell (latency = 15 ± 2 s, τ = 43 ± 5 s, n = 4), inside-out (latency = 12 ± 1 s, τ = 17 ± 2 s, n = 4), and whole-endolysosome (latency = 7 ± 1 s, n = 5; τ = 8 ± 2 s, n = 4) recordings. Both individual data points and Mean ± S.E.M are presented. **, p<0.01; ***, p<0.001. Individual data for (B–D) are presented in Figure 1—figure supplement 2—source data 1.

TCAs act as TPC agonists.

(A) An example of a negative responder (MDL) in high- throughput screening of the LOPAC library with Fluo-4 Ca2+ imaging in HEK293 cells stably expressing hTPC2. (B, C, D) Representative whole-cell I was evoked by chlorpromazine (100 µM, (B), amitriptyline (100 µM, (C), and desipramine (100 µM, (D) and, but not by carbamazepine (100 µM, (D).

Time courses of LyNa-VA1.2-induced TPC2 activation under different recording configurations.

(A) Representative I evoked by LyNa-VA1.2 (200 µM) in an inside-out patch from TPC2LL/AA-transfected cells. (B) Representative time course of LyNa-VA1.2- induced TPC2 activation under whole-cell (WC), inside-out (I/O), and whole-endolysosomal (EL) configurations. (C, D) Comparison of latency (C) and time constant (τ, D) of LyNa-VA1.2 (200 µM)-induced TPC2 activation in whole-cell (latency = 15 ± 2 s, τ = 43 ± 5 s, n = 4), inside-out (latency = 12 ± 1 s, τ = 17 ± 2 s, n = 4), and whole-endolysosome (latency = 7 ± 1 s, n = 5; τ = 8 ± 2 s, n = 4) recordings. Both individual data points and Mean ± S.E.M are presented. **, p<0.01; ***, p<0.001. Individual data for (B–D) are presented in Figure 1—figure supplement 2—source data 1.

LyNA1 activates TPC2 channels.

(A) Chemical structure of LyNA1. (B) The effects of LyNa-VA1.2 and LyNA1 on whole-cell I under the recording conditions of extracellular 150 mM Na+ and cytosolic 150 mM K+.

Tri-cyclic anti-depressants (TCAs) as TPC2 agonists

To our surprise, 5 out of the 23 compounds are well characterized as tri-cyclic anti-depressants (TCAs), which are believed to act on neurotransmitter transporters or voltage-gated Na+ channels (Cheng and Bahar, 2019; Pancrazio et al., 1998). We therefore characterized the responses of TPC2 channels to TCAs in detail using electrophysiological methods. We first performed whole-cell recordings in HEK293 cells that were transfected with surface-expressed TPC2 mutant channels (TPC2-L11L12-AA; abbreviated as TPC2LL/AA hereafter). No functional difference was noted between wild-type (WT) TPC2 and TPC2LL/AA channels in terms of channel permeation and gating properties (Wang et al., 2012). To facilitate the detection of TPC2-specific currents, we used symmetric Na+ solutions in the bath (extracellular) and pipette (cytosolic) solutions (Wang et al., 2012). All five TCAs robustly and rapidly activated whole-cell currents in TPC2LL/AA-expressing cells (Wang et al., 2012), but not in non-transfected HEK293 cells (Figure 1C and D, Figure 1—figure supplement 1B–D, Table 1, and Table 1—source data 1).
Table 1.

Summary of electrophysiology-based screening of TPC agonists.

Based on chemical structures, LyNa-VAs were divided into two groups: LyNa-VA1.x and LyNa-VA2.x. EC50 and the average TPC2 currents (I) were calculated based on 3–5 whole-cell or whole-endolysosome recordings (see individual data in Table 1—source data 1) for each LyNa-VA, respectively.

LyNa-VAsChemical nameStructureEC50 (μM)*ITPC2 (pA)**
LyNa-VA1.1Clomipramine 43 ± 2945 ± 111
LyNa-VA1.2Desipramine 87 ± 81120 ± 94
LyNa-VA1.3Imipramine112 ± 1433 ± 94
LyNa-VA1.4Amitriptyline 102 ± 3876 ± 196
LyNa-VA1.5Nortriptyline 52 ± 101916 ± 361
Carbamazepine No activationNo activation
LyNa-VA2.1Chlorpromazine 60 ± 21101 ± 508
LyNa-VA2.2Triflupromazine 63 ± 2984 ± 294
Phenothiazine No activationNo activation

*Data were obtained from whole-cell recordings at −140 mV.

**Data were obtained from whole endolysosome recordings with 100 µM of LyNa-VAs at −120 mV.

Summary of electrophysiology-based screening of TPC agonists.

Based on chemical structures, LyNa-VAs were divided into two groups: LyNa-VA1.x and LyNa-VA2.x. EC50 and the average TPC2 currents (I) were calculated based on 3–5 whole-cell or whole-endolysosome recordings (see individual data in Table 1—source data 1) for each LyNa-VA, respectively. *Data were obtained from whole-cell recordings at −140 mV. **Data were obtained from whole endolysosome recordings with 100 µM of LyNa-VAs at −120 mV. We then extended detailed analyses to other known TCAs (Table 1). Of them, Clomipramine activated whole-cell TPC2LL/AA-mediated strongly rectifying currents (ITPC2-LL/AA) with an EC50 of 43 ± 2 μM (n = 4 patches) (Figure 1D and E, and Table 1). Given the apparent voltage-dependent gating described below, we referred to Clomipramine as Lysosomal Na+ channel Voltage-dependent Activator 1.1 (LyNa-VA1.1). Another structurally different TCA, Chlorpromazine, had an EC50 of 60 ± 2 μM (n = 4 patches), and was referred to as LyNa-VA2.1 (Figure 1E, Table 1, and Figure 1—figure supplement 1B). Other TPC-activating TCAs were referred to as LyNa-VA1.x or LyNa-VA2.x, respectively, based on the structural similarity (Table 1). In contrast, no significant activation was seen with Carbamazepine or Phenothiazine, tricyclic drugs without the aliphatic chain (Table 1 and Figure 1—figure supplement 1D). All TCA-induced currents exhibited strong voltage-dependence and inward rectification, which resembled TRPML1-mediated currents (ITRPML1) (Shen et al., 2012). However, none of the TCAs had any activation effect on ITRPML1 (Figure 1F and G). Taken together, these results suggested that TCAs may function as small-molecule agonists of TPC2 channels. In a separate screen, we identified another compound (Riluzole, see Figure 1—figure supplement 3A) that showed striking differences from the responses elicited by TCAs. Riluzole, an FDA-approved amyotrophic lateral sclerosis drug that is known to modulate voltage-gated Na+ channels (Liu and Wang, 2018), activated large and linear whole-cell currents in TPC2LL/AA-expressing HEK293 cells (Figure 1H and Figure 1—figure supplement 3), but not in non-transfected HEK293 cells. Given its lack of the voltage-dependence, Riluzole was referred to as Lysosomal Na+ channel Agonist 1 (LyNA1). Hence, more than one agonist-specific gating (voltage-dependent and voltage-independent) mechanism may co-exist within one channel protein.
Figure 1—figure supplement 3.

LyNA1 activates TPC2 channels.

(A) Chemical structure of LyNA1. (B) The effects of LyNa-VA1.2 and LyNA1 on whole-cell I under the recording conditions of extracellular 150 mM Na+ and cytosolic 150 mM K+.

TCAs activate lysosomal TPC2 channels

TCAs, with a general structure of an aromatic greasy core and an aliphatic chain containing a terminal amine, are lysosomotropic compounds that are known to be highly accumulating in the lysosomes due to proton trapping (Beckmann et al., 2014). We next tested the effects of LyNa-VAs in hTPC2-transfected Cos1 and HEK293 cells using whole-endolyosome patch-clamp. Cells were pretreated with vacuolin-1 (1 µM) that can selectively increase the size of late endosomes and lysosomes (LELs) up to 5 μm (Dong et al., 2010). The enlarged endolysosomes were manually isolated and then patch clamped in the whole-endolysosome configuration (Dong et al., 2010). In TPC2-positive enlarged LELs isolated from transfected Cos1 cells, little or no basal whole-endolysosome currents were seen under symmetric (pipette/luminal and bath/cytosolic) Na+ solutions (Figure 2A). Consistent with our previous studies, bath application of PI(3,5)P2, the endogenous agonist of TPCs (Wang et al., 2012), activated a large whole-endolysosome ITPC2 with linear I-V (Figure 2B and E). Both LyNa-VAs and LyNA1 readily activated ITPC2, although the I-Vs were dramatically different (Figure 2C, D and E, and Figure 2—figure supplements 1 and 2). In contrast, no current activation was seen for LyNa-VAs or LyNA1 in TRPML1-transfected cells (Figure 2—figure supplement 1C). Both LyNa-VAs and LyNA1 activated whole-endolysosome ITPC in WT HAP1 cells, but not HAP1 cells lacking TPC1 or TPC2 (TPC1, TPC1/2 DKO; Figure 2—figure supplement 1), suggesting that the activation effects of both TCAs and LyNA1 on TPCs are specific. In addition, robust activation of ITPC2 in the whole-cell configuration with agonists being applied from the extracellular side (analogous to the luminal side in the lysosome), as well as in the inside-out (Figure 1—figure supplement 2A) and whole-endolysosome configurations with agonists being applied from the cytosolic side, suggests that LyNa-VAs and LyNA1 are likely to be membrane permeable, activating TPC2 via direct agonist binding. As the channel activation in the whole-cell recordings was significantly slower, that is longer latency and time course of activation, compared to the inside-out and whole-endolysosome recordings (see Figure 1—figure supplement 2), the action site of LyNa-VAs is likely to be either intracellular or more accessible from the intracellular side.
Figure 2.

LyNa-VAs activate lysosomal TPC2 channels in a voltage-dependent manner.

