Literature DB >> 31805683

Rhizobia Isolated from the Relict Legume Vavilovia formosa Represent a Genetically Specific Group within Rhizobium leguminosarum biovar viciae.

Anastasiia K Kimeklis1,2, Elizaveta R Chirak1, Irina G Kuznetsova1, Anna L Sazanova1, Vera I Safronova1, Andrey A Belimov1, Olga P Onishchuk1, Oksana N Kurchak1, Тatyana S Aksenova1, Alexander G Pinaev1, Evgeny E Andronov1,2,3, Nikolay A Provorov1.   

Abstract

Twenty-two rhizobia strains isolated from three distinct populations (North Ossetia, Dagestan, and Armenia) of a relict legume Vavilovia formosa were analysed to determine their position within Rhizobium leguminosarum biovar viciae (Rlv). These bacteria are described as symbionts of four plant genera Pisum, Vicia, Lathyrus, and Lens from the Fabeae tribe, of which Vavilovia is considered to be closest to its last common ancestor (LCA). In contrast to biovar viciae, bacteria from Rhizobium leguminosarum biovar trifolii (Rlt) inoculate plants from the Trifolieae tribe. Comparison of house-keeping (hkg: 16S rRNA, glnII, gltA, and dnaK) and symbiotic (sym: nodA, nodC, nodD, and nifH) genes of the symbionts of V. formosa with those of other Rlv and Rlt strains reveals a significant group separation, which was most pronounced for sym genes. A remarkable feature of the strains isolated from V. formosa was the presence of the nodX gene, which was commonly found in Rlv strains isolated from Afghanistan pea genotypes. Tube testing of different strains on nine plant species, including all genera from the Fabeae tribe, demonstrated that the strains from V. formosa nodulated the same cross inoculation group as the other Rlv strains. Comparison of nucleotide similarity in sym genes suggested that their diversification within sym-biotypes of Rlv was elicited by host plants. Contrariwise, that of hkg genes could be caused by either local adaptation to soil niches or by genetic drift. Long-term ecological isolation, genetic separation, and the ancestral position of V. formosa suggested that symbionts of V. formosa could be responsible for preserving ancestral genotypes of the Rlv biovar.

Entities:  

Keywords:  Rhizobium leguminosarum bv. viciae; Vavilovia formosa (Stev.) Fed.; evolution of symbiosis; group separation; housekeeping genes (hkg); symbiotic (sym) genes; tribe Fabeae

Mesh:

Substances:

Year:  2019        PMID: 31805683      PMCID: PMC6947851          DOI: 10.3390/genes10120991

Source DB:  PubMed          Journal:  Genes (Basel)        ISSN: 2073-4425            Impact factor:   4.096


1. Introduction

Root nodule bacteria (rhizobia) represent a useful model for studying the molecular and ecological mechanisms of evolution of symbiotic bacteria. Divergent evolution (intra-species radiation and formation of new species) by these bacteria is promoted by host plants, which elicit the selection pressures responsible for the genetic and ecological diversification of rhizobia [1,2,3]. This evolution may be traced using specialised symbiotic (sym) genes representing the accessory parts of bacterial genomes, which differ in their natural histories from housekeeping genes (hkg) representing the core parts of genomes [4]. As a result of co-evolutionary processes, symbiosis is formed between tightly co-adapted cross-inoculation groups of rhizobia and legumes, and their coevolution is directed by a set of symbiosis-specific genes from each partner [5,6,7]. In some rhizobia, sym genes are more susceptible to autonomous horizontal gene transfer than hkg genes, because they are located on plasmids—mobile elements of the genome [3]. This results in an intensive recombination of host specific and chromosomal markers [8]. For example, Rhizobium leguminosarum is composed of two biovars, which have diverged based on their plasmid-encoded host ranges [9]. Biovar viciae (Rlv) nodulates legumes from the Fabeae tribe, while biovar trifolii (Rlt) nodulates clovers from the Trifolieae tribe; however, they show a conservative chromosomal arrangement of hkg markers (Figure 1).
Figure 1

Plant hosts of Rlv and Rlt on the scheme of Fabeae evolution, based after Mikic [17]. Photo of Vavilovia formosa © Alexander Ivanov (North-Caucasus Federal University, Russia).

