Mingxi Xu1, Meng Gu1, Juan Zhou1, Jun Da1, Zhong Wang1. 1. Department of Urology, Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, P.R. China.
Abstract
Yes‑associated protein 1 (YAP1) and mammalian target of rapamycin (mTOR) signaling pathways have been found to be deregulated in bladder cancer and accelerate the malignant progression of bladder cancer. However, the crosstalk between YAP1 and mTOR and its role in bladder cancer progression remains unclear. The aim of the present study was to investigate this crosstalk and the results revealed that the expression of YAP1 and mTOR was elevated in bladder cancer tissues compared with that in adjacent normal tissues. Knockdown of either mTOR or YAP1 with siRNA transfection significantly repressed the proliferation ability and induced apoptosis of HT‑1376 and J82 bladder cancer cells, particularly when YAP1 and mTOR were downregulated simultaneously. Upregulation of mTOR increased the mRNA and protein levels of YAP1 and enhanced its nuclear accumulation. In turn, YAP1 upregulation increased mTOR expression, reduced its protein degradation and increased its stability. In addition, immunofluorescence and Duolink assays demonstrated that YAP1 and mTOR were co‑localized in the nucleus. Immunoprecipitation assay demonstrated that the YAP1 protein was able to bind to the mTOR protein. Moreover, YAP1 combined with S‑phase kinase‑associated protein 2 (SKP2) and positively regulated its expression. Furthermore, the promotion of cell growth and inhibition of cell apoptosis induced by YAP1 overexpression were abolished when SKP2 was downregulated in HT‑1376 and J82 cells. Taken together, the findings of the present study indicated that the crosstalk between YAP1 and mTOR plays a pivotal role in accelerating the progression of bladder cancer, which may provide new insights into the role of the YAP1/mTOR axis in the occurrence and development of bladder cancer.
Yes‑associated protein 1 (YAP1) and mammalian target of rapamycin (mTOR) signaling pathways have been found to be deregulated in bladder cancer and accelerate the malignant progression of bladder cancer. However, the crosstalk between YAP1 and mTOR and its role in bladder cancer progression remains unclear. The aim of the present study was to investigate this crosstalk and the results revealed that the expression of YAP1 and mTOR was elevated in bladder cancer tissues compared with that in adjacent normal tissues. Knockdown of either mTOR or YAP1 with siRNA transfection significantly repressed the proliferation ability and induced apoptosis of HT‑1376 and J82bladder cancer cells, particularly when YAP1 and mTOR were downregulated simultaneously. Upregulation of mTOR increased the mRNA and protein levels of YAP1 and enhanced its nuclear accumulation. In turn, YAP1 upregulation increased mTOR expression, reduced its protein degradation and increased its stability. In addition, immunofluorescence and Duolink assays demonstrated that YAP1 and mTOR were co‑localized in the nucleus. Immunoprecipitation assay demonstrated that the YAP1 protein was able to bind to the mTOR protein. Moreover, YAP1 combined with S‑phase kinase‑associated protein 2 (SKP2) and positively regulated its expression. Furthermore, the promotion of cell growth and inhibition of cell apoptosis induced by YAP1 overexpression were abolished when SKP2 was downregulated in HT‑1376 and J82 cells. Taken together, the findings of the present study indicated that the crosstalk between YAP1 and mTOR plays a pivotal role in accelerating the progression of bladder cancer, which may provide new insights into the role of the YAP1/mTOR axis in the occurrence and development of bladder cancer.