(A) Representative basal I step currents elicited by a voltage step protocol in the whole-endolysosome (EL) configuration. Voltage steps from −140 to 100 mV with a voltage increment (∆V) of 20 mV for 0.5 s were used to elicit I in A-D. HP = 0 mV. Unless otherwise indicated, symmetric (bath/cytosol vs pipette/lumen) Na+ (150 mM) solutions were used for all whole-endolysosome recordings, and PI(3,5)P2 (0.3 µM), LyNa-VA1.2 (100 µM), and LyNA1 (300 µM) were bath- applied to induce I (B–D) Representative I step currents activated by PI(3,5)P2 (B), LyNa-VA1.2 (C), and LyNA1 (D). (E) Representative normalized I-V plots based on the instantaneous currents activated by various agonists. (F) Rectification index, calculated as the ratio of the current amplitudes between +80 and −80 mV, of PI(3,5)P2-, LyNa-VA1.2-, and LyNA1- activated I. (G) The inactivation of I at −120 mV was quantified as the ratio of current amplitudes at 10 vs. 500 ms, based on step currents in B, (C) and D. (H) Voltage steps from −120 to 100 mV (∆V = 20 mV) for 1 s were used to elicit tail currents at −120 mV shown in (I) and (J). (I) The tail currents of PI(3,5)P2- evoked whole-endolysosome I (J) The tail currents of LyNa-VA1.2- activated whole-endolysosome I. Arrows in (I) and (J) indicate where the currents were measured to calculate the channel conductance (G = I/V). (K) Normalized G-V curves of PI(3,5)P2- and LyNa-VA1.2- activated I LyNa-VA1.2 activated I in a voltage dependent manner with a V1/2 = −20.3 ± 3.5 mV (n = 5 patches). For panels F and G, individual data and Mean ± S.E.M. are presented. ***, p<0.001. Individual data for (F) and (G) are presented in Figure 2—source data 1.

(A) Time course of dose-dependent activation of whole-endolysosome ITPC2 by LyNA1. (B) Representative traces of I evoked by 100 µM and 300 µM LyNA1 at the time points indicated in (A). (C) The lack of the activation effects of LyNA1 on whole-endolysosome I. (D, E) LyNA1 (300 µM) activated whole-endolysosome I in WT (D) but not TPC1/2 double KO HAP1 cells (E). Instead, ML-SA1, a TRPML-specific synthetic agonist, readily activated ITRPML1 in TPC1/2 DKO cells.

(A, B) Whole-cell ITPC2 elicited by voltage steps from −140 to 80 mV (∆V = 20 mV; see the voltage protocol in the left panel) in the presence of LyNa-VA1.2 (A) or LyNA1 (B). (C) Agonist-specific voltage-dependent inactivation of ITPC2 induced by LyNa-VA1.2 and LyNA1 (see individual data in Figure 2—figure supplement 2—source data 1). ***, p<0.001.

Figure 2—figure supplement 1.

LyNA1 activates lysosomal TPC2 channels.

(A) Time course of dose-dependent activation of whole-endolysosome ITPC2 by LyNA1. (B) Representative traces of I evoked by 100 µM and 300 µM LyNA1 at the time points indicated in (A). (C) The lack of the activation effects of LyNA1 on whole-endolysosome I. (D, E) LyNA1 (300 µM) activated whole-endolysosome I in WT (D) but not TPC1/2 double KO HAP1 cells (E). Instead, ML-SA1, a TRPML-specific synthetic agonist, readily activated ITRPML1 in TPC1/2 DKO cells.

Figure 2—figure supplement 2.

TCAs induce voltage-dependent activation and inactivation of TPC2 channels.

(A, B) Whole-cell ITPC2 elicited by voltage steps from −140 to 80 mV (∆V = 20 mV; see the voltage protocol in the left panel) in the presence of LyNa-VA1.2 (A) or LyNA1 (B). (C) Agonist-specific voltage-dependent inactivation of ITPC2 induced by LyNa-VA1.2 and LyNA1 (see individual data in Figure 2—figure supplement 2—source data 1). ***, p<0.001.

LyNa-VAs activate lysosomal TPC2 channels in a voltage-dependent manner.

(A) Representative basal I step currents elicited by a voltage step protocol in the whole-endolysosome (EL) configuration. Voltage steps from −140 to 100 mV with a voltage increment (∆V) of 20 mV for 0.5 s were used to elicit I in A-D. HP = 0 mV. Unless otherwise indicated, symmetric (bath/cytosol vs pipette/lumen) Na+ (150 mM) solutions were used for all whole-endolysosome recordings, and PI(3,5)P2 (0.3 µM), LyNa-VA1.2 (100 µM), and LyNA1 (300 µM) were bath- applied to induce I (B–D) Representative I step currents activated by PI(3,5)P2 (B), LyNa-VA1.2 (C), and LyNA1 (D). (E) Representative normalized I-V plots based on the instantaneous currents activated by various agonists. (F) Rectification index, calculated as the ratio of the current amplitudes between +80 and −80 mV, of PI(3,5)P2-, LyNa-VA1.2-, and LyNA1- activated I. (G) The inactivation of I at −120 mV was quantified as the ratio of current amplitudes at 10 vs. 500 ms, based on step currents in B, (C) and D. (H) Voltage steps from −120 to 100 mV (∆V = 20 mV) for 1 s were used to elicit tail currents at −120 mV shown in (I) and (J). (I) The tail currents of PI(3,5)P2- evoked whole-endolysosome I (J) The tail currents of LyNa-VA1.2- activated whole-endolysosome I. Arrows in (I) and (J) indicate where the currents were measured to calculate the channel conductance (G = I/V). (K) Normalized G-V curves of PI(3,5)P2- and LyNa-VA1.2- activated I LyNa-VA1.2 activated I in a voltage dependent manner with a V1/2 = −20.3 ± 3.5 mV (n = 5 patches). For panels F and G, individual data and Mean ± S.E.M. are presented. ***, p<0.001. Individual data for (F) and (G) are presented in Figure 2—source data 1.

LyNA1 activates lysosomal TPC2 channels.

(A) Time course of dose-dependent activation of whole-endolysosome ITPC2 by LyNA1. (B) Representative traces of I evoked by 100 µM and 300 µM LyNA1 at the time points indicated in (A). (C) The lack of the activation effects of LyNA1 on whole-endolysosome I. (D, E) LyNA1 (300 µM) activated whole-endolysosome I in WT (D) but not TPC1/2 double KO HAP1 cells (E). Instead, ML-SA1, a TRPML-specific synthetic agonist, readily activated ITRPML1 in TPC1/2 DKO cells.

TCAs induce voltage-dependent activation and inactivation of TPC2 channels.

(A, B) Whole-cell ITPC2 elicited by voltage steps from −140 to 80 mV (∆V = 20 mV; see the voltage protocol in the left panel) in the presence of LyNa-VA1.2 (A) or LyNA1 (B). (C) Agonist-specific voltage-dependent inactivation of ITPC2 induced by LyNa-VA1.2 and LyNA1 (see individual data in Figure 2—figure supplement 2—source data 1). ***, p<0.001.

Activation of TPCs by LyNa-VAs shows strong voltage dependence

Despite the fact that TPCs have two S4 domains that act as voltage sensors in many voltage gated channels (She et al., 2018), the responses of TPC2 to PI(3,5)P2 and LyNA1 were voltage independent, with large currents at both positive and negative voltages (Figure 2B, D and E). In contrast, TPC2 currents activated by TCAs were strongly voltage-dependent, in both whole-cell and whole-endolysosome recordings, no matter whether the currents were elicited by a voltage ramp or a series of voltage steps (see Figure 2C and E and Figure 2—figure supplement 2). In both whole-cell and whole-endolysosome configurations, TCA-activated step currents displayed prominent inactivation and strong inward rectification (Figure 2C, E and F and Figure 2—figure supplement 2), suggesting the existence of voltage-dependent activation and/or inactivation gating processes. The steady-state voltage dependence of the responses to all 7 TCAs were qualitatively similar. A convenient way to quantitatively summarize the voltage dependence of the TCA responses was to calculate the rectification ratio ( ), which was 1.00 ± 0.06 (n = 4 patches) for activation by PI(3,5P)2, 0.93 ± 0.03 for LyNA1 (n = 4), but only 0.10 ± 0.03 for LyNa-VA1.2 (n = 6, Figure 2F). Under the voltage-step protocols, LyNa-VA-activated ITPC2 exhibited substantial time-dependent inactivation at negative voltages (Figure 2C and G and Figure 2—figure supplement 2A). This could be conveniently characterized by two parameters: the amount of current decline at steady state () and the time constant (τ) of the decay of current. There was no inactivation with ratio near 1.0 at all potentials when the agonist was PI(3,5)P2 or LyNA1, but the ratio was 0.6 or less for all the active TCAs tested at −120 mV; the time constant of inactivation was approximately 300 ms at −120 mV (Figure 2J and Figure 2—figure supplement 2). When we used a tail-current protocol to study the voltage-dependent activation, the activation by LyNa-VA1.2 was strongly dependent on voltage, with a half-maximal activation voltage (V1/2) of −20 mV at the concentration of 100 μM (Figure 2J and K). In contrast, no apparent voltage-dependent activation was seen when whole-endolysosome ITPC2 was activated by PI(3,5)P2 (Figure 2I and K) or LyNA1. Collectively, LyNa-VAs have manifested multiple aspects of voltage-dependent gating of TPC2 channels.