Even so, divergent evolution of rhizobia is not restricted to sym genes. Application of the average nucleotide identity (ANI) method has demonstrated that a local R. leguminosarum population could be separated into five genomic species, differing in their hkg genes, representing their core genomes [10]. However, this speciation does not correlate with the diversification of R. leguminosarum into biovars viciae and trifolii, suggesting that hkg and sym gene evolution is controlled by different mechanisms. We decided to probe this hypothesis using the model of Rlv, a symbiont of the legume tribe Fabeae, which includes five genera: Lens, Lathyrus, Pisum, Vicia, and Vavilovia [11]. The latter genus consists of a single species, Vavilovia formosa (Stev.) Fed., a relict and endangered legume plant, which grows mostly in high-mountain regions of the Caucasus and Middle East [12,13,14,15]. Based on genetic and morphological markers, Vavilovia is closely related to Pisum, such that it is still sometimes attribute to this genus [16]. Based on a number of phenotypic traits, V. formosa is considered to be the closest living relative to the last common ancestor (LCA) of the Fabeae tribe [17]. Due to hard-to-reach niches, scarce populations, and the deeply growing roots of V. formosa, it is challenging to obtain a representative collection of its symbionts. Nevertheless, symbionts representing a local population in North Ossetia were previously described [18]. Most of the isolates were identified as Rlv, with some isolates belonging to the genera Bosea, Tardiphaga, and Phyllobacterium. A remarkable feature of these Rlv isolates was that the nodX gene was found in all strains [18]. This gene enables rhizobia to nodulate the highly selective Afghanistan pea lines, which have a specific allele of the sym2 gene, sym2A, which restricts nodulation by Rlv strains devoid of nodX [19]. We used the R. leguminosarumV. formosa system to dissect microevolutionary processes within the cross-inoculation group formed by legumes of the Fabeae tribe. Specifically, we assessed a collection of V. formosa symbionts isolated from three geographically separated populations from North Ossetia, Dagestan (Russia), and Armenia. We compared nucleotide similarity of core hkg (16S rRNA, dnaK, gltA and glnII) and accessory sym (nodA, nodC, nodD and nifH) genes of V. formosa strains with those of R. leguminosarum biovars viciae and trifolii. This approach enabled us to address the trade-off between the evolution of bacterial hkg and sym genes, which might be responsible for speciation and intra-species diversification processes, respectively.

2. Materials and Methods

2.1. Bacterial Collection and DNA Isolation

V. formosa plants with nodules were collected from three widely separated high-mountain populations in North Ossetia, Dagestan, and Armenia (Figure 2). They were sent to our laboratory by the Gorsky State Agrarian University in Vladikavkaz, Russia; the Mountain Botanical Garden in Makhachkala, Russia; and the Institute of Botany in Yerevan, Armenia. Sixteen plants were collected, each of which had 2–20 nodules on their roots. A total of 106 fast-growing rhizobia strains were isolated from nodules of V. formosa using a standard protocol [20]. All isolates were stored at −80 °C in an automated tube store (Liconic Instruments, Mauren, Lichtenstein) at the Russian Collection of Agricultural Microorganisms (RCAM, WDCM 966) in the All-Russia Research Institute for Agricultural Microbiology (ARRIAM) [21]. Information about these strains is available on-line in the database of RCAM (http://www.arriam.spb.ru). Isolates were cultivated at 28 °C and 220 rpm for 48 h in modified yeast mannitol broth (YMB) containing 1% sucrose [22]. DNA was obtained by the lysozyme–SDS–phenol–chloroform extraction protocol, with minor modifications [23]. The final concentration of DNA was measured on a SpectroStar Nano (BMG Labtech, Ortenberg, Germany), and preparations were diluted with water from Millipore Simplicity (Merck KGaA, Darmstadt, Germany) to a working concentration of 10 ng/µl. To optimise the number of samples, 1–3 strains were chosen at random from each plant for further analysis.
Figure 2

Origin of V. formosa populations from this study (black and white dots).

2.2. Polymerase Chain Reaction (PCR) Analysis

PCR with primers for hkg (16S rRNA, dnaK, gltA, and glnII) and sym (nodA, nodC, nodD, nodX and nifH) genes were performed in a 30 µl reaction mixture, containing 10 ng template DNA, 10 pM of each primer, 1× buffer for Taq polymerase (Evrogen, Moscow, Russia), 4.5 nM of each dNTP (Helicon, Moscow, Russia) and one unit of Taq polymerase (Evrogen, Moscow, Russia). PCR reactions were performed on a T-100 thermal cycler (Bio-Rad, Hercules, CA, United States) with an initial denaturation at 95 °C for 3 min, 35 cycles of denaturation (30 s at 94 °C) and annealing (30 s at 50–62 °C), an extension of 1 min at 72 °C, and a final extension at 72 °C for 3 min. Primers and their annealing temperatures are listed in Table 1. PCR products were cleaned of residual enzyme and primers using a silica binding-based protocol [24]. All amplicons were directly sequenced on an ABI PRISM 3500xL Genetic Analyzer (Applied Biosystems, Waltham, MA, United States) at the Centre for Collective Use of Scientific Equipment’s “Genomic Technologies, Proteomics and Cell Biology” in ARRIAM.
Table 1

Primers used in this study.

