Literature DB >> 31783837

O-serogroups, virulence genes, antimicrobial susceptibility, and MLST genotypes of Shiga toxin-producing Escherichia coli from swine and cattle in Central China.

Zhong Peng1,2, Wan Liang3, Zizhe Hu1,2, Xiaosong Li1,2, Rui Guo1,2, Lin Hua1,2, Xibiao Tang1,2, Chen Tan1,2, Huanchun Chen1,2, Xiangru Wang4,5, Bin Wu6,7.   

Abstract

BACKGROUND: Shiga toxin-producing Escherichia coli (STEC) is a leading cause of worldwide food-borne and waterborne infections. Despite an increase in the number of STEC outbreaks, there is a lack of data on prevalence of STEC at the farm level, distribution of serogroups, and virulence factors.
RESULTS: In the present study, a total of 91 (6.16%) STEC strains were isolated from 1477 samples including pig intestines, pig feces, cattle feces, milk, and water from dairy farms. The isolation rates of STEC strains from pig intestines, pig feces, and cattle feces were 7.41% (32/432), 4.38% (21/480), and 9.57% (38/397), respectively. No STEC was isolated from the fresh milk and water samples. By O-serotyping methods, a total of 30 types of O-antigens were determined, and the main types were O100, O97, O91, O149, O26, O92, O102, O157, and O34. Detection of selected virulence genes (stx1, stx2, eae, ehxA, saa) revealed that over 94.51% (86/91) of the isolates carried more than two types of virulence associated genes, and approximately 71.43% (65/91) of the isolates carried both stx1 and stx2, simultaneously. Antimicrobial susceptibility tests showed that most of the STEC isolates were susceptible to ofloxacin and norfloxacin, but showed resistance to tetracycline, kanamycin, trimethoprim-sulfamethoxazole, streptomycin, amoxicillin, and ampicillin. MLST determined 13 categories of sequence types (STs), and ST297 (31.87%; 29/91) was the most dominant clone. This clone displayed a close relationship to virulent strains STEC ST678 (O104: H4). The prevalence of ST297 clones should receive more attentions.
CONCLUSIONS: Our preliminary data revealed that a heterogeneous group of STEC is present, but the non-O157 serogroups and some ST clones such as ST297 should receive more attentions.

Entities:  

Keywords:  Antimicrobial susceptibility; MLST genotypes; O-serogroups; Shiga toxin-producing Escherichia coli; Virulence genes

Mesh:

Year:  2019        PMID: 31783837      PMCID: PMC6883634          DOI: 10.1186/s12917-019-2177-1

Source DB:  PubMed          Journal:  BMC Vet Res        ISSN: 1746-6148            Impact factor:   2.741


Background

Shiga toxin-producing Escherichia coli (STEC) is a significant foodborne pathogen that is capable of causing watery or bloody diarrhea, hemorrhagic colitis, and hemolytic uremic syndrome [1-3]. O (somatic) polysaccharides and H (flagellar) surface antigens form the basis for the serological determination of STEC strains [4, 5]. There are currently more than 100 types of O antigens having been determined from STEC isolates, and several serogroups such as O157, O26, O104, O45, O103, O111, O121, and O145 are commonly associated with severe illness in humans worldwide [2, 4, 6–9]. In China, the first ever severe outbreak of E. coli O157:H7 occurred in Xuzhou, Jiangsu Province, in 1999, which caused the death of 177 people [10]. While limited data on STEC in humans in China are available, both STEC O157 and non-O157 STEC including some predominant serogroups associated with human disease, such as O26, O45, O103, O111, and O121, have been detected and isolated from domestic and wild animals as well as raw meats in different regions [11-14]. A recent study has revealed that the overall prevalence of STEC O157:H7 was 41.3% along the production and supply chain of pork around Hubei Province in Central China, and the prevalence found in slaughter houses, wet- and super-markets were 86.25% (69/80), 53.3% (32/60), and 28.3% (17/60), respectively [13]. These data suggest a big threat to the food safety and even human health in this region. There are many virulence factors associated with the fitness and pathogenesis of STEC, but Shiga toxin (Stx, also called Vero toxin) is regarded as the most important one [1, 15]. STEC strains mainly produce two Stx types, Stx1 and Stx2, which are further classified into three subtypes for Stx1 (Stx1a, Stx1c, Stx1d) and seven subtypes for Stx2 (Stx2a, Stx2b, Stx2c, Stx2d, Stx2e, Stx2f, Stx2g) [16]. In addition to Stx, the STEC strains also possess many other virulence determinants, including the locus of enterocyte effacement (LEE), hemolysin, STEC autoagglutinating adhesion (Saa), lipopolysaccharide (LPS), outer membrane proteins (OMPs), fimbrial, and peroxidase [15, 17–22]. It is proposed that food-producing animals such as cattle, pigs, chickens are major reservoirs for STEC [23]; and many STEC outbreaks are associated with consumption of meat and other products of food-producing animals contaminated with STEC strains, and/or water contaminated with feces of food-producing animals [24, 25]. Despite an increase in the number of STEC outbreaks, there is a lack of data on prevalence of STEC at the farm level, distribution of serogroups, and virulence factors [2]. Since pork and milk are the common daily food for the Chinese people and Central China, including Hubei, Anhui, Hunan and Henan provinces, is one of main pig rearing and pork producing regions in China, in this study, we performed an isolation, identification and characterization of STEC strains from pigs, cattle, milk and water samples collected from pig and cattle farms in Central China.