Synergistic activation of TPC2 by PI(3,5)P2 and TCAs

PI(3,5)P2 reportedly binds to Lys204 and adjacent AA residues to activate TPC2 (She et al., 2019). In the cells that were transfected with a PI(3,5)P2-insensitive mutant TPC2 channel (K204A) (She et al., 2019), LyNa-VA and LyNA1 still robustly activated whole-endolysosome ITPC2 (Figure 3A and B and Figure 3—figure supplement 1A and B). Lysosomal PI(3,5)P2 may play a permissive role in TPC activation in intact cells (Ruas et al., 2015). Much dramatic LyNa-VA activation was seen in the presence of a low concentration of PI(3,5)P2 (50 nM; Figure 3C and D and Figure 3—figure supplement 1C), and this synergism was nearly abolished in TPC2K204A mutant channels (Figure 3C and D). In contrast, an additive but not synergistic activation was observed between LyNA1 and PI(3,5)P2 (Figure 3—figure supplement 1D and E).
Figure 3.

Synergistic activation of TPC2 channels by TCAs and PI(3,5)P2.

(A) The effects of PI(3,5)P2 (0.3 µM) and LyNa-VA1.2 (100 µM) on whole-endolysosome I in TPC2K204A-transfected HEK293 cells (She et al., 2019). (B) Comparison effects of LyNa-VA1.2 and PI(3,5)P2 on WT and PI(3,5)P2-insensitive K204A (She et al., 2019) mutant TPC2 channels (also see Figure 3—figure supplement 1). (C) The synergistic effects of PI(3,5)P2 (50 nM) and LyNa-VA1.1 on whole-endolysosome I and I currents. Data are presented as Mean ± S.E.M (n = 3 patches). (D) The summary of EC50 of LyNa-VA1.1 with or without PI(3,5)P2 for WT and K204A mutant TPC2 channels. (E, F) Co-application of PI(3,5)P2 (0.3 µM) and LyNa-VA1.1 (50 µM) activated whole-endolysome ITPC in WT (E) but not TPC1/2 DKO (F) HAP1 cells. Note that the endogenous TPCs were more difficult to activate compared to overexpressed TPCs. (G) Summary of LyNa-VA1.1 effects on whole-endolysome I in WT and TPC1/2 DKO cells. For panels B, D and F, individual data and Mean ± S.E.M are presented. *, p<0.05; **, p<0.01; ***, p<0.001; N.S., no significance. Individual data for (B–D) and (G) are presented in Figure 3—source data 1.

(A) The effects of PI(3,5)P2 (0.3 µM) and LyNa-VA1.2 (100 µM) on whole-endolysosome ITPC2 in TPC2-transfected Cos1 cells. (B) Whole-cell ITPC2-K204A activated by LyNa-VA1.2 and LyNA1 in TPC2K204A-transfected HEK293 cells. (C) Synergetic effects of PI(3,5)P2 (50 nM) and LyNa-VA1.1 (30 µM) on whole-endolysosome ITPC2. (D) Additive effects of PI(3,5)P2 (50 nM) and LyNA1 (150 µM) on whole-endolysosome ITPC2. (E) Dose-dependent activation of TPC2 by LyNA1 in the presence or absence of PI(3,5)P2 (10 nM). Both individual data points and Mean ± S.E.M are presented (n ≥ 3 patches; also see individual data in Figure 3—figure supplement 1—source data 1).

Figure 3—figure supplement 1.

LyNa-VAs and LyNA1 activate TPCs independent of PI(3,5)P2.

(A) The effects of PI(3,5)P2 (0.3 µM) and LyNa-VA1.2 (100 µM) on whole-endolysosome ITPC2 in TPC2-transfected Cos1 cells. (B) Whole-cell ITPC2-K204A activated by LyNa-VA1.2 and LyNA1 in TPC2K204A-transfected HEK293 cells. (C) Synergetic effects of PI(3,5)P2 (50 nM) and LyNa-VA1.1 (30 µM) on whole-endolysosome ITPC2. (D) Additive effects of PI(3,5)P2 (50 nM) and LyNA1 (150 µM) on whole-endolysosome ITPC2. (E) Dose-dependent activation of TPC2 by LyNA1 in the presence or absence of PI(3,5)P2 (10 nM). Both individual data points and Mean ± S.E.M are presented (n ≥ 3 patches; also see individual data in Figure 3—figure supplement 1—source data 1).

Synergistic activation of TPC2 channels by TCAs and PI(3,5)P2.

(A) The effects of PI(3,5)P2 (0.3 µM) and LyNa-VA1.2 (100 µM) on whole-endolysosome I in TPC2K204A-transfected HEK293 cells (She et al., 2019). (B) Comparison effects of LyNa-VA1.2 and PI(3,5)P2 on WT and PI(3,5)P2-insensitive K204A (She et al., 2019) mutant TPC2 channels (also see Figure 3—figure supplement 1). (C) The synergistic effects of PI(3,5)P2 (50 nM) and LyNa-VA1.1 on whole-endolysosome I and I currents. Data are presented as Mean ± S.E.M (n = 3 patches). (D) The summary of EC50 of LyNa-VA1.1 with or without PI(3,5)P2 for WT and K204A mutant TPC2 channels. (E, F) Co-application of PI(3,5)P2 (0.3 µM) and LyNa-VA1.1 (50 µM) activated whole-endolysome ITPC in WT (E) but not TPC1/2 DKO (F) HAP1 cells. Note that the endogenous TPCs were more difficult to activate compared to overexpressed TPCs. (G) Summary of LyNa-VA1.1 effects on whole-endolysome I in WT and TPC1/2 DKO cells. For panels B, D and F, individual data and Mean ± S.E.M are presented. *, p<0.05; **, p<0.01; ***, p<0.001; N.S., no significance. Individual data for (B–D) and (G) are presented in Figure 3—source data 1.

LyNa-VAs and LyNA1 activate TPCs independent of PI(3,5)P2.

(A) The effects of PI(3,5)P2 (0.3 µM) and LyNa-VA1.2 (100 µM) on whole-endolysosome ITPC2 in TPC2-transfected Cos1 cells. (B) Whole-cell ITPC2-K204A activated by LyNa-VA1.2 and LyNA1 in TPC2K204A-transfected HEK293 cells. (C) Synergetic effects of PI(3,5)P2 (50 nM) and LyNa-VA1.1 (30 µM) on whole-endolysosome ITPC2. (D) Additive effects of PI(3,5)P2 (50 nM) and LyNA1 (150 µM) on whole-endolysosome ITPC2. (E) Dose-dependent activation of TPC2 by LyNA1 in the presence or absence of PI(3,5)P2 (10 nM). Both individual data points and Mean ± S.E.M are presented (n ≥ 3 patches; also see individual data in Figure 3—figure supplement 1—source data 1). Although LyNa-VAs weakly activated endogenous TPC currents, in the presence of PI(3,5)P2, more robust activation was seen (Figure 3E and G). In contrast, no measurable whole-endososome ITPC was seen in TPC1/2 DKO HAP1 cells even in the presence of both PI(3,5)P2 and LyNa-VAs (Figure 3F and G). Collectively, these results suggested that LyNa-VAs activated or modulated TPC2 via a unique, PI(3,5)P2-independent but voltage-dependent mechanism.

Voltage-dependent activation of TPC1 by TCAs

In contrast to TPC2, which produces little or no current at any potential under basal conditions, yet a large, voltage-independent conductance increases in the presence of PI(3,5)P2, TPC1 shows substantial voltage-dependent currents in the absence of any exogenous agonist (Cang et al., 2014; Guo et al., 2016). It was therefore of interest to explore whether TCAs/LyNa-VAs could also act on TPC1. To investigate this, we used two different voltage paradigms. First, when membrane voltage was stepped to various test potentials after a prolonged pre-pulse to +80 mV and the currents were compared to the basal currents, LyNa-VA1.1 produced a profound suppression of outward currents at potentials positive to Erev (~0 mV), and a substantial enhancement of inward currents negative to Erev (Figure 4A and B). Hence, upon LyNa-VA1 activation, the I-V of TPC1 completely reversed from strong outward rectification to strong inward rectification (Figure 4B and C). Intriguingly, unlike LyNa-VA1.1 and LyNa-VA1.2, which activated inward ITPC2 with EC50s within micromolar ranges, both LyNa-VA2.1 and LyNA1 inhibited ITPC1 (Figure 4D and Figure 4—figure supplement 1C). Second, we used a tail current paradigm to measure the amplitude of the peak inward current at −120 mV following prolonged steps to various potentials (Figure 4E). The effect of LyNa-VA1.1 was to shift the midpoint of activation voltage (V1/2) by −65 mV as compared to the basal condition, and to slow down the deactivation time course (Figure 4E–F).
Figure 4.

Activation of lysosomal TPC1 channels by LyNa-VAs.

(A) Whole-endolysosome TPC1 current (I) was activated by LyNa-VA1.1 (right) and elicited by a voltage step protocol (left), in which a preconditioning voltage (80 mV, 0.3 s) was applied before voltage steps starting from −140 to 100 mV (0.8 s, ∆V = 20 mV). HP = 0 mV. Unless otherwise indicated, symmetric 150 mM Na+ solutions were used for all whole-endolysosome recordings, and LyNa-VA1.1 (100 µM) was bath-applied. (B) I-V plots of basal- and LyNa-VA1.1-induced I which were recorded from the same vacuole. Dotted lines in A indicate where the currents were measured. (C) Summary of rectification index of basal and LyNa-VA1.1-induced I. Individual data and Mean ± S.E.M are presented. ***, p<0.001. (D) Does-dependent activation or inhibition of TPC1 by LyNa-VA1.1, LyNa-VA1.2, and LyNa-VA2.1. Data are presented as Mean ± S.E.M (n = 3 patches). (E) The effects of LyNa-VA1.1 on I tail currents at −120 mV. The voltage protocol that elicited I tail currents was shown in Figure 4—figure supplement 1A. (F) The effects of LyNa-VA1.1 on the G-V curves of I (n = 4–5 patches). (G) Normalized I-V plots of basal voltage-dependent currents in WT TPC1- and TPC1R540I-transfected cells. (H) The basal and LyNa-VA1.1-activated I step currents, which were recorded from the same vacuole. Individual data for (C), (D) and (F) are also presented in Figure 4—source data 1.