Bladder cancer ranks fourth among the most common types of cancer and eighth among causes of cancer-related mortality worldwide (1). The economic burden of bladder cancer is high due to the lifelong surveillance and invasive procedures required (2,3). Non-muscle-invasive superficial bladder cancers are usually treated with a combination of transurethral resection and chemotherapy or immunotherapy. However, the prognosis of patients with this type of cancer remains poor, with a high recurrence rate or even progression to a higher grade (4). Therefore, it is necessary to identify more detailed molecular mechanisms associated with bladder cancer progression in order to achieve optimal therapeutic efficacy.The phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT)/mammalian target of rapamycin (mTOR) signaling pathway is identified as a prominent mediator of several path-ways and regulates multiple cellular processes, such as cell proliferation, differentiation, metabolism and apoptosis (5). PI3K/AKT/mTOR signaling is reported to be frequently activated in several types of cancer (6,7), including bladder cancer (8,9), whereas inhibition of PI3K/AKT/mTOR signaling is considered to be a major target in cancer treatment (10-13). For example, oleanolic acid was reported to repress the proliferation of humanbladder cancer cells through inhibition of AKT/mTOR signaling (14). The high expression of either phosphorylated (p)-AKT or p-mTOR in patients with sialyl-Tn antigen-positive muscle-invasive bladder cancer was independently associated with a ~6-fold increased mortality risk; in addition, inhibition of the PI3K/mTOR pathway with rapamycin, an inhibitor of mTOR, significantly reduced the number of invasive lesions in vivo (15).Yes-associated protein (YAP) and its homolog, as well as the transcriptional co-activator with PDZ-binding motif, are the main effectors of the evolutionarily conserved Hippo pathway, which is crucial in the regulation of cell proliferation, survival, apoptosis, movement and differentiation (16). Generally, the YAP protein is phosphorylated at Ser127 by the Hippo pathway and sequestrated in the cytoplasm or degraded by the ubiquitination pathway (17). However, in some pathological processes, such as carcinogenesis, YAP phosphorylation is repressed with the absence of Hippo pathway signaling and the non-phosphorylated YAP translocates to the nucleus where it combines with transcription factors, such as the TEA domain transcription factor (TEAD) family, leading to the expression of genes involved in cell growth and survival (18). Moreover, accumulating evidence indicates that the high expression and nuclear localization of YAP1 are closely correlated with the progression and poor prognosis of bladder cancer (19-21), suggesting the important role of YAP1 in bladder cancer progression.Both the mTOR and YAP1 proteins are implicated in the progression of bladder cancer. However, whether the mTOR protein interacts with the YAP1 protein and the role of this interaction in the progression of bladder cancer remain unknown. Therefore, the objective of the present study was to explore the function of the crosstalk between mTOR and YAP1 in the occurrence and progression of bladder cancer.
Materials and methods
Bladder cancer tissue specimens
A total of 20 pairs of bladder cancer and paracancerous normal bladder tissues were obtained from bladder cancerpatients who had undergone cystectomy without any preoperative and postoperative adjuvant therapy. Among the 20 cases of bladder cancer, 4 cases had T1N0M0, 6 had T1N1M0, 7 had T3N0M0 and 3 had T3N1M0 stage. All tissue samples were surgically removed and paraffin-embedded at the Shanghai Ninth People's Hospital between January 2015 and January 2017. All patients had signed informed consent forms and the study protocol was approved by the Ethics Committee of Shanghai Jiao Tong University.
Immunohistochemistry
Formalin-fixed and paraffin-embedded bladder cancer tissues and adjacent normal bladder tissues were cut into 6-µm sections and subjected to immunohistochemical staining. After being deparaffinized, hydrated and blocked with 10% goat serum (AmyJet Scientific Inc.), the sections were probed with primary antibody against YAP1 (cat. no. PA5-78321, Invitrogen; Thermo Fisher Scientific, Inc.) or mTOR (cat. no. PA5-34663, Invitrogen; Thermo Fisher Scientific, Inc.), followed by incubation with the corresponding secondary antibody (Cell Signaling Technology, Inc.) for 1 h and chromogen 3,30-diaminobenzidine tetrachloride (DAB; R&D Systems, Inc.) for 2-3 sec, all at room temperature. Cell nuclei were stained with Harris hematoxylin solution for 2 min at room temperature.For staining evaluation, three independent evaluators who were blinded to the pathological and clinical characteristics of the cases performed scoring of the sections according to the staining extent and intensity. The extent of staining was scored by the percentage of the positively stained area using the following scale: 0, <5%; 1, 5-25%; 2, 25-50%; 3, 50-75%; and 4, >75%. The staining intensity was scored as 0, 1, 2 and 3 for negative (no staining), mild (weak), intermediate (distinct) and intense (strong) staining, respectively. The staining intensity and extent scores were multiplied to yield a weighted score (22).
Cell culture and treatment
The humanbladder cancer cell lines HT-1376 and J82 were obtained from American Type Culture Collection and maintained in Eagle's minimum essential medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin (Invitrogen; Thermo Fisher Scientific, Inc.), and kept in a humidified atmosphere at a constant temperature of 37°C with 5% CO2.Cells were treated with 100 µg/ml cycloheximide (MedChemExpress) for 1, 2, 4, 8 and 24 h, or with 20 µM of MG132 (MedChemExpress) for 4 h.
Cell transfection
Small interfering RNAs (siRNAs) targeting the humanmTOR, YAP1 and S-phase kinase-associated protein 2 (SKP2) genes and the overexpression plasmids of YAP1 (OE-YAP1) and mTOR (OE-mTOR), as well as their negative controls, were all obtained from GenePharma. Cell transfection was performed using Lipofectamine 2000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions.