Results

Isolation of STEC

A total of 1477 samples, including 432 samples of intestinal contents from pigs with diarrhea, 480 fecal samples from pigs with diarrhea, 397 fecal samples from cows with diarrhea, 99 samples of fresh milk and 69 water samples from dairy farms, were collected from four provinces of Central China (Hubei, Anhui, Hunan, Henan) for PCR detection of Shiga toxin encoding genes (stx) and STEC isolation. Of the 1477 samples detected, 119 (8.06%) samples were positive for stx1 and/or stx2. STEC strains were isolated from 91 (76.47%) of the 119 stx-positive samples. The isolation rates of STEC strains from pig intestines, pig feces, and cattle feces were 7.41% (32/432), 4.38% (21/480), and 9.57% (38/397), respectively (Fig. 1a, Table 1). However, there were no STEC strains being isolated from the fresh milk and water samples collected (Fig. 1a, Table 1). Biochemical tests showed that all isolates were capable of fermenting glucose, maltose, lactose, and xylose, raffinose, lysine, and ornithine, but were unable to use gluconate, phenylalanine, and citrate.
Fig. 1

Isolation of STEC from samples collected from Hubei, Henan, Hunan, and Anhui in China. Panel a displays the number of each type of the samples collected for STEC isolation and the number of STEC strains isolated. Panel b shows the places of samples collected and the number of STEC isolated from different provinces in Central China. The authors sincerely acknowledge the Ministry of Natural Resources of the People’s Republic of China for providing the map of China free for public use

Table 1

Serogroups, virulence factors and sequence types (STs) of the 91 STEC isolates

STNo. of isolatesSerogroupStx1Stx2eaeehxAsaa
ST105O34+++
O92+
O97++
O98+++
O149++
ST262O69++++
O100+++
ST2911O76++++
O92+++
O97+++
O97+++
O100++++
O100+++
O100+++
O102++
O102++
O102+++
Nontypable+++
ST1017O26++
O97+++
O100+
O100++++
O100+++
O102+++
O149++
ST1561O64+++
ST29729O5+++
O6+++
O21++
O22++++
O26+++
O26+++
O26+++
O26+++
O39++
O54+++
O55+++
O75+++
O91+++
O91++++
O97+++
O97++++
O97++++
O97+++
O97+++
O97+++
O97+++
O100+++
O100+++
O100++
O100++
O145+++
O149++
O173+++
O173+++
ST5422O157++++
O157++++
ST60213O34+++
O34+++
O55+++
O75+++
O91+++
O91++
O91++
O91++
O91+++
O97+++
O118++++
O149+++
Nontypable+++
ST7931O3++
ST8134O34++
O92+++
O97+++
O100+++
ST12948O91+++
O100++++
O110++++
O149+++
Nontypable+++
Nontypable+++
Autoagglutination+
Autoagglutination+
ST16236O42+++
O54+++
O78+++
O92++++
O92++++
O149+
ST17212O9++++
O167++++