(A) A voltage protocol that elicited I tail currents as shown in Figure 4E (from −140 to 100 mV with a ∆V = 20 mV, 1 s with a 10 s inter-step interval). Arrows indicate where tail currents were measured. (B) A voltage protocol that elicited I tail currents as shown in C. A preconditioning voltage (+80 mV, 0.2 s) was applied before voltage steps starting from −140 to 100 mV (1.3 s, ∆V = 20 mV). HP = 0 mV. (C) In comparison to the basal I (right), LyNA1 (150 µM) inhibited (left) I.

(A) Basal whole-endolysosome I (left) or I (right) was elicited by voltage steps (−140 to +100 mV with ΔV = 20 mV) in the absence of PI(3,5)P2 in TPC1-transfected Cos1 cells (She et al., 2019). Tail currents were elicited at −120 mV. (B) The effects of PI(3,5)P2 (0.3 µM) on I (left) and I (right) step currents. (C) I-V plots of steady-state I and I step currents shown in B. (D) LyNa-VA1.2-induced whole-endolysosome I was evoked by a voltage ramp from −120 to +120 mV (duration = 200 ms). (E) The basal (right), LyNa-VA1.2 (200 µM)- (middle) and PI(3,5)P2 (0.3 µM)- (left) activated lysosomal I were recorded from the same vacuole. A preconditioning voltage (+80 mV, 0.1 s) was applied before voltage steps starting from −140 to 100 mV (0.5 s, ∆V = 20 mV). HP = 0 mV.

Figure 4—figure supplement 1.

Inhibition of lysosomal TPC1 channels by LyNA-1.

(A) A voltage protocol that elicited I tail currents as shown in Figure 4E (from −140 to 100 mV with a ∆V = 20 mV, 1 s with a 10 s inter-step interval). Arrows indicate where tail currents were measured. (B) A voltage protocol that elicited I tail currents as shown in C. A preconditioning voltage (+80 mV, 0.2 s) was applied before voltage steps starting from −140 to 100 mV (1.3 s, ∆V = 20 mV). HP = 0 mV. (C) In comparison to the basal I (right), LyNA1 (150 µM) inhibited (left) I.

Activation of lysosomal TPC1 channels by LyNa-VAs.

(A) Whole-endolysosome TPC1 current (I) was activated by LyNa-VA1.1 (right) and elicited by a voltage step protocol (left), in which a preconditioning voltage (80 mV, 0.3 s) was applied before voltage steps starting from −140 to 100 mV (0.8 s, ∆V = 20 mV). HP = 0 mV. Unless otherwise indicated, symmetric 150 mM Na+ solutions were used for all whole-endolysosome recordings, and LyNa-VA1.1 (100 µM) was bath-applied. (B) I-V plots of basal- and LyNa-VA1.1-induced I which were recorded from the same vacuole. Dotted lines in A indicate where the currents were measured. (C) Summary of rectification index of basal and LyNa-VA1.1-induced I. Individual data and Mean ± S.E.M are presented. ***, p<0.001. (D) Does-dependent activation or inhibition of TPC1 by LyNa-VA1.1, LyNa-VA1.2, and LyNa-VA2.1. Data are presented as Mean ± S.E.M (n = 3 patches). (E) The effects of LyNa-VA1.1 on I tail currents at −120 mV. The voltage protocol that elicited I tail currents was shown in Figure 4—figure supplement 1A. (F) The effects of LyNa-VA1.1 on the G-V curves of I (n = 4–5 patches). (G) Normalized I-V plots of basal voltage-dependent currents in WT TPC1- and TPC1R540I-transfected cells. (H) The basal and LyNa-VA1.1-activated I step currents, which were recorded from the same vacuole. Individual data for (C), (D) and (F) are also presented in Figure 4—source data 1.

Inhibition of lysosomal TPC1 channels by LyNA-1.

(A) A voltage protocol that elicited I tail currents as shown in Figure 4E (from −140 to 100 mV with a ∆V = 20 mV, 1 s with a 10 s inter-step interval). Arrows indicate where tail currents were measured. (B) A voltage protocol that elicited I tail currents as shown in C. A preconditioning voltage (+80 mV, 0.2 s) was applied before voltage steps starting from −140 to 100 mV (1.3 s, ∆V = 20 mV). HP = 0 mV. (C) In comparison to the basal I (right), LyNA1 (150 µM) inhibited (left) I.

Voltage-dependence and PI(3,5)P2-sensitivity of R540I mutant TPC1 channels.

(A) Basal whole-endolysosome I (left) or I (right) was elicited by voltage steps (−140 to +100 mV with ΔV = 20 mV) in the absence of PI(3,5)P2 in TPC1-transfected Cos1 cells (She et al., 2019). Tail currents were elicited at −120 mV. (B) The effects of PI(3,5)P2 (0.3 µM) on I (left) and I (right) step currents. (C) I-V plots of steady-state I and I step currents shown in B. (D) LyNa-VA1.2-induced whole-endolysosome I was evoked by a voltage ramp from −120 to +120 mV (duration = 200 ms). (E) The basal (right), LyNa-VA1.2 (200 µM)- (middle) and PI(3,5)P2 (0.3 µM)- (left) activated lysosomal I were recorded from the same vacuole. A preconditioning voltage (+80 mV, 0.1 s) was applied before voltage steps starting from −140 to 100 mV (0.5 s, ∆V = 20 mV). HP = 0 mV. The S4 segments of TPC1 and TPC2 contain several positively-charged AA residues, which were believed to serve as voltage sensors in mediating TPC1- but not TPC2-specific activation (She et al., 2018). It was recently reported that the R540I mutation, which removes a positive charge in the second putative voltage-sensing ‘S4-type’ helix, abolished TPC1 activation by membrane depolarization (She et al., 2018). However, in our hands, depolarization still robustly activated voltage-dependent currents in the whole-endolysosomes of hTPC1R540I -expressing cells (Figure 4G and H). When LyNa-VA1.1 was tested on endolysosomes overexpressing TPC1R540I, there was also a dramatic enhancement of inward currents at negative potentials indicative of a substantial negative shift in the V1/2 of voltage activation (Figure 4H). Finally, when exposed to PI(3,5)P2, ITPC1 showed a large enhancement at negative potentials indicative of a negative shift in the V1/2 of activation, while TPC1R540I -positive endolysosomes showed large currents at all potentials (Figure 4—figure supplement 2A, B and C). The charge-introducing mutation at Ile551 of TPC2 (She et al., 2019), the equivalent site of TPC1R540, conferred a voltage-dependence to the mutant channel but failed to affect LyNa-VA1.2 activation (Figure 4—figure supplement 2D and E). Put together, these results suggested that whereas the S4 voltage-sensing domains may play a modulatory role, there exist intrinsic or extrinsic voltage-sensing mechanisms elsewhere responsible for the voltage-dependent gating of TPCs.
Figure 4—figure supplement 2.

Voltage-dependence and PI(3,5)P2-sensitivity of R540I mutant TPC1 channels.

(A) Basal whole-endolysosome I (left) or I (right) was elicited by voltage steps (−140 to +100 mV with ΔV = 20 mV) in the absence of PI(3,5)P2 in TPC1-transfected Cos1 cells (She et al., 2019). Tail currents were elicited at −120 mV. (B) The effects of PI(3,5)P2 (0.3 µM) on I (left) and I (right) step currents. (C) I-V plots of steady-state I and I step currents shown in B. (D) LyNa-VA1.2-induced whole-endolysosome I was evoked by a voltage ramp from −120 to +120 mV (duration = 200 ms). (E) The basal (right), LyNa-VA1.2 (200 µM)- (middle) and PI(3,5)P2 (0.3 µM)- (left) activated lysosomal I were recorded from the same vacuole. A preconditioning voltage (+80 mV, 0.1 s) was applied before voltage steps starting from −140 to 100 mV (0.5 s, ∆V = 20 mV). HP = 0 mV.

Cationic ion selectivity of TPC2 is not altered by LyNa-VAs and LyNA1

The selectivity filter region in an ion channel is responsible for the selective permeability to one or more ions (Yu and Catterall, 2004). However, it was recently reported that AA residues below the selectivity filter may mediate activation gating of multiple K+ channels by small-molecule agonists (Schewe et al., 2019). In addition, some voltage sensitivity can be conferred when the permeable ions move through the selectivity filter (Schewe et al., 2016). We therefore tested whether TCAs/LyNa-VAs bind to the selectivity filer. Like PI(3,5)P2-activated ITPC2 (Figure 5A–C and K), LyNa-VA1.2- and LyNA1-induced whole-endolysosome ITPC2 was highly selective for Na+ over K+, as substitution of bath/cytoplasmic Na+ with K+ significantly shifted Erev to more positive values (Figures 1H, 5D–F and K and Figure 2—figure supplement 1B). Meanwhile, LyNa-VA1.2- and LyNA1-activated ITPC2 still exhibited low Ca2+ permeability (Figure 5G and K and Figure 5—figure supplement 1A), and the PCa/PNa values were similar to those for PI(3,5)P2-activated ITPC2 (Wang et al., 2012) (Figure 5K and Figure 5—figure supplement 1B). Finally, the N653G mutation, which is known to significantly increase the relative K+ permeability of the TPC2 channel (Guo et al., 2017), did not alter the ability of LyNa-VA1.2 to enhance channel activation, but did result in currents elicited by LyNa-VA1.2 that had a much increased relative permeability to K+ (Figure 5I–K). Taken together, these results indicate that the selectivity filter region does not mediate the action of TCAs.
Figure 5.

LyNa-VAs do not change the cationic selectivity of TPC2 channels.