GenesPrimersSequencesT °CReferences
16S rDNA27FAGAGTTTGATCMTGGCTCAG55[25]
1525RAAGGAGGTGWTCCARCC
dnaKdnaK1466FAAGGARCANCAGATCCGCATCCA62[26]
dnaK1777RTASATSGCCTSRCCRAGCTTCAT
gltAgltA428FCSGCCTTCTAYCAYGACTC53[27]
gltA1111RGGGAGCCSAKCGCCTTCAG
glnIIGSII-1AACGCAGATCAAGGAATTCG55[28]
GSII-2ATGCCCGAGCCGTTCCAGTC
nodAnodA-1TGCRGTGGAARNTRNNCTGGGAAA49[29]
nodA-2GGNCCGTCRTCRAAWGTCARGTA
nodCnodCFAYGTHGTYGAYGACGGTTC57[30]
nodCICGYGACAGCCANTCKCTATTG
nodDNBA12GGATSGCAATCATCTAYRGMRTGG57[31]
NBF12′GGATCRAAAGCATCCRCASTATGG
nodXoMP199CCATGGGACCATCCAATGAAC53[19]
oMP196TTAAGCGACGGAAAGCCTTC
nifHnifHFTACGGNAARGGSGGNATCGGCAA62[30]
nifHIAGCATGTCYTCSAGYTCNTCCA

2.3. Sequence Analysis

Nucleotide sequences were processed using UGENE software (Unipro, Novosibirsk, Russia) [32], and deposited in GenBank under accession numbers listed in Table S1. Reference sequences for the analysis of genes were taken from those R. leguminosarum genomes available in GenBank (Table S1). Alignments were made using Molecular Evolutionary Genetics Analysis (MEGA) X software [33]. Further analysis was performed for separate genes, and also for hkg and sym gene concatenates. Nucleotide distances between and within the three populations were calculated in MEGA X using the p-distance method. These distances were also calculated within groups of all V. formosa (Vaf), vetch/pea (Rlv), and clover (Rlt) symbionts as reference groups. Statistical reliability of nucleotide distances was calculated using Statistica 12 [34]. In order to define the genetic and geographic factors responsible for nucleotide diversity, we used the Mantel test, which was performed using the vegan packet in RStudio [35]. To reconstruct phylogenies, neighbour-joining trees [36], with evolutionary distances computed by the maximum composite likelihood model and a bootstrap test (1000 replicates) [37], were constructed in MEGA X. Resulting dendrograms were visualised using the iTOL webtool [38].

2.4. Group Separation Statistics

Group separation analysis was performed for both individual genes and concatenates obtained for the hkg and sym gene groups. Measures of group separation of Vaf genes from those of Rlv and Rlt were calculated using the jackknife (JK) method, with average similarities, from BioNumerics (Applied Maths, Sint-Martens-Latem, Belgium) [39]. Each sequence from the pool was compared to all other sequences, and was assigned to the group (Vaf, Rlv, or Rlt) to which it was most similar. In cases of ambiguity, the tested sequence was assigned randomly to one of the groups. The depth of group separation was measured using the coefficient of nucleotide differentiation (Nst) with the p-distance model and bootstrap test (1000 replicates) from MEGA X. This coefficient was calculated as (Rt − Rs)/Rt, where Rt is the nucleotide diversity (derived from p-distance) of both populations under comparison, and Rs is the nucleotide diversity within populations [40].