RNA extraction, cDNA synthesis and RT-PCR were carried out as previously described (23). The primers were synthesized by the Beijing Genomics Institute and are listed in Table I.
Table I
Primer sequences used in reverse transcription-polymerase chain reaction analysis.
Gene name
Forward (5'-3')
Reverse (5'-3')
YAP1
CAACTCCAACCAGCAGCAAC
TCCTGCCGAAGCAGTTCTTG
mTOR
GCCGCGCGAATATTAAAGGA
CTGGTTTCCTCATTCCGGCT
CDC4
GGTCAGGACATTTGGTAGGGG
AAGAGCGGACCTCAGAACCA
RCHY1
GTCACGTGCTTAGGAGCCAT
TGCACTGCACTTCCTTCACT
MDM2
TCTTGATGCTGGTGTATATCAAGT
AATTCTCACGAAGGGCCCAA
SKP2
GGCTGAAGAGCAAAGGGAGT
GGGAGGCACAGACAGGAAAA
UBE3A
CTCGGGGTGACTACAGGAGA
GGCAGAGGTGAAGCGTAAGT
SMURF1
GCTTTGCAAGGCGCGG
TGGGAGCCACCAACAAAAGT
TEAD1
AACTCAGGACAGGCAAGACG
GGCTTGACGTCTTGTGAGGA
GAPDH
AGGCCGGATGTGTTCGC
CATGGTTCACACCCATGACG
YAP1, Yes-associated protein 1; mTOR, mammalian target of rapamycin; SKP2, S-phase kinase-associated protein 2; TEAD, TEA domain transcription factor.
Western blotting
Protein samples were obtained from cells and tissues using RIPA lysis buffer (Beyotime Institute of Biotechnology). Following quantification with a BCA kit (Thermo Fisher Scientific, Inc.), equal amounts of protein (20-30 µg) from each sample were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred onto PVDF membranes (EMD Millipore). Next, the membranes were probed with primary antibodies and the corresponding horseradish peroxidase (HRP)-conjugated secondary antibodies (1:5,000 dilution; cat. nos. SA00001-1 and SA00001-2; Proteintech Group, Inc.) successively. The signal was detected using an enhanced chemiluminescence gel imaging system (GeneGnomeXRQ; Syngene International Ltd.). The primary antibodies used in the present study were as follows: YAP1 (1:2,000 dilution; cat. no. PA5-78321, Invitrogen; Thermo Fisher Scientific, Inc.), TEAD (1:1,000 dilution; cat. no. ab197589, Abcam), mTOR (1:2,000 dilution; cat. no. PA5-34663, Invitrogen; Thermo Fisher Scientific, Inc.), p-mTOR (1:2,000 dilution; cat. no. ab109268, Abcam), eukaryotic translation initiation factor (eIF)4E (1:1,000 dilution; cat. no. ab33766, Abcam), p-eIF4E (1:1,000 dilution; cat. no. ab76256, Abcam), ribosomal protein (rp)S6 (1:1,000 dilution; cat. no. ab40820, Abcam), p-rpS6 (1:1,000 dilution; cat. no. ab215214, Abcam), caspase 3 (1:2,000 dilution; cat. no. 9662, Cell Signaling Technology, Inc.), cleaved caspase 3 (1:2,000 dilution; cat. no. 9661, Cell Signaling Technology, Inc.), caspase 9 (1:2,000 dilution; cat. no. 9502, Cell Signaling Technology, Inc.), cleaved caspase 9 (1:2,000 dilution; cat. no. 9505, Cell Signaling Technology, Inc.), Ub (1:2,000 dilution; cat no. 3933, Cell Signaling Technology, Inc.), SKP2 (1:1,000 dilution; cat. no. ab68455, Abcam), CDC4 (1:1,000 dilution; cat. no. ab12292, Abcam), RCHY1 (1:1,000 dilution; cat. no. 5754, Cell Signaling Technology, Inc.), UBE3A (1:1,000 dilution; cat. no. ab3519, Abcam), SMURF1 (1:1,000 dilution; cat. no. ab57573, Abcam), MDM2 (1:1,000 dilution; cat. no. PA5-11353, Invitrogen; Thermo Fisher Scientific, Inc.), flag (1:3,000 dilution; cat. no. 8146, Cell Signaling Technology, Inc.) and GAPDH (1:5,000 dilution; cat. no. 5174, Cell Signaling Technology, Inc.).