(A) Representative PI(3,5)P2-evoked whole-endolysosome I elicited by a voltage ramp from −120 to 120 mV. The recordings were performed under a bi-ionic condition with 150 (in mM) Na+ in the pipette solution and 150 Na+ or 150 K+ in the bath solution. PI(3,5)P2 (0.3 µM) was bath-applied. (B, C) Representative PI(3,5)P2- evoked I elicited with voltage steps (−140 mV to 100 mV with a ∆V = 20 mV, 0.5 s) with 150 mM Na+ (B) or K+(C) in the bath solution. (D, E) Representative LyNa-VA1.2-activated I step currents. (F) Representative I-V plots of LyNa-VA1.2- activated I measured from the instantaneous currents in (D) and (E). Note the reversal potentials (Erev) of LyNa-VA1.2- activated I in the presence of Na+ or K+ bath solution. (G) LyNa-VA1.2- activated I under the bi-ionic conditions of bath/cytosolic Na+ and pipette/luminal Ca2+. 150 Na+ solution contained (in mM) 145 NaCl, 5 NaOH, 20 HEPES, (pH 7.2); isotonic (105 mM) Ca2+ solution contained (in mM) 100 CaCl2, 5 Ca(OH)2, 20 HEPES (pH 7.2). Right panel zoom-in micrograph shows the Erev of LyNa-VA1.2- activated I. (H–J) Representative I-V plots of LyNa-VA1.2- evoked I (J) measured from Na+ (H) and K+ (I) bath solution. (K) Summary of Na+ vs. K+ /Ca2+ selectivity of WT TPC2 and TPC2N653G channels. Individual data and Mean ± S.E.M are presented (also see Figure 5—source data 1). N.S., no significance.

(A) LyNA1 (300 µM)- activated whole-cell I under the bi-ionic conditions (in mM), that is pipette/cytosolic 150 Na+ and bath/extracellular 150 Na+, 150 K+ or 105 Ca2+. Right panel: zoom-in micrograph shows the Erev changes of I with different bath solutions. (B) Summary of cationic selectivity values for LyNA1-induced I. Both individual data points and Mean ± S.E.M are presented (see individual data in Figure 5—figure supplement 1—source data 1).

Figure 5—figure supplement 1.

LyNA1 does not change the Na+ selectivity of TPC2 channels.

(A) LyNA1 (300 µM)- activated whole-cell I under the bi-ionic conditions (in mM), that is pipette/cytosolic 150 Na+ and bath/extracellular 150 Na+, 150 K+ or 105 Ca2+. Right panel: zoom-in micrograph shows the Erev changes of I with different bath solutions. (B) Summary of cationic selectivity values for LyNA1-induced I. Both individual data points and Mean ± S.E.M are presented (see individual data in Figure 5—figure supplement 1—source data 1).

LyNa-VAs do not change the cationic selectivity of TPC2 channels.

(A) Representative PI(3,5)P2-evoked whole-endolysosome I elicited by a voltage ramp from −120 to 120 mV. The recordings were performed under a bi-ionic condition with 150 (in mM) Na+ in the pipette solution and 150 Na+ or 150 K+ in the bath solution. PI(3,5)P2 (0.3 µM) was bath-applied. (B, C) Representative PI(3,5)P2- evoked I elicited with voltage steps (−140 mV to 100 mV with a ∆V = 20 mV, 0.5 s) with 150 mM Na+ (B) or K+(C) in the bath solution. (D, E) Representative LyNa-VA1.2-activated I step currents. (F) Representative I-V plots of LyNa-VA1.2- activated I measured from the instantaneous currents in (D) and (E). Note the reversal potentials (Erev) of LyNa-VA1.2- activated I in the presence of Na+ or K+ bath solution. (G) LyNa-VA1.2- activated I under the bi-ionic conditions of bath/cytosolic Na+ and pipette/luminal Ca2+. 150 Na+ solution contained (in mM) 145 NaCl, 5 NaOH, 20 HEPES, (pH 7.2); isotonic (105 mM) Ca2+ solution contained (in mM) 100 CaCl2, 5 Ca(OH)2, 20 HEPES (pH 7.2). Right panel zoom-in micrograph shows the Erev of LyNa-VA1.2- activated I. (H–J) Representative I-V plots of LyNa-VA1.2- evoked I (J) measured from Na+ (H) and K+ (I) bath solution. (K) Summary of Na+ vs. K+ /Ca2+ selectivity of WT TPC2 and TPC2N653G channels. Individual data and Mean ± S.E.M are presented (also see Figure 5—source data 1). N.S., no significance.

LyNA1 does not change the Na+ selectivity of TPC2 channels.

(A) LyNA1 (300 µM)- activated whole-cell I under the bi-ionic conditions (in mM), that is pipette/cytosolic 150 Na+ and bath/extracellular 150 Na+, 150 K+ or 105 Ca2+. Right panel: zoom-in micrograph shows the Erev changes of I with different bath solutions. (B) Summary of cationic selectivity values for LyNA1-induced I. Both individual data points and Mean ± S.E.M are presented (see individual data in Figure 5—figure supplement 1—source data 1).

Discussion

In this study, we report that the voltage dependence, generally thought to be an intrinsic property of an ion channel (Catterall, 2010; Yu and Catterall, 2004), can be conferred or unmasked by extrinsic agonists in lysosomal TPC channels. What is the origin of agonist-conferred voltage-dependence in the otherwise voltage-independent TPC2 channel? It is possible that the S4 voltage sensors, which are operational in TPC1, might be ‘exposed’ upon agonist binding. Alternatively, another unidentified ‘hidden’ intrinsic voltage sensor might be revealed upon agonist binding, a possibility that was supported by the negative results in our targeted mutational analyses of the S4 regions. Additionally, it is recently reported that permeant ions may contribute to the channel’s voltage-dependence (Schewe et al., 2019). Hence, it is an attractive hypothesis that a gate at the selectivity filter is the molecular target of TCAs to mediate the observed voltage-dependence. However, it remains unknown whether such a ‘selectivity filter gate’, extensively studied in several other ion channels including CNG channels (Contreras et al., 2008), does exist in TPC channels. Nevertheless, although mutational analyses in the selectivity filter or the ‘S6 gate’ (data not shown) do not seem to affect LyNa-VA activation, given the limitations of targeted mutations, future high-resolution structural studies may be necessary to reveal the TCA-binding sites in the TPC channels, explaining the conferred voltage dependence by TCAs. In addition, the differential effects of LyNa-VAs on TPC1 and TPC2 may also help design future structural-functional studies to reveal the action site of TCAs on TPCs. Diverse functions have been associated with TPC channels, largely based on genetic manipulations (e.g. KO, knockdown, overexpression) (Grimm et al., 2017; Xu and Ren, 2015). However, the roles of TPCs in some of the proposed functions might be indirect based on the following reasons. First, lysosomal membrane trafficking, for example fusion and fission, has been difficult to study as these functions are interconnected. For instance, a block in membrane fusion may often indirectly affect membrane fission, and vice versa (Xu and Ren, 2015). In addition, defects in lysosomal membrane trafficking may also affect lysosomal degradation, and degradation products may in turn regulate membrane trafficking (Xu and Ren, 2015). Second, compensatory changes occur commonly in the genetically-manipulated cells, for example KO or lysosome storage disease (LSD) cells. Hence, it is necessary to develop methods to acutely activate and inhibit lysosomal channels, so that immediate cellular actions of TPC activation can be revealed. Notably, precisely defining TPC’s roles in lysosomal Δψ regulation may require real-time monitoring of lysosomal Δψ while acutely activating or inhibiting lysosomal K+ and Na+ channels (Li et al., 2019). The identification of membrane-permeable small-molecule TPC agonists has made it feasible for such studies. TCAs are known to regulate autophagy and lysosome function, but underlying mechanisms are not clear (Tsvetkov et al., 2010). For example, in a neuronal model of Huntington disease (HD), TCAs were shown to be neuroprotective by inducing the clearance of misfolded protein aggregates (Tsvetkov et al., 2010). Given the proposed roles of TPCs in autophagy and lysosomal membrane trafficking (Grimm et al., 2017; Li et al., 2019), it is likely some of the effects associated with TCAs are mediated by TPCs. The concentrations of TCAs that activate autophagy are lower than those activating TPC channels in the current study (Beckmann et al., 2014; Cheng and Bahar, 2019). However, TCAs, as lysosomotropic compounds, are known to accumulate at high concentrations in the lysosomes (Beckmann et al., 2014). In addition, the synergistic effects of TCAs with endogenous ligand, for example PI(3,5)P2, suggest that the exposure level of TCAs in the brain might be sufficient to cause robust pharmacological actions, much more potently than the efficacies defined in our channel assays. Future cell biological studies utilizing TCAs with TPC KO as negative controls may confirm whether TCAs modulate autophagy and lysosome function through activation of TPCs.

Materials and methods

Molecular biology

All TPC1 and TPC2 mutants were generated with a site-directed mutagenesis kit (Qiagen) using EGFP- human TPC1 and TPC2 as the templates. All constructs were confirmed by DNA sequencing.

Mammalian cell lines

Cos1 (ATCC, CRL-1650, passage number 8–15) and HEK293 (ATCC, CRL-1573, passage number 8–15) cells were cultured in DMEM with 10% fetal bovine serum (FBS). HAP1 (Horizon Discovery, human HAP1 parental cell line, passage number 5–15) cells were maintained in IMDM with 10% FBS. Immortalized cell lines (Cos1, HEK293 and HAP1) were cultured following standard tissue culture protocols, and were tested negative for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit Assay (Lonza). HEK293 cells are on the list of frequently misidentified or cross-contaminated cell lines, but were only used for the overexpression experiments. Cells were transfected with Lipofectamine 2000 (Invitrogen). After culture media were refreshed 18–24 hr post-transfection, cells were used for the electrophysiological assays 24–36 hr post-transfection.