2.5. Sterile Tube Test Experiment

To determine the presence of nodulation of isolated rhizobia in symbiosis with different Fabeae plants, we performed sterile tube test experiments. Four Vaf strains obtained from different geographical regions were selected: Rlv Vaf-10, Vaf-12, Vaf-46 and Vaf-108. In addition, two strains were used as controls, R. leguminosarum bv. viciae 1079 (without the nodX gene) and R. leguminosarum bv. viciae A1 (with the nodX gene), with the latter being capable of effective symbiosis with Afghanistan lines of pea [41]. Nine legume plant species from the Fabeae tribe were used for estimating host specificity: V. formosa, Vicia villosa, Vicia sativa, Pisum sativum line SGE (European line), Pisum sativum (Afghanistan line), Lathyrus pratensis, Lathyrus sylvestris, Lens culinaris and Lens nigricans. V. formosa seeds were provided by the Gorsky State Agrarian University in Vladikavkaz; vetch, vetchlings, and lentils seeds—by the N. I. Vavilov All-Russian Institute of Plant Genetic Resources in St. Petersburg; and pea seeds—by the Laboratory of Genetics of Plant-Microbe Interactions of ARRIAM in St. Petersburg. Control rhizobia strains were provided by RCAM in ARRIAM. Plant seeds were sterilised with concentrated H2SO4 and incubated at 4 °C until they germinated. They were then planted in one-litre glass cylinders containing vermiculite, with N-free liquid growth medium and a solution of microelements [42]. Seedlings were inoculated with 1 mL of a suspension of rhizobia containing approximately 107 cells. As a negative control, 1 mL sterile water was added to the vessel. Plants were cultivated for 30 days in the growth chamber at 50% relative humidity, with a four-level illumination/temperature mode: night (dark, 18 °C, 8 h), morning (200 μmol m−2 s−1, 20 °C, 2 h), day (400 μmol m−2 s−1, 23 °C, 12 h), and evening (200 μmol m−2 s−1, 20 °C, 2 h). Illumination was provided by L 36W/77 Fluora lamps (Osram, Munich, Germany). Four replications were carried out for each sample. Results were recorded using a Carl Zeiss Stemi 508 stereo microscope with Zeiss Axiocam ERc 5S camera (Carl Zeiss Microscopy GmbH, Jena, Germany).

3. Results

A total of 22 fast-growing rhizobia strains were selected from nodules on V. formosa collected at three distinct locations: North Ossetia, Dagestan, and Armenia. Strains used and their geographic origins are listed in Table S1.

3.1. Population Diversity in Symbionts of V. formosa

A total of 198 sequences for nine genes of symbionts of V. formosa were acquired. Nucleotide similarity of each gene between populations did not differ statistically from that observed within populations (data not shown), so all three populations could be regarded as components of the same metapopulation of symbionts of V. formosa. The Mantel test demonstrated significant positive correlations between genetic and geographic distances for most of the genes, based on p-values (Table 2). The highest correlations were generally for hkg: dnaK (0.34, p = 0.0004), gltA (0.45, p = 0.0001), glnII (0.41, p = 0.0001); and for the symbiotic gene: nodX (0.37, p = 0.0007). The rest of the sym genes also demonstrated positive correlations between genetic and geographic distances, though to a lesser degree, nodC (0.13, p = 0.039), nodD (0.26, p = 0.0037) and nifH (0.19, p = 0.0077). The 16S rRNA and nodA genes showed no statistically significant correlation between genetic and geographic distances. Although symbionts of V. formosa could be regarded as components of the same metapopulation, Mantel analysis shows the influence of geographical origin on gene diversity, which is more pronounced for hkg than sym genes.
Table 2

Pearson’s product-moment correlation between nucleotide and geographic distances for isolates of V. formosa, calculated by Mantel test in R studio (vegan packet).

GeneMantel Statistic rp-Value
16S rRNA0.01920.2978
dnaK 0.3379 0.0004
glnII 0.4051 0.0001
gltA 0.4494 0.0001
nodA0.01730.2807
nodC 0.1266 0.039
nodD 0.2553 0.0037
nodX 0.3705 0.0007
nifH 0.1899 0.0077

Statistically significant values are given in bold.

3.2. Phylogenetic Analysis of Symbionts of V. formosa

Phylogenetic trees were constructed for individual genes (Figure S1) and for concatenates of hkg and sym gene groups (Figure 3 and Figure 4). Phylogenies of hkg genes showed no apparent differentiation of Vaf from the reference groups (Rlv and Rlt; Figure 3); however, there were some clades, particularly the Armenian and most of the Dagestan isolates, with some signs of separation. In contrast, phylogenies of the rhizobial sym genes demonstrated different patterns depending on the host plant. There was complete separation of Rlt with 100% bootstrap support, and less pronounced but still clear separation between Rlv and Vaf (Figure 4). At the population level, only the Armenian group displayed a trend to separation, while the Dagestan and North Ossetian groups were intermixed with each other. Strains carrying the nodX gene are widely represented on the dendrograms, but only the Rlv TOM strain, symbiont of Afghanistan pea and carrier of the nodX gene, is grouped with Vaf on the nodA, nodD, and concatenated sym phylogenies. We suppose, this grouping occurred due to their close place of origin, and not the presence of nodX, because the Rlv Vc2 strain, isolated from V. cracca in the United Kingdom, does not group with either Vaf or TOM. To conclude, Vaf isolates form separate a cluster with Rlv on the sym, but not hkg phylogenies.
Figure 3