Immunoprecipitation (IP) assay
For the endogenous IP assay, bladder cancer cells were directly collected and subjected to the following protocols. For the exogenous IP assay, the cells were first transfected with the overexpressing YAP1 plasmid vector with flag-tag (YAP1-flag-tag; GenePharma), and were then collected for the following protocols. In detail, bladder cancer cells were first rinsed with cold PBS and lysed in IP lysis buffer (Thermo Fisher Scientific, Inc.), and the total protein in the lysate served as the 'Input' sample. Then, cell lysate containing 200 µg protein was incubated with Dynabeads® Protein G (Thermo Fisher Scientific, Inc.) for 1 h, and incubated with 2 µg antibody against YAP1 (cat. no. PA5-78321, Invitrogen; Thermo Fisher Scientific, Inc.), mTOR (cat. no. PA5-34663, Invitrogen; Thermo Fisher Scientific, Inc.) flag (cat. no. 8146, Cell Signaling Technology, Inc.), or beads (negative control) overnight at 4°C, followed by incubation with Dynabeads® Protein G for another 1 h to form the immune complex, which was considered as the 'Elute' sample. Subsequently, both the 'Input' and 'Elute' samples were loaded onto gels for western blotting with antibodies against Ub (cat. no. 3933, Cell Signaling Technology, Inc.), SKP2 (cat. no. ab68455, Abcam) or mTOR (cat. no. PA5-34663, Invitrogen; Thermo Fisher Scientific, Inc.).
Immunofluorescence
HT-1376 and J82 cells transfected with OE-mTOR, OE-NC or the non-transfected cells were seeded onto glass coverslips in a 24-well plate for 48 h. Then, the cells were fixed with paraformaldehyde for 15 min at room temperature and subsequently stained with rabbit polyclonal YAP1 (1:50 dilution; cat. no. PA5-78321, Invitrogen; Thermo Fisher Scientific, Inc.) and mouse polyclonal mTOR (1:50 dilution; cat. no. AHO1232, Invitrogen; Thermo Fisher Scientific, Inc.) antibodies, followed by incubation with the corresponding fluorescent secondary antibodies, including goat anti-rabbit IgG (H+L) highly cross-adsorbed secondary antibody, Alexa Fluor Plus 488 (1:1,000 dilution; cat. no. A32731, Invitrogen;Thermo Fisher Scientific, Inc.) and donkey anti-mouse IgG (H+L) highly cross-adsorbed secondary antibody, Alexa Fluor Plus 594 (1:1,000 dilution; cat. no. A327441, Invitrogen; Thermo Fisher Scientific, Inc.) for 1 h at room temperature. The nuclei were visualized by staining with DAPI at 1:10,000 dilution (Solarbio) for 5 min at room temperature. The glass coverslips were sealed with antifade reagent (Vectashield) and examined under a laser scanning microscope (TCSSP2-AOBS-MP, Leica Microsystems CMS) at a magnification of x400.
Proximity ligation assay (PLA)
The interaction between the mTOR and YAP1 proteins was investigated by performing a similar double immunostaining protocol, with the secondary antibodies replaced by PLA probes obtained from the Duolink kit (Sigma Aldrich; Merck KGaA). Hybridization between two PLA plus and minus probes gives a fluorescent signal only when the distance between the two proteins is ≤40 nm.
Cell proliferation and apoptosis detection
Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Inc.) was used to assess cell proliferation. Briefly, HT-1376 and J82 cells were seeded into 96-well plates at a density of 2,000 cells/well and cell transfection was performed. Subsequently, the cells were incubated with 10 µl CCK-8 reagent for another 4 h at 37°C after 24, 48, 72, 96 or 120 h of cell transfection. The absorbance at 450 nm was detected by a microplate reader (Molecular Devices, LLC).For cell apoptosis, 48 h after cell transfection with si-YAP1, si-NC, si-mTOR, si-SKP2, OE-mTOR or OE-YAP1, HT-1376/J82 cells were collected and subjected to apoptosis evaluation with Annexin V(FITC)/propidium iodide (PI) Apoptosis Detection Kits (Dojindo Molecular Technologies, Inc.) according to the manufacturer's instructions. Cell apoptosis rate was determined by flow cytometry (Beckman Coulter, Inc.) and analyzed by FlowJo 7.6 software (FlowJo LLC).