TPC1/TPC2 DKO HAP1 cells

TPC1 and TPC2 CRISPR KO cells were generated in HAP1 cells using the CRISPR/Cas9 system. The TPC1 sequence (5'cttgcagtacttcagcaccc3', TPC1-sgRNA) and TPC2 sequence (5'ccccagcgtcgggctgctgc3', TPC2-sgRNA) were targeted with pSpCas9 (BB)−2A-puro vector (Addgene). HAP1 cells were co-transfected with TPC1 and TPC2-sgRNA expressing vector in the presence of Lipofectamine 2000 (In vitrogen) and selected with 2 μg/ml puromycin for 48 hr. The remaining cells were trypsinized and seeded into 96-well plate after a limiting dilution. When single cell clones were established, their genomic DNAs were extracted and amplified with following primers: TPC1-fw: 5’atggcccagacatgtgactc3’, TPC1-re: 5’ tgcctgtctccatcctctca3’; TPC2-fw: 5’tgagctgagcatgaggcaag3’, TPC2-re: 5’ aaaggacaagtggccctgag3’. The PCR amplicons were then sequenced to confirm the intended genetic disruption. The TPC1/TPC2 DKO cells harboring an insert of one nucleotide (A) in the TPC1 sequence and a deletion of ten nucleotides in the TPC2 sequence, respectively, were used in the present study.

LOPAC high-throughput screening

Ca2+ imaging-based HTS using the Library of Pharmacologically Active Compounds (LOPAC)1280 collection (Sigma) was conducted as described previously (Liu et al., 2010). Briefly, HEK293 cells stably expressing TPC2 and TRPML1 were loaded with a Ca2+ detection dye (Fluo-4). The kinetic of Ca2+ flux was measured using a kinetic plate reader FDSS-7000 (Liu et al., 2010). The FDSS-7000 had an on-board 1536 pintool that was used to transfer 23 nl of a compound to the assay plate (Liu et al., 2010). All of the compounds were dissolved in 100% DMSO. Hence, transferring 23 nl of a compound to a well containing 5 μl of the culture medium would result in a final concentration of DMSO of ~0.5%. The final concentrations of the LOPAC compounds in each were 0.003, 0.015, 0.074, 0.37, 1.84, 9.2, and 46 μM, respectively. Compounds that were positive in the TPC2 assay, but not in the TRPML1 assay, were considered to be positive hits for potential TPC2 agonists.

Whole-cell electrophysiology

Whole-cell recordings were performed using pipette electrodes with resistance of 3–5 MΩ. Unless otherwise stated, both pipette and bath solutions contained (in mM): 145 NaOH, 5 NaCl, 20 HEPES, pH 7.2 (adjusted with methanesulfonic acid). All bath solutions were applied via a perfusion system that allowed complete solution exchange within a few seconds. Data were collected using an Axopatch 200A patch clamp amplifier, Digidata 1440, and pClamp 10.2 software (Axon Instruments). Whole-cell currents were digitized at 10 kHz and filtered at 2 kHz. All experiments were conducted at room temperature (21–23°C), and all recordings were analyzed with pClamp 10.2, and Origin 8.0 (OriginLab, Northampton, MA).

Whole-endolysosome electrophysiology

Endolysosomal electrophysiology was performed in isolated enlarged endolysosomes using a modified patch-clamp method (Dong et al., 2010). Cells were treated with 1 μM vacuolin-1, a lipid-soluble polycyclic triazine that can selectively increase the size of endosomes and lysosomes (Huynh and Andrews, 2005), for at least 1 hr and up to 12 hr. Whole-endolysosome recordings were performed on manually isolated enlarged endolysosomes (Wang et al., 2012). In brief, a patch pipette was pressed against a cell and quickly pulled away to slice the cell membrane. Enlarged endolysosomes were released into a dish and identified by monitoring EGFP-TPC1/2 or the mCherry-TPC1/2 fluorescence. After formation of a gigaseal between the patch pipette and the enlarged endolysosome, capacitance transients were compensated. Voltage steps of several hundred mVs with millisecond duration were then applied to break into the vacuolar membrane. The whole-endolysosome configuration was verified by the re-appearance of capacitance transients after break-in. Unless otherwise stated, both bath (internal/cytoplasmic) and pipette solutions contained (in mM): 145 NaOH, 5 NaCl, 20 HEPES, pH 7.2 (adjusted with methanesulfonic acid). 150 K+ solution contained (in mM): 145 KOH, 5 KCl, 20 HEPES, pH 7.2 (adjusted with methanesulfonic acid). Data were collected using an Axopatch 200A patch clamp amplifier, Digidata 1440, and pClamp 10.2 software (Axon Instruments). Whole-endolysosome currents were digitized at 10 kHz and filtered at 2 kHz. All experiments were conducted at room temperature (21–23°C), and all recordings were analyzed with pClamp 10.2, and Origin 8.0 (OriginLab, Northampton, MA). The permeability to cations (relative to PNa) was estimated based on following equations (Lewis, 1979) and Erev measurement under bi-ionic conditions:where R, T, F, Erev, and γ are, respectively, the gas constant, absolute temperature, Faraday constant, reversal potential, and activity coefficient. The liquid junction potentials were measured and corrected as described (Neher, 1992).