Neighbour-joining tree for concatenate of hkg (16S rRNA, dnaK, glnA, and gsII) of Vaf (light green—Dagestan, green—Armenia, dark green—North Ossetia), Rlv (yellow), and Rlt (pink) groups. The evolutionary distances were computed using the maximum composite likelihood method. Values of the bootstrap test (1000 replicates) exceeding 0.5 are shown next to the branches. * presence of nodX gene in a strain.

Figure 4

Neighbour-joining trees for concatenate of symbiotic genes (nodA, nodC, nodD, and nifH) of Vaf (light green—Dagestan, green—Armenia, dark green—North Ossetia), Rlv (yellow), and Rlt (pink) groups. The evolutionary distances were computed using the maximum composite likelihood method. Values of the bootstrap test (1000 replicates) exceeding 0.5 are shown next to the branches. * presence of nodX gene in a strain.

3.3. Separation Statistics of symbionts of V. formosa from Rlv

The separation of Vaf genes from Rlv was measured by the JK method and by Nst coefficient. The first method indicated the “topology” of the separation, and the second method determined its depth. The results of these measures were consistent with one another (Figure 5). Two trends could be seen from these results: (1) differences in the degree of separation for different genes, which are statistically significant for nodC, nodD, and nifH genes in comparison with hkg, but was also evident when comparing genes within a category; and (2) a more pronounced separation of Vaf for concatenates than for individual genes. In particular, within symbiotic groups, the minimum separation was detected for nodA and the maximum for nodD (Figure 5).
Figure 5

Group separation statistics. The panel represents summarised data for separation of Vaf from Rlv, including the coefficient of differentiation, group separation, and nucleotide diversity. Each measure is made for individual genes and concatenates of hkg and sym. In panel 1, values for sym that are significantly higher than those for hkg are marked with *. More detailed information can be found in Tables S2 and S3.

Notably, JK measures were asymmetric for groups that were compared (Table S2): Vaf strains were mostly similar to themselves, while Rlv strains were similar to both themselves and Vaf. This might be because the distances between some sequences in the Rlv group were bigger than the distance between the Rlv and Vaf groups.

3.4. Divergence of Hkg and Sym Genes in R. leguminosarum

Due to the design of our dataset, it would be incorrect to directly compare the nucleotide sequence similarities of genes between Vaf and Rlv/Rlt, since the Vaf group represented a naturally occurring metapopulation, while Rlv and Rlt were randomly chosen sets of genotypes. However, it was possible to compare the ratios of sequence similarity of hkg/sym genes within these groups. We demonstrated for the Vaf group that diversities of hkg and sym genes based on p-distance statistically did not differ, while for Rlv, the diversities of sym genes were statistically almost twice as high as those of hkg genes (Table S3). Previously, Kumar et al. [10] demonstrated that in the local R. leguminosarum population composed of bv. viciae and bv. trifolii strains, a pronounced diversity for hkg genes occurred, as determined using the ANI statistics. It resulted in the rhizobia being differentiated into five genomic (cryptic) species, which were not correlated to the host ranges. In order to look for a similar differentiation in our strain collection, we reorganised the group separation data (Table S2), calculating the coefficients of average divergence (CAD) as 100% minus JK values. We demonstrated that a significant diversification of sym genes occurred only in the Rlv group, while for hkg genes, all three groups were highly diverse. For all three groups, the mean CAD values calculated for the Vaf, Rlv, and Rlt groups were significantly higher for hkg than for sym genes (Table S4), which indicates that hkg are more ductile within biovars than sym genes.