Statistical analysis
Each experiment was performed at least 3 times. Data are expressed as the mean ± square deviation. Statistical analysis was performed using the two-tailed Student's t-test or ANOVA with Bonferroni post hoc test for two or multiple groups, respectively. Statistical significance is expressed as *,#P<0.05, **,##P<0.01 or ***,###P<0.001.
Results
Knockdown of YAP1 and mTOR represses cell proliferation and induces cell apoptosis in bladder cancer
To explore the interaction of YAP1 and mTOR, we first compared their expression profiles in bladder cancer tissues with those in adjacent normal tissues. The results demonstrated that the mRNA and protein levels of YAP1 and mTOR were all increased in bladder cancer tissues (Fig. 1A and B). Consistently, immunohistochemistry also demonstrated that the YAP1 and mTOR protein expression levels were elevated in bladder cancer tissues (Fig. 1C), with a high score of mTOR and YAP1 staining (Fig. 1D and E). Next, the effects of YAP1 and mTOR on the proliferation and apoptosis of bladder cancer cells was assessed through loss-of-function experiments. The knockdown efficiencies of siRNAs of humanYAP1 and mTOR genes demonstrated that si-YAP1-1 and si-mTOR-2 displayed the best knockdown efficiency among the 3 siRNAs in both HT-1376 and J82 cells (Fig. 1F and G). CCK-8 assay (Fig. 1H and I) and flow cytometry (Fig. 1J) demonstrated that cell proliferation was significantly decreased and cell apoptosis was enhanced when HT-1376 and J82 cells were transfected with either si-YAP1 or si-mTOR, in particular si-YAP1 + si-mTOR, whereas upregulation of mTOR or YAP1 significantly enhanced cell proliferation (Fig. 1H and I) and repressed cell apoptosis (Fig. 1J). Furthermore, knockdown of either YAP1 or mTOR induced an increase in the expression of cleaved-caspase3/9 in both HT-1376 and J82 cells (Fig. 1K). These results indicated that both YAP1 and mTOR promoted bladder cancer progression.
Figure 1
Knockdown of YAP1 and mTOR inhibited the progression of bladder cancer. (A and B) RT-PCR and western blot assays were performed to test the expression of YAP1 and mTOR in bladder cancer and normal bladder tissues (***P<0.001). (C) Immunohistochemistry was used to evaluate the expression patterns of the YAP1 and mTOR proteins in three matched pairs of bladder cancer and normal bladder tissues (magnification, x200). (D and E) Immunohistochemistry scores of mTOR and YAP1 staining in 20 paired bladder cancer and adjacent normal tissues. (F and G) RT-PCR was used to analyze the knockdown efficien-cies of si-YAP1 and si-mTOR (*P<0.05, **P<0.01). (H and I) HT-1376 and J82 cells were transfected with si-NC, si-YAP1, si-mTOR or si-YAP1 + si-mTOR for 0, 24, 48, 72 and 96 h; then, CCK-8 assay was performed to evaluate cell proliferation. (J) HT-1376 and J82 cells were transfected with si-NC, si-YAP1, si-mTOR or si-YAP1 + si-mTOR for 48 h; then, cells were collected for flow cytometry assay to detect cell apoptosis. (K) Western blotting was performed to detect the expression of apoptosis-related proteins, such as caspase 3/9 and cleaved-caspase3/9 after 48 h of cell transfection (H-K, vs. si-NC group, *P<0.05; vs. si-YAP1 group, #P<0.05; NC, negative control). YAP1, Yes-associated protein 1; mTOR, mammalian target of rapamycin; RT-PCR, reverse transcription-polymerase chain reaction.
mTOR positively regulates YAP1 expression in bladder cancer cells
Subsequently, the interaction between mTOR and YAP1 was explored through upregulation of mTOR with OE-mTOR transfection in HT-1376 and J82 cells. Transfection of cells with OE-mTOR significantly increased mTOR mRNA and protein levels (Fig. 2A and B), and increased the expression levels of YAP1 and its downstream transcription factor TEAD at the mRNA and protein levels in both HT1376 (Fig. 2C and D) and J82 cells (Fig. 2E and F). In addition, upregulation of mTOR enhanced the nuclear accumulation of YAP1 (Fig. 2G and H). These findings demonstrated that mTOR enhanced YAP1 expression and its subcellular localization in bladder cancer cells.