Data analysis

Data are presented as the mean ± standard error of the mean (S.E.M). Statistical comparisons were made using analysis of variance (ANOVA). A p value < 0.05 was considered statistically significant. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses. Acceptance summary: The function of lysosomes is more and more being linked to several important normal and pathological physiological states. Several of these functions are linked to ion transport mechanisms mediated by ion channels that are not completely understood. In this manuscript, the authors have identified small-molecule agonist for the lysosomal two-pore channels, TPC1 and TPC2. Strikingly these agonist are tricyclic compounds that have traditionally been used as antidepressants. This is a clear example of re-purposing of clinically-relevant compounds and it also open the window to understanding secondary effects of these drugs that cannot be explained by their classically described actions. Lysosomal ion channels are notoriously difficult to study, given their location and poorly characterized biophysical properties. The findings in this manuscript also suggest that these compounds could help identify drug-specific modes of activation in two-pore channels. Given the growing recognition of the importance of lysosomes in several diseases, this findings are of general interest to clinicians and basic scientist alike. The compounds identified and initially characterized here should make the task of understanding the physiology of TPC1 and TPC2 channels a little easier. Decision letter after peer review: Thank you for submitting your article "Agonist-specific voltage-dependent gating of lysosomal two-pore Na+ channels" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Leon D Islas as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Richard Aldrich as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Shmuel Muallem (Reviewer #2); Tinatin Brelidze (Reviewer #3). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. Summary: The paper by the Xu group describes the novel finding that tricyclic anti-depressants, a major class of clinically relevant drugs, also behave as activators of the two-pore, Na-selective lysosomal ion channels TPC1 and TPC2. The authors show that these drugs induce voltage-dependent and voltage-independent modes of activation of these channels. These findings are relevant because they provide a possible new framework for the development of new TPC-selective activators (and possibly, inhibitors) with increased potency. These drugs offer the possibility of having an increased toolset for the study of these class of channels and open the door for understanding side effects and off-target effects of tricyclic anti-depressants. The reviewers are very enthusiastic about the manuscript and offer the following comments that the authors should attend. Major comments: 1) While the authors showed that the effect is specific to TPC channels the effect may not be direct and might be mediated by a signaling cascade. This could be determined by recording currents from excised patches in the absence and presence of the agonists. In addition, the comparison of the time-course of activation for inside-out and whole cell or outside-out patches may suggest if the agonist binding site is extracellular or intracellular. 2) For pharmacological comparisons it would be useful to determine the EC50 for TPC1 and at least a few of the identified agonists. 3) Figure 3C could be strengthened by including dose-response data for K204 mutant. It is conceivable that the agonists might activate or expose additional PIP2 sites, distinct from the one destabilized by the K204A mutation. The dose-response experiments might reveal this possibility. 4) The effect of Riluzole is also very interesting and could be considered in more depth. The authors have not described the effect of Riluzole on TPC1 channels. Is it still voltage-independent? It is important to know if the mechanism of this agonist action is similar in the two channels, as it might help in identifying the molecular determinants of the effect. It also would be of interest to investigate the effect of Riluzole on TPC2 and R540I TPC1 mutant channels in the presence of PIP2. Both agonists show linear activation with voltage and therefore there is a possibility that they might be competitive. 5) Since the hTPC2 currents activated by TCAs are so different (Figure 2C), the possibility exists that channels other than TPC2 mediate these currents. The authors should endeavor to show that an hTPC2-specific blocker also blocks TCA-activated currents. 6) In the subsection “Cationic ion selectivity of TPC2 is not altered by LyNa-Vas”, the authors make the argument that to probe if TCAs bind to the selectivity filter, they investigate possible changes in ion selectivity. They find that there are no changes in selectivity in the presence of TCAs and therefore these drugs do not bind at the selectivity filter. This argument is flawed; there is no reason to think that a drug binding in or near the selectivity filter necessarily alters the selectivity to ions. 7) Further, the authors mention a "selectivity gate" do they mean "gate at the selectivity filter"? If so, there is no evidence that TPC channel's gating occurs at the selectivity filter, like in CNG cation channels. It is sometimes wrongly assumed that all ions have gating at a bundle crossing (S6 gate) and at the selectivity filter. 8) The last paragraph of the Discussion presents some discussion of the possible consequences of this newly described interaction between TCAs and lysosomal cation channels, however, there is no discussion of the possible mechanism of voltage-dependent gating induced in TPC channels and this is a major point of the manuscript. 9) In Figure 1E, it is surprising that the magnitude of the currents is so similar between cells to have the size of errors presented. Surely there should be a large variability in the levels of expression. Please present all comparisons between currents as normalized current density (current/capacitance). Although the reviewers found our work interesting, they have made several specific suggestions to improve the paper. To address the reviewers’ concerns, we have performed a number of new experiments. The most significant changes are highlighted in the summary paragraphs below, and all other concerns are addressed in the point-by-point response. First, in response to the reviewers’ suggestions, we performed additional new experiments to systematically investigate the effects of LyNA1 (the voltage-independent synthetic agonist) on both TPC1 and TPC2 channels, especially regarding the ion selectivity and synergistic activation with PI(3,5)P2. Unlike LyNa-VAs (the voltage-dependent synthetic agonists), LyNA1 activated TPC2 currents (ITPC2) in a voltage-independent manner (Figure 2D, 2E) through an additive but not synergistic mechanism to PI(3,5)P2 (new Figure 3—figure supplement 1D, E). In contrast, ITPC1 was inhibited by LyNA1 (new Figure 4—figure supplement 1B). Neither LyNa-VAs nor LyNA1 affected the Na+-selectivity of TPC channels (Figure 5K and new Figure 5—figure supplement 1). Hence, LyNA1 and LyNa-VAs modulate TPCs via distinct mechanisms. Second, based on the reviewers’ suggestions, we explored the possible action site of LyNa-VAs by comparing the time course of activation in three different patch configurations: whole-cell (i.e., extracellular agonist application), inside-out (intracellular agonist application), and whole-endolysosome (intracellular agonist application). As channel activation in the whole-cell configuration was significantly slower, i.e., longer latency and time constant of activation, in comparison to cytosolic applications under the inside-out and whole-endolysosome configurations (see new Figure 1—figure supplement 2), the action site of LyNa-VAs is likely to be either intracellular or more accessible from the intracellular side. Third, the reviewers asked us to examine the effects of multiple LyNa-VAs on TPC1 and various mutant TPC2 channels, including I551R, the presumed voltage-sensor mutation (She et al., 2018), and K204A, the PI(3,5)P2-binding-site mutation (She et al., 2019). We found that whereas both LyNa-VA1.1 and LyNa-VA1.2 activated TPC1, LyNa-VA2.1 instead inhibited TPC1 (new Figure 4D). Additionally, the I551R mutation, which converted TPC2 into a voltage-dependent outward-rectifying TPC1-like channel (She et al., 2018), failed to affect the voltage-dependent activation of inwardly-rectifying currents by LyNa-VAs (new Figure 4—figure supplement 2D-E). Furthermore, the lack of a synergistic effect between LyNa-VAs and PI(3,5)P2 on TPC2K204A currents (new Figure 3C, 3D) suggested that Lys204 is the primary PI(3,5)P2-binding site. Collectively, the results obtained from these additional experiments have significantly strengthened the major conclusion of the paper: LyNa-VAs bind to activate TPCs via a voltage-dependent mechanism independent of PI(3,5)P2. Major comments: 1) While the authors showed that the effect is specific to TPC channels the effect may not be direct and might be mediated by a signaling cascade. This could be determined by recording currents from excised patches in the absence and presence of the agonists. In addition, the comparison of the time-course of activation for inside-out and whole cell or outside-out patches may suggest if the agonist binding site is extracellular or intracellular. Based on the reviewer’s suggestion, we performed inside-out patch-clamp recordings in TPC2LL/AA-expressing HEK293 cells. Robust activation was seen in these cell-free excised patches (Figure 1—figure supplement 2), as well as in (cell-free) whole-endolysosome patches, suggesting that the effects of LyNa-VAs are most likely to be direct. As mentioned in the summary paragraphs (Experiment #2), LyNa-VAs activated ITPC2 significantly faster (i.e., with shorter latency and smaller activation time-constant) in the inside-out and whole-endolysosome patches (Figure 1—figure supplement 2C and D) comparted with whole-cell recordings, suggesting that the agonist binding site is likely to be intracellular. 2) For pharmacological comparisons it would be useful to determine the EC50 for TPC1 and at least a few of the identified agonists. We have conducted the dose-dependent studies to show that whereas LyNa-VA1.1 and LyNa-VA1.2 activated whole-endolysosomeITPC1 with an EC50 of 27 ± 2 µM (n=3 patches) and 10 ± 1 µM (n=3), respectively, LyNa-VA2.1 inhibited ITPC1 (IC50 = 77 ± 2 µM, n=3; see Figure 4D). Also see Experiment #3 in the summary paragraphs. 3) Figure 3C could be strengthened by including dose-response data for K204 mutant. It is conceivable that the agonists might activate or expose additional PIP2 sites, distinct from the one destabilized by the K204A mutation. The dose-response experiments might reveal this possibility. We agree with the reviewer and have examined the dose-dependent responses of TPC2K204A in the presence and absence of PI(3,5)P2. Unlike wild-type (WT) channels, PI(3,5)P2 had little or no effect on the LyNa-VA dose-response of the TPC2K204A channel (new Figure 3C and D), suggesting that Lys204 is essential for PI(3,5)P2 binding in TPC2 (She et al., 2019) in the presence and absence of LyNa-VAs. 4) The effect of Riluzole is also very interesting and could be considered in more depth. The authors have not described the effect of Riluzole on TPC1 channels. Is it still voltage-independent? It is important to know if the mechanism of this agonist action is similar in the two channels, as it might help in identifying the molecular determinants of the effect. It also would be of interest to investigate the effect of Riluzole on TPC2 and R540I TPC1 mutant channels in the presence of PIP2. Both agonists show linear activation with voltage and therefore there is a possibility that they might be competitive. Whereas TPC2 was activated by Riluzole (LyNA1) with an EC50 of 181 ± 6 µM (Figure 3—figure supplement 1E), TPC1 was, intriguingly, inhibited by Riluzole at the concentration of 150 µM (Figure 4—figure supplement 1C). Since the inhibition appeared to be voltage-independent (Figure 4—figure supplement 1C), we did not further study the Riluzole effect on TPC1R540I. On the other hand, although both PI(3,5)P2 and Riluzole are agonists of TPC2, PI(3,5)P2 did not further increase the potency of Riluzole (EC50 = 175 ± 19 µM) on ITPC2 (Figure 3—figure supplement 1E). Additionally, Riluzole activation was intact in TPC2K204A channels (Figure 3—figure supplement 1B). Therefore, Riluzole and PI(3,5)P2 may activate TPC2 channels via distinct voltage-independent mechanisms. 5) Since the hTPC2 currents activated by TCAs are so different (Figure 2C), the possibility exists that channels other than TPC2 mediate these currents. The authors should endeavor to show that an hTPC2-specific blocker also blocks TCA-activated currents. We addressed the reviewer’s concern on this by conducting several control experiments. First, we used a pharmacological approach to show that TCA-activated currents were inhibited by our unpublished, TPC-specific small-molecule inhibitor (LyNI-1; Lysosomal Na+ channel Inhibitor 1; see Author response image 1). Note that Ned-19 and Tetrandine, two reported TPC blockers (Sakurai et al., 2015), are at best very weak inhibitors of ITPC in our hands (Author response image 1). Likewise, verapamil, a blocker that we reported previously, had very weak inhibitory effects on the inward currents of TPC2 (Wang et al., 2012). We will report the characterization work of LyNI-1 in a separate study focusing on the cell biological roles of TPC2. Second, we used a genetic approach to show that TCA-activated whole-endolysosome currents were present in WT, but not TPC1/2 DKO HAP1 cells (Figure 3E and F). Third, TCA-activated whole-cell currents were only detected in TPC2LL/AA-transfected, but not non-transfected HEK293 cells (Figure 1C and D). Fourth, TCA-activated currents had nearly identical PK/PNa values compared with PI(3,5)P2-activated TPC2 currents (Figure 5), and the N653G mutation decreased the Na+-selectivity of both TCA- and PI(3,5)P2-activated TPC currents (Figure 5 andFigure 5—figure supplement 1). Taken together, these results suggest that TCA-induced currents are mediated by TPC2.
Author response image 1.

LyNa-VA-induced currents are inhibited by LyNI-1, a small-molecule TPC2 inhibitor.

(A) Dose-dependent inhibition of LyNI-1 on PI(3,5)P2 (0.1 µM)-induced whole-endolysosome ITPC2 (IC50 = 3 ± 1 µM, n=3 patches). (B) Co-application of LyNI-1(100 µM) inhibited LyNa-VA1.1 (50 µM)-evoked whole-endolysosome ITPC2.

LyNa-VA-induced currents are inhibited by LyNI-1, a small-molecule TPC2 inhibitor.