3.5. Sterile Tube Test Experiment

Sterile tube tests were conducted with nine plant species, which represent all genera of the Fabeae tribe, including both cultured and wild-growing species. The goal was to estimate the significance of sym gene differences in Vaf strains on nodulation on different Fabeae plants. All four strains from V. formosa demonstrated a nod+ phenotype on all analysed plants (Figure 6). Therefore, V. formosa and its microsymbionts could be attributed to the cross-inoculation group of Fabeae–Rlv.
Figure 6

Results of the sterile tube tests. Pictures show nodule phenotype from each plant–strain combination. The scale for all images is 1 mm. Plants: (Lc) Lens culinaris, (Ln) Lens nigricans, (Lp) Lathyrus pratensis, (Ls) Lathyrus sylvestris, (PsA) Pisum sativum (Afghan line), (PsE) P. sativum SGE (European line), (Vf) Vavilovia formosa, (Vs) Vicia sativa, and (Vv) Vicia villosa. Rhizobia: Rlv 1079, Rlv A1, Rlv Vaf-10, Rlv Vaf-12, Rlv Vaf-46, and Rlv Vaf-108.

The colour and size of nodules varied in different plants; however, these features did not depend on the plant species. The effect of the rhizobial nodX gene on symbiosis was only seen for controls A1 (nodX+) and 1079 (nodX-).

4. Discussion

We analysed the genetic traits of rhizobia isolated from several populations of the relict legume V. formosa. Previously, we demonstrated most of these isolates might be attributed to R. leguminosarum, on the basis of 16S and internal transcribed spacer (ITS) sequences [43]. In addition, the nodC gene was sequenced, and it showed that isolated strains were closest to biovar viciae strains, which commonly nodulate plants from the Fabeae tribe. Another peculiarity was that all these strains contained nodX; this is typical of rhizobia nodulating P. sativum cv. Afghanistan, which grows in the Middle East and was known for its specific Nod factor receptor encoded by the sym2A allele [44]. We also demonstrated that the V. formosa isolates differed from other bv. viciae strains in their sym gene sequences; however, they did not differ in their hkg sequences [45]. The aim of current study was to see whether these features were manifested in different populations, by analysing 22 R. leguminosarum strains isolated from V. formosa plants from three distinct populations of the Caucasus: North Ossetia, Armenia, and Dagestan. The list of analysed genes was extended to include dnaK, gltA, and glnII for hkg genes, and nodA, nodD, nodX, and nifH for sym genes. Nucleotide sequences of these genes were used to differentiate between V. formosa isolates (Vaf) and reference Rlv/Rlt strains, using phylogeny and group separation methods. This allowed the divergent evolution within the R. leguminosarum species to be dissected, with a special emphasis on the trade-off between speciation and symbiotic diversification processes, as well as on the phylogenetic status of symbionts of V. formosa within bv. viciae.

4.1. Symbiotic Behavior of Isolates of V. formosa

The results of sterile tube tests suggest that V. formosa and its symbionts belong to the cross-inoculation group of the Fabeae Rlv. We did not detect differences between the inoculation of European and Afghan pea lines by symbionts of V. formosa, so the role of the nodX gene in V. formosa symbiosis remained unclear. For a more complete assessment of the symbiotic phenotypes formed by isolates of V. formosa, it would be necessary to conduct additional tests with a wider selection of strains and determine their nitrogen-fixing activity.

4.2. Divergent Evolution within R. leguminosarum

In order to dissect the divergent evolution of R. leguminosarum bv. viciae, we used two measures of group separation, JK and Nst, which revealed both the separation and its depth; they also suggested that Vaf constitutes a genetically defined group within or very close to Rlv. In order to analyse the trade-off between symbiotic diversification and speciation processes in rhizobia, we compared the divergence of hkg and sym genes. Previously, we demonstrated that the Vaf group diverged from the Rlv and Rlt groups for sym genes, but not for hkg genes [45]. In this report, with the help of group separation statistics, we demonstrated that intergroup divergence pertains to both gene categories (Figure 5), although in hkg genes it is not pronounced enough to result in the emergence of new species. The last statement is also supported by the ANI statistics for Vaf genomes compared to Rlv, as reported by Chirak [46]. For intra-group diversification, we demonstrated that different statistical approaches to compare hkg and sym gene diversification gave contrasting results. Specifically, p-distance analysis demonstrates (Table S3) that diversification of hkg and sym genes was equal in the Vaf population, while in the Rlv and Rlt groups, hkg genes were less variable than sym genes. We also detected an almost twofold difference in the ratio of hkg/sym nucleotide polymorphisms between Rlv and Vaf rhizobia, which could indicate chromosomal diversification of strains, occurring together with the stabilising pressure of host plants on the sym genes of their symbionts (Table S3). Quite different results were obtained using the reorganised group separation (JK) data, which allowed us to demonstrate that within all three R. leguminosarum groups, divergence for hkg genes was much more pronounced than for sym genes (Table S4). The same difference was demonstrated previously for Neorhizobium galegae biovars orientalis and officinalis [47]. Our data was consistent with that of Kumar et al. [10], who revealed a deep cryptic diversification for hkg genes in a local R. leguminosarum population, which did not correlate with the distribution of bacteria between the viciae and trifolii biovars. Collectively, these data demonstrate that speciation and symbiotic diversification processes might represent independent vectors in rhizobia evolution, controlled by different population and molecular mechanisms operating in the core and accessory parts of bacterial genomes. Considering a pronounced positive correlation between nucleotide sequence similarity of some hkg genes and common geography (Table 2), these data suggested that hkg genes diverged under the influence of micro-evolutionary adaptations to local ecological factors, such as soil micro-niches, or from genetic drift. It would be interesting to address the reasons for the different group separation values obtained for different sym genes. These differences might have a functional background, such as the transcription-activating impacts of NodD being induced by root-released flavonoids, which might differ in plants of the Fabeae tribe, resulting in maximal separation levels for nodD gene. In contrast to nodD, a minimal separation of Vaf and Rlv was detected for the nodA gene. This could result from similarities between chemical structures of the fatty acid tails in the Nod-factors of the rhizobia of V. formosa and those of other plants from this tribe. Therefore, nodA diversity might represent an interesting model for the analysis of the interplay between nucleotide diversity of nod genes and the chemical structure of the Nod-factor signal molecules.