Figure 2
Crosstalk between the YAP1 and mTOR proteins. (A and B) HT-1376 and J82 cells were transfected with OE-mTOR and OE-NC; then cells were harvested and subjected to RT-PCR and western blot assays to determine the expression of mTOR at the mRNA and protein levels, respectively. (C-F) RT-PCR and western blot assays were performed to determine the mRNA and protein expression of YAP1 and TEAD after 48 h of HT-1376 and J82 cell transfection with OE-mTOR or OE-NC. (G) Immunofluorescence assay was performed to evaluate the effects of subcellular location of the YAP1 protein. (H) Statistical analysis of the fluorescence intensity of the YAP1 protein (*P<0.05, **P<0.01; NC, negative control). YAP1, Yes-associated protein 1; mTOR, mammalian target of rapamycin; RT-PCR, reverse transcription-polymerase chain reaction; TEAD, TEA domain transcription factor.
YAP1 facilitates the activation of mTOR pathway
Next, we assessed the effects of YAP1 on mTOR pathway activation in bladder cancerHT-1376 and J82 cells. The overexpression efficiency of OE-YAP1 in HT-1376 and J82 cells at the mRNA and protein levels is shown in Fig. 3A and B. Upregulation of YAP1 significantly increased the expression and phosphorylation of mTOR, as well as the phosphorylation of eIF4E and rpS6 (Fig. 3C and D). In addition, YAP1 upregulation significantly increased the stability of the mTOR protein (Fig. 3E and F) and decreased its ubiquitination (Fig. 3G). The ubiquitination-mediated degradation of the mTOR protein was further confirmed by MG132 treatment (Fig. 3G).
Figure 3
Upregulation of YAP1 promoted the expression and protein stability of mTOR. (A and B) HT-1376 and J82 cells were transfected with OE-YAP1 and OE-NC; then, the cells were harvested and subjected to RT-PCR and western blot assays to determine the expression of YAP1. (C and D) western blotting assays were performed to determine the protein expression and phosphorylation of mTOR, p-mTOR, p-eIF4E, eIF4E, p-rpS6 and rpS6 after HT-1376 and J82 cells were transfected with OE-YAP1 or OE-NC. (E and F) After HT-1376 and J82 cells were transfected with OE-YAP1 and OE-NC for 24 h, they were incubated with 100 µg/ml CHX for 0, 1, 2, 4, 8 and 24 h; then, cells were harvested and protein samples were extracted for western blotting with mTOR antibody. (G) Immunoprecipitation (IP) assay was performed to explore the effects of YAP1 upregulation or MG132 on mTOR expression and ubiquitination in HT-1376 and J82 cells (*P<0.05, **P<0.01). YAP1, Yes-associated protein 1; mTOR, mammalian target of rapamycin; RT-PCR, reverse transcription-polymerase chain reaction; eIF, eukaryotic translation initiation factor; rpS6, ribosomal protein s6; CHX, cycloheximide.
Moreover, a co-localization of the mTOR and YAP1 proteins in the nucleus was observed, as determined by immunofluorescence assay (Fig. 4A) and Duolink assay (Fig. 4B). To further evaluate the interaction between YAP1 and mTOR, the YAP1 overexpressing vector with flag-tag (YAP1-flag-tag) was constructed and its validity was determined by western blotting in both J82 and HT-1376 cells (Fig. 4C and D). Endogenous as well as exogenous IP assays demonstrated that YAP1 could bind to the mTOR protein (Fig. 4E). These results demonstrated that YAP1 can interact with and activate mTOR signaling.
Figure 4
Interaction between YAP1 protein and mTOR protein in HT-1376 and J82 cells. (A) Immunofluorescence assay was performed to evaluate the subcellular localization of the YAP1 and SKP2 proteins. (B) Duolink assay was performed to evaluate the subcellular localization of the YAP1 and mTOR proteins. (C and D) Western blotting was performed to assess the expression of flag and YAP1 after J82 and HT-1376 cells were transfected with flag-tag or YAP1-flag-tag vector (*P<0.05). (E) Immunoprecipitation assay was used to assess the combination of YAP1 and mTOR proteins ['input' refers to total protein lysate and 'eluent' refers to the immune complex pulled down by YAP1 antibody or flag antibody; beads were used as a negative control (NC)]. YAP1, Yes-associated protein 1; mTOR, mammalian target of rapamycin; SKP2, S-phase kinase-associated protein 2.