(A) Dose-dependent inhibition of LyNI-1 on PI(3,5)P2 (0.1 µM)-induced whole-endolysosome ITPC2 (IC50 = 3 ± 1 µM, n=3 patches). (B) Co-application of LyNI-1(100 µM) inhibited LyNa-VA1.1 (50 µM)-evoked whole-endolysosome ITPC2. 6) In the subsection “Cationic ion selectivity of TPC2 is not altered by LyNa-Vas”, the authors make the argument that to probe if TCAs bind to the selectivity filter, they investigate possible changes in ion selectivity. They find that there are no changes in selectivity in the presence of TCAs and therefore these drugs do not bind at the selectivity filter. This argument is flawed; there is no reason to think that a drug binding in or near the selectivity filter necessarily alters the selectivity to ions. We agree with the reviewer and have toned down the argument in the revision (see Discussion). 7) Further, the authors mention a "selectivity gate" do they mean "gate at the selectivity filter"? If so, there is no evidence that TPC channel's gating occurs at the selectivity filter, like in CNG cation channels. It is sometimes wrongly assumed that all ions have gating at a bundle crossing (S6 gate) and at the selectivity filter. We agree with the reviewer and have modified the discussion about the unverified “gate at the selectivity filter” of TPC channels (see Discussion). 8) The last paragraph of the Discussion presents some discussion of the possible consequences of this newly described interaction between TCAs and lysosomal cation channels, however, there is no discussion of the possible mechanism of voltage-dependent gating induced in TPC channels and this is a major point of the manuscript. We have expanded the discussion on the potential mechanisms that may contribute to TCA-induced voltage-dependent gating (see the first paragraph in Discussion). 9) In Figure 1E, it is surprising that the magnitude of the currents is so similar between cells to have the size of errors presented. Surely there should be a large variability in the levels of expression. Please present all comparisons between currents as normalized current density (current/capacitance). Based on the reviewer’s suggestion, we have replaced the figure panel using normalized current density (new Figure 1E).
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Cell line (Homo sapiens)HEK293ATCCRRID:CVCL_0045
Cell line (Homo sapiens)HAP1Horizon DiscoveryCat. #: C631
Cell line (Chlorocebus aethiops)Cos1ATCCRRID:CVCL_0223
Recombinant DNA reagentpEGFP-C2-TPC2 (plasmid)Wang et al., 2012
Recombinant DNA reagentpEGFP-C2-TPC1 (plasmid)Wang et al., 2012
Sequence-based reagentTPC1-sgRNAThis papersgRNACTTGCAGTACTTCAGCACCC
Sequence-based reagentTPC2-sgRNAThis papersgRNACCCCAGCGTCGGGCTGCTGC
Sequence-based reagentTPC1-fwThis paperPCR primersATGGCCCAGACATGTGACTC
Sequence-based reagentTPC1-reThis paperPCR primersTGCCTGTCTCCATCCTCTCA
Sequence-based reagentTPC2-fwThis paperPCR primersTGAGCTGAGCATGAGGCAAG
Sequence-based reagentTPC2-reThis paperPCR primersAAAGGACAAGTGGCCCTGAG
Chemical compound, drugDesipramin hydrochlorideSigmaCat. #: D3900
Chemical compound, drugCarbamazepineSigmaCat. #: C4024
Chemical compound, drugmonensinSigmaCat. #: M5273
Chemical compound, drugionomycinSigmaCat. #: I0634
Chemical compound, drugClomipramineCayman ChemicalCat. #: 15884
Chemical compound, drugImipramineCayman ChemicalCat. #: 15890
Chemical compound, drugAmitriptylineCayman ChemicalCat. #: 15881
Chemical compound, drugNortriptylineCayman ChemicalCat. #: 15904
Chemical compound, drugPhenothiazineNCATSCAS: 92-84-2
Chemical compound, drugTriflupromazineNCATSCAS: 146-54-3
Chemical compound, drugChlorpromazineCayman ChemicalCat. #: 16129
Chemical compound, drugML-SA1Princeton BioMolecular Research IncCat. #: OSSK_389119
Chemical compound, drugPI(3,5)P2Echelon BiosciencesCat. #: P-3508
Chemical compound, drugvacuolin-1CalbiochemCat. #: 673000
Software, algorithmpClamppClampRRID:SCR_011323
  51 in total

1.  Gating at the selectivity filter in cyclic nucleotide-gated channels.

Authors:  Jorge E Contreras; Deepa Srikumar; Miguel Holmgren
Journal:  Proc Natl Acad Sci U S A       Date:  2008-02-20       Impact factor: 11.205

Review 2.  TPC: the NAADP discovery channel?

Authors:  Anthony J Morgan; Lianne C Davis; Margarida Ruas; Antony Galione
Journal:  Biochem Soc Trans       Date:  2015-06       Impact factor: 5.407

3.  Photoaffinity labeling of nicotinic acid adenine dinucleotide phosphate (NAADP) targets in mammalian cells.

Authors:  Yaping Lin-Moshier; Timothy F Walseth; Dev Churamani; Sean M Davidson; James T Slama; Robert Hooper; Eugen Brailoiu; Sandip Patel; Jonathan S Marchant
Journal:  J Biol Chem       Date:  2011-11-23       Impact factor: 5.157

4.  A small-molecule scaffold induces autophagy in primary neurons and protects against toxicity in a Huntington disease model.

Authors:  Andrey S Tsvetkov; Jason Miller; Montserrat Arrasate; Jinny S Wong; Michael A Pleiss; Steven Finkbeiner
Journal:  Proc Natl Acad Sci U S A       Date:  2010-09-10       Impact factor: 11.205

5.  Phosphatidylinositol-3,5-bisphosphate lipid-binding-induced activation of the human two-pore channel 2.

Authors:  Sonja A Kirsch; Andreas Kugemann; Armando Carpaneto; Rainer A Böckmann; Petra Dietrich
Journal:  Cell Mol Life Sci       Date:  2018-04-28       Impact factor: 9.261

6.  NAADP mobilizes calcium from acidic organelles through two-pore channels.

Authors:  Peter J Calcraft; Margarida Ruas; Zui Pan; Xiaotong Cheng; Abdelilah Arredouani; Xuemei Hao; Jisen Tang; Katja Rietdorf; Lydia Teboul; Kai-Ting Chuang; Peihui Lin; Rui Xiao; Chunbo Wang; Yingmin Zhu; Yakang Lin; Christopher N Wyatt; John Parrington; Jianjie Ma; A Mark Evans; Antony Galione; Michael X Zhu
Journal:  Nature       Date:  2009-04-22       Impact factor: 49.962

7.  mTOR regulates lysosomal ATP-sensitive two-pore Na(+) channels to adapt to metabolic state.

Authors:  Chunlei Cang; Yandong Zhou; Betsy Navarro; Young-Jun Seo; Kimberly Aranda; Lucy Shi; Shyuefang Battaglia-Hsu; Itzhak Nissim; David E Clapham; Dejian Ren
Journal:  Cell       Date:  2013-02-07       Impact factor: 41.582

8.  Structure of the voltage-gated two-pore channel TPC1 from Arabidopsis thaliana.

Authors:  Jiangtao Guo; Weizhong Zeng; Qingfeng Chen; Changkeun Lee; Liping Chen; Yi Yang; Chunlei Cang; Dejian Ren; Youxing Jiang
Journal:  Nature       Date:  2015-12-21       Impact factor: 49.962

9.  A molecular mechanism to regulate lysosome motility for lysosome positioning and tubulation.

Authors:  Xinran Li; Nicholas Rydzewski; Ahmad Hider; Xiaoli Zhang; Junsheng Yang; Wuyang Wang; Qiong Gao; Xiping Cheng; Haoxing Xu
Journal:  Nat Cell Biol       Date:  2016-03-07       Impact factor: 28.824

10.  Intracellular sphingosine releases calcium from lysosomes.

Authors:  Doris Höglinger; Per Haberkant; Auxiliadora Aguilera-Romero; Howard Riezman; Forbes D Porter; Frances M Platt; Antony Galione; Carsten Schultz
Journal:  Elife       Date:  2015-11-27       Impact factor: 8.140

View more
  15 in total

Review 1.  The ins and outs of virus trafficking through acidic Ca2+ stores.

Authors:  Gihan S Gunaratne; Jonathan S Marchant
Journal:  Cell Calcium       Date:  2022-01-06       Impact factor: 6.817

2.  Parkinson's disease-risk protein TMEM175 is a proton-activated proton channel in lysosomes.

Authors:  Meiqin Hu; Ping Li; Ce Wang; Xinghua Feng; Qi Geng; Wei Chen; Matangi Marthi; Wenlong Zhang; Chenlang Gao; Whitney Reid; Joel Swanson; Wanlu Du; Richard I Hume; Haoxing Xu
Journal:  Cell       Date:  2022-06-23       Impact factor: 66.850

3.  The Three Two-Pore Channel Subtypes from Rabbit Exhibit Distinct Sensitivity to Phosphoinositides, Voltage, and Extracytosolic pH.

Authors:  Xinghua Feng; Jian Xiong; Weijie Cai; Jin-Bin Tian; Michael X Zhu
Journal:  Cells       Date:  2022-06-23       Impact factor: 7.666

Review 4.  Activation of endo-lysosomal two-pore channels by NAADP and PI(3,5)P2. Five things to know.

Authors:  Sandip Patel; Yu Yuan; Gihan S Gunaratne; Taufiq Rahman; Jonathan S Marchant
Journal:  Cell Calcium       Date:  2022-01-25       Impact factor: 4.690

Review 5.  Potential COVID-19 therapeutics from a rare disease: weaponizing lipid dysregulation to combat viral infectivity.

Authors:  Stephen L Sturley; Tamayanthi Rajakumar; Natalie Hammond; Katsumi Higaki; Zsuzsa Márka; Szabolcs Márka; Andrew B Munkacsi
Journal:  J Lipid Res       Date:  2020-05-26       Impact factor: 5.922

6.  Human genome diversity data reveal that L564P is the predominant TPC2 variant and a prerequisite for the blond hair associated M484L gain-of-function effect.

Authors:  Julia Böck; Einar Krogsaeter; Marcel Passon; Yu-Kai Chao; Sapna Sharma; Harald Grallert; Annette Peters; Christian Grimm
Journal:  PLoS Genet       Date:  2021-01-19       Impact factor: 5.917

Review 7.  NAADP: From Discovery to Mechanism.

Authors:  Timothy F Walseth; Andreas H Guse
Journal:  Front Immunol       Date:  2021-09-07       Impact factor: 7.561

Review 8.  Evolutionary Aspects of TRPMLs and TPCs.

Authors:  Dawid Jaślan; Julia Böck; Einar Krogsaeter; Christian Grimm
Journal:  Int J Mol Sci       Date:  2020-06-11       Impact factor: 5.923

Review 9.  Targeting Two-Pore Channels: Current Progress and Future Challenges.

Authors:  Xuhui Jin; Yuxuan Zhang; Abeer Alharbi; Ali Hanbashi; Ali Alhoshani; John Parrington
Journal:  Trends Pharmacol Sci       Date:  2020-08       Impact factor: 14.819

Review 10.  Lysosomal Calcium Channels in Autophagy and Cancer.

Authors:  Yi Wu; Peng Huang; Xian-Ping Dong
Journal:  Cancers (Basel)       Date:  2021-03-15       Impact factor: 6.639

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.