4.3. Role of Geographic Factors in the Diversification of Rhizobia

The data on genetic differentiation of symbionts of V. formosa from the other Rlv strains in the absence of phenotypic differentiation for host specificity suggest that some non-host-dependent factors, such as geographic components, might be responsible for the gene diversification. The results of the Mantel tests (Table 2) suggest that a mechanistic topological (spatial) separation might represent no less a potent factor of rhizobia diversification than the selective pressures responsible for local adaptation. For the majority of hkg genes (dnaK, gltA, and glnII), as well as for nodX, these correlations were highly significant (p < 0.001). For the majority of sym genes (nodC, nodD, and nifH), they were moderately significant (p = 0.0077–0.039), while for genes 16S rRNA and nodA these correlations were absent (p > 0.05). The sym genes might have evolved mainly under selection pressures determined by host plants, which eliminated the correlations between the genetic and geographic diversities. However, for hkg genes, these pressures were generally low, and the diversity of hkg sequences was more dependent on geographic origin. A negligible correlation between topological and genetic diversity revealed for 16S rDNA might have resulted from strong stabilising selection monitoring the structure of this conservative gene.

4.4. Evolutionary Status of Symbionts of V. formosa

Based on the ancestral status of V. formosa and its long-term ecological isolation, we proposed that its rhizobia might also retain ancestral genetic and symbiotic traits. The uniform presence of the nodX gene in the Vaf group, unusual for rhizobia of the European pea lines, also supports this hypothesis. Phylogenetic analysis demonstrated that sym gene diversity is clearly correlated with the separation of R. leguminosarum strains into biovars, while hkg gene diversity doesn’t show such a correlation (Figure 3 and Figure 4). However, the results of sterile tube tests suggested that V. formosa and its symbionts did not demonstrate host specificity within the cross-inoculation group of Fabeae–Rlv. These data suggested that during rhizobia microevolution, diversification of sym genes might precede phenotypic diversification for symbiotic traits. As such, the V. formosaRlv system might still be at the early stages of symbiotic evolutionary divergence, since the genetic differences were already pronounced, while phenotypic differences still had not occurred. Together with the proposed ancestral status of V. formosa, these data suggested that its strains might also preserve ancestral features, which were most clearly expressed at the level of concatenates of hkg and sym genes. Data indicating pronounced ancestral features for the sym gene arrangement within the bacterial genomes have been presented by Chirak et al. [46].

5. Conclusions

Genus Vavilovia is a phylogenetically compact group within the tribe Fabeae, which is sometimes included in its fellow genus Pisum. Nevertheless, V. formosa has some unique properties, such as its archaic phenotypic features and narrow habitat close to the centres of origin of cultivated plants. We analysed 22 R. leguminosarum strains isolated from three distinct populations of V. formosa collected in the Caucasus. Nucleotide sequence similarity of selected hkg and sym genes showed that statistically, all strains appear to compose one metapopulation, with a marked influence of geographic origin on hkg sequences. We propose that that rhizobia strains isolated from V. formosa (Vaf group) represent a compact group within or very close to Rlv rhizobia, based on group separation statistics, including distances between and within groups, as well as JK asymmetry. A comparison of different gene categories for nucleotide diversity suggests that while differences between sym-biotypes for sym genes in R. leguminosarum bv. viciae were elicited by host plants, the diversification of sym-biotypes for hkg genes was affected either by adaptation to soil niches or by genetic drift. Our data suggest that the speciation and micro-evolution of rhizobia might be controlled by different genetic mechanisms correlated to changes of core (hkg) and accessory (sym) genes, respectively.
  28 in total

Review 1.  What makes the rhizobia-legume symbiosis so special?