YAP1 promotes bladder cancer progression through SKP2-induced mTOR stability enhancement
Subsequently, the mechanism of YAP1 in the regulation of mTOR ubiquitination was investigated through loss-of-function assays. Among the 3 siRNAs of YAP1, si-2 targeting the YAP1 gene exhibited the highest knockdown efficiency in both HT-1376 and J82 cells (Fig. 5A and B). Subsequently, we analyzed the expression of proteins associated with ubiquitination, and the results demonstrated that knockdown of YAP1 significantly reduced SKP2 expression and vice versa, whereas the expression of CDC4, RCHY1, MDM2, UBE3A and SMURF1 exhibited no obvious change in either HT-1376 (Fig. 5C and D) or J82 cells (Fig. 5E and F). Immunofluorescence and Duolink assays revealed co-localization of the YAP1 and SKP2 proteins (Fig. 5G and H). In addition, IP assay was performed to verify whether YAP1 could bind to SKP2, and the results confirmed that YAP1 could combine with the SKP2 protein (Fig. 5I).
Figure 5
Detection of the interaction between YAP1 and SKP2. (A and B) HT-1376 and J82 cells were transfected with siRNAs-YAP1; then, cells were harvested and subjected to RT-PCR and western blot assays to determine the knockdown efficiency (**P<0.01, ***P<0.001). After (C and D) HT-1376 and (E and F) J82 cells were transfected with si-YAP1, si-NC, OE-YAP1 and OE-NC, RT-PCR and western blot assays were performed to determine the mRNA and protein levels of CDC4, SKP2, RCHY1, MDM2, UBE3A and SMURF1 (si-YAP1 vs. si-NC group, *P<0.05, **P<0.01; OE-YAP1 vs. OE-NC group, #P<0.05, ##P<0.01, ###P<0.001). (G and H) Immunofluorescence and Duolink assays were performed to evaluate the subcellular localization of the YAP1 and SKP2 proteins. (I) Immunoprecipitation assay was used to assess the combination between YAP1 and SKP2 proteins in HT-1376 and J82 cells ['input' refers to total protein lysate and 'eluent' refers to the immune complex pulled down by YAP1 antibody; beads were used as a negative control (NC)]. YAP1, Yes-associated protein 1; SKP2, S-phase kinase-associated protein 2; RT-PCR, reverse transcription-polymerase chain reaction.
Next, the effects of SKP2 on the progression of bladder cancer were examined. As shown in Fig. 6A and B, the knock-down efficiency of si-SKP2 was examined and the results demonstrated that si-3 exhibited the best knockdown efficiency at the mRNA and protein levels. Downregulation of SKP2 significantly blunted the effect of YAP1 on the ubiquitination inhibition of the mTOR protein (Fig. 6C) and the enhancement of the expression of mTOR and the phosphorylation of p-mTOR, p-elF4E and p-rpS6 (Fig. 6D and E). In addition, cell proliferation promotion (Fig. 6F and G) and apoptosis inhibition (Fig. 6H) induced by YAP1 overexpression were all impaired when SKP2 was downregulated in bladder cancerHT-1376 and J82 cells. Furthermore, knockdown of SKP2 together with YAP1 overexpression significantly increased the expression of cleaved-caspase3/9 in HT-1376 and J82 cells compared with cells with YAP1 overexpression alone (Fig. 6I and J). Overall, these findings indicate that YAP1 promotes bladder cancer progression through SKP2-induced mTOR signaling activation.
Figure 6
Detection of the effects of YAP1/SKP2 axis on mTOR ubiquitination and bladder cancer progression. (A and B) HT-1376 and J82 cells were trans-fected with siRNAs-SKP2; then, the cells were harvested and subjected to RT-PCR and western blot assays to determine the knockdown efficiency of SKP2 (**P<0.01, ***P<0.001). (C) Immunoprecipitation assay was used to assess the effects of the YAP1/SKP2 axis on mTOR protein expression and ubiquitination. (D and E) Western blotting was performed to test the expression and phosphorylation of mTOR, p-mTOR, p-eIF4E, elF4E, p-rpS6 and rpS6 following cell transfection. (F and G) The effects of the YAP1/SKP2 axis on cell proliferation were determined by CCK-8 analysis. Detection of the effects of YAP1/SKP2 axis on mTOR ubiquitination and bladder cancer progression. (H) The effects of the YAP1/SKP2 axis on cell apoptosis were assessed by flow cytometry analysis. (I and J) Western blotting was performed to detect the expression of apoptosis-related proteins, such as caspase 3/9 and cleaved-caspase3/9 after 48 h of cell transfection (D-J, OE-YAP1 + si-NC group or OE-NC + si-SKP2 group vs. OE-NC + si-NC group, *P<0.05, **P<0.01, ***P<0.001; OE-YAP1 + si-SKP2 group vs. OE-YAP1 + si-NC group, #P<0.05, ##P<0.01; NC, negative control). YAP1, Yes-associated protein 1; SKP2, S-phase kinase-associated protein 2; RT-PCR, reverse transcription-polymerase chain reaction; eIF, eukaryotic translation initiation factor; rpS6, ribosomal protein s6.
Discussion
Bladder cancer is a common malignancy of the urinary system with high morbidity and mortality. Its incidence in recent decades has increased by ~40%, and the prognosis of patients with advanced disease and metastasis is extremely poor (24,25). To comprehensively understand the molecular mechanism underlying the occurrence and development of bladder cancer, the crosstalk between YAP1 and mTOR proteins was investigated and the results demonstrated that YAP1 interacted with mTOR, thereby promoting bladder cancer progression.To further explore the effects of YAP1 and mTOR on bladder cancer progression, the different expression patterns of YAP1 and mTOR were first assessed in bladder cancer and normal tissues. The results demonstrated that both YAP1 and mTOR were overexpressed in bladder cancer tissues compared with normal tissues, at both the protein and mRNA levels. These results were consistent with those of previous studies (19,21,26). In addition, it was confirmed that both YAP1 and mTOR act as oncogenes in bladder cancer. Knockdown of either YAP1 or mTOR significantly repressed cell growth and induced cell apoptosis, particularly when YAP1 and mTOR were silenced simultaneously. mTOR has been recognized as a cytoplasmic kinase modulating translation, autophagy and protein degradation (27). The dysregulation of mTOR has been found to contribute to the carcinogenesis and poor outcome of bladder cancer (28,29). Similarly, YAP1 is also an oncogene that plays crucial roles in the progression of several types of cancer (30). YAP1 is frequently overexpressed and hyperactivated in a number of tumors, including bladder cancer, leading to uncontrolled growth of cancer cells (31), whereas inhibition of YAP1 causes the inhibition of cell proliferation and enhancement of cell death through modulation of its down-stream transcriptional targets (19). All these findings highlight the vital roles of YAP1 and mTOR in cancer progression.To elucidate the interaction between mTOR and YAP1, we then investigated the effects of mTOR on the expression pattern and subcellular location of YAP1 in bladder cancer cells. Upregulation of mTOR was found to significantly increase YAP1 mRNA and protein expression levels and enhanced its nuclear accumulation. The nucleus is where YAP1 combines with transcription factors and then regulates gene expression to modulate cell growth and survival (18). Reduction of nuclear accumulation is a primary mechanism of antitumor effects mediated through the YAP family. For example, Lv et al (32) reported that the reduction of YAP nucleoprotein induced by Amot knockdown inhibited the progression of breast cancer.In addition, the effects of YAP1 on the expression of mTOR were also explored. It was observed that the YAP1 and mTOR proteins could bind with each other and overexpression of YAP1 increased mTOR expression through inhibiting its ubiquitination and enhancing its stability in a SKP2-dependent manner. SKP2 is an E3 ubiquitin ligase that belongs to the ubiquitin proteasome system, and has been found to play an important role in tumorigenesis (33,34). It has been reported that SKP2 regulates cell cycle, proliferation, differentiation, apoptosis and metastasis and acts as an oncoprotein in multiple humancancers (35,36). Notably, Zhang et al (37) revealed that YAP could strongly induce SKP2 acetylation, leading to the hyperaccumulation of the cyclin-dependent kinase inhibitor p27 and reduced expres-sion of the pro-apoptotic factors FoxO1/3. In the present study, we observed that YAP1 could interact with the SKP2 protein and promote its expression. Furthermore, knockdown of SKP2 significantly abolished the effect of YAP1 on the reduction of mTOR ubiquitination and the activation of mTOR signaling, the enhancement of cell proliferation and repression of cell apoptosis. Our results revealed that YAP1 promoted mTOR expression in a SKP2-dependent manner, which demonstrated a different role for SKP2 in the regulation of protein expression, in addition to its role in ubiquitination pathway-mediated protein regulation. The findings of the present study indirectly indicate that SKP2 acts as an oncogene in tumorigenesis, which is consistent with previous findings (35,36).In conclusion, the present study demonstrates that YAP1 and mTOR proteins positively regulate each other, and their crosstalk markedly accelerates the progression of bladder cancer. These findings may provide new insights into the roles of YAP1 and mTOR in the occurrence and progression of bladder cancer.
Authors: Luo Yuan Yuan; Wu Shuai; Zou Yuan-Peng; Jiang Ting; Xia Wei; He Yu-Qin Journal: Evid Based Complement Alternat Med Date: 2022-07-19 Impact factor: 2.650