Authors:  A M Hirsch; M R Lum; J A Downie
Journal:  Plant Physiol       Date:  2001-12       Impact factor: 8.340

2.  Legacy of prior host and soil selection on rhizobial fitness in planta.

Authors:  Liana T Burghardt; Brendan Epstein; Peter Tiffin
Journal:  Evolution       Date:  2019-08-07       Impact factor: 3.694

3.  Unipro UGENE: a unified bioinformatics toolkit.

Authors:  Konstantin Okonechnikov; Olga Golosova; Mikhail Fursov
Journal:  Bioinformatics       Date:  2012-02-24       Impact factor: 6.937

4.  Recombination and selection shape the molecular diversity pattern of nitrogen-fixing Sinorhizobium sp. associated to Medicago.

Authors:  Xavier Bailly; Isabelle Olivieri; Stéphane De Mita; Jean-Claude Cleyet-Marel; Gilles Béna
Journal:  Mol Ecol       Date:  2006-09       Impact factor: 6.185

5.  The neighbor-joining method: a new method for reconstructing phylogenetic trees.

Authors:  N Saitou; M Nei
Journal:  Mol Biol Evol       Date:  1987-07       Impact factor: 16.240

6.  Typing of rhizobia by PCR DNA fingerprinting and PCR-restriction fragment length polymorphism analysis of chromosomal and symbiotic gene regions: application to Rhizobium leguminosarum and its different biovars.

Authors:  G Laguerre; P Mavingui; M R Allard; M P Charnay; P Louvrier; S I Mazurier; L Rigottier-Gois; N Amarger
Journal:  Appl Environ Microbiol       Date:  1996-06       Impact factor: 4.792

7.  The glutamine synthetases of rhizobia: phylogenetics and evolutionary implications.

Authors:  S L Turner; J P Young
Journal:  Mol Biol Evol       Date:  2000-02       Impact factor: 16.240

8.  Classification of rhizobia based on nodC and nifH gene analysis reveals a close phylogenetic relationship among Phaseolus vulgaris symbionts.

Authors:  Gisèle Laguerre; Sarah M Nour; Valérie Macheret; Juan Sanjuan; Pascal Drouin; Noëlle Amarger
Journal:  Microbiology       Date:  2001-04       Impact factor: 2.777

9.  Bacterial genospecies that are not ecologically coherent: population genomics of Rhizobium leguminosarum.

Authors:  Nitin Kumar; Ganesh Lad; Elisa Giuntini; Maria E Kaye; Piyachat Udomwong; N Jannah Shamsani; J Peter W Young; Xavier Bailly
Journal:  Open Biol       Date:  2015-01       Impact factor: 6.411

10.  Search for Ancestral Features in Genomes of Rhizobium leguminosarum bv. viciae Strains Isolated from the Relict Legume Vavilovia formosa.

Authors:  Elizaveta R Chirak; Anastasiia K Kimeklis; Evgenii S Karasev; Vladimir V Kopat; Vera I Safronova; Andrey A Belimov; Tatiana S Aksenova; Marsel R Kabilov; Nikolay A Provorov; Evgeny E Andronov
Journal:  Genes (Basel)       Date:  2019-12-01       Impact factor: 4.096

View more
  2 in total

1.  Search for Ancestral Features in Genomes of Rhizobium leguminosarum bv. viciae Strains Isolated from the Relict Legume Vavilovia formosa.

Authors:  Elizaveta R Chirak; Anastasiia K Kimeklis; Evgenii S Karasev; Vladimir V Kopat; Vera I Safronova; Andrey A Belimov; Tatiana S Aksenova; Marsel R Kabilov; Nikolay A Provorov; Evgeny E Andronov
Journal:  Genes (Basel)       Date:  2019-12-01       Impact factor: 4.096

2.  Evolutionary Genetics of Microbial Symbioses.

Authors:  Laura Baldo; John Werren
Journal:  Genes (Basel)       Date:  2021-02-25       Impact factor: 4.096

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.