“+”: Positive; “-”: Negative

Isolation of STEC from samples collected from Hubei, Henan, Hunan, and Anhui in China. Panel a displays the number of each type of the samples collected for STEC isolation and the number of STEC strains isolated. Panel b shows the places of samples collected and the number of STEC isolated from different provinces in Central China. The authors sincerely acknowledge the Ministry of Natural Resources of the People’s Republic of China for providing the map of China free for public use Serogroups, virulence factors and sequence types (STs) of the 91 STEC isolates “+”: Positive; “-”: Negative

Serogroups and virulence genotypes

By O-serotyping methods, a total of 30 categories of serogroups were determined for the 93 STEC isolates, and O100, O97, O91, O149, O26, O92, O102, O157, and O34 were the main serogroups (Fig. 2). There were 17 categories of serogroups identified among the bovine isolates (isolates from cow-associated samples), and 25 categories of serogroups among the porcine isolates (isolates from pig-associated samples) (Fig. 2, Table 1). Main serogroups among the porcine isolates were O100, O97, O149, O102, and O34. For bovine isolates, prevalent serogroups were O91, O97, O100, O157, and O26 (Fig. 2). In particularly, serogroup O157 was only detected in STEC strains originated from cows.
Fig. 2

Distribution of the O-antigens among the STEC isolates. Columns in pink displays the percentage of STECs isolated from the feces and intestinal contents of pigs; Columns in sky blue displays the percentage of STECs isolated from the feces of cows; Columns in gray displays the percentage of the total STECs isolated herein (STECs from pigs plus STECs from cows)

Distribution of the O-antigens among the STEC isolates. Columns in pink displays the percentage of STECs isolated from the feces and intestinal contents of pigs; Columns in sky blue displays the percentage of STECs isolated from the feces of cows; Columns in gray displays the percentage of the total STECs isolated herein (STECs from pigs plus STECs from cows) The positive rate of the four virulence associated genes (stx1, stx2, eae, ehxA, saa) among the 91 STEC isolates ranged from 6.59% (eae, 6/91) to 89.01% (stx2, 81/91) (Fig. 3a). The detection rates of the two Stx encoding genes stx1 and stx2 were 82.42% (75/91) and 89.01% (81/91), respectively. Among the stx1-positive isolates, stx1a was the most predominant subtype (78.67%, 59/75), followed by stx1c (17.33%, 13/75) and stx1d (4.00%, 3/75). For the stx2-positive isolates, stx2e was the most predominant subtype (56.79%, 46/81), followed by stx2b (17.28%, 14/81), stx2d (9.88%, 8/81), stx2a (7.14%, 6/81), stx2c (6.17%, 5/81) and stx2g (2.47%, 2/81). Stx1a (100%, 33/33) and stx2b (46.67%, 14/30) were the most predominant stx1 and stx2 subtypes for the bovine isolates while stx1a (61.90%, 26/42) and stx2e (91.20%, 46/51) were the most predominant stx1 and stx2 subtypes for the porcine isolates. Over 94.51% (86/91) of the isolates carried more than two types of virulence associated genes, and approximately 71.43% (65/91) of the isolates carried both stx1 and stx2, simultaneously (Fig. 3b). The percentages of the isolates carrying four types, three types, two types, and one type of the virulence genes detected were 18.68% (17/91), 58.24% (53/91), 17.58% (16/91), and 5.49% (5/91), respectively. Approximately 10.99% (10/91) of the isolates only carried stx1, and 17.58% (16/91) of the isolates only carried stx2.
Fig. 3

Distribution of main virulence genes (a) and their groups (b) among the STEC isolates. Panel a shows the distribution of main virulence genes while panel b shows the distribution of different groups of virulence genes. Columns in pink displays the percentage of STECs isolated from the feces and intestinal contents of pigs; Columns in sky blue displays the percentage of STECs isolated from the feces of cows; Columns in gray displays the percentage of the total STECs isolated herein (STECs from pigs plus STECs from cows)

Distribution of main virulence genes (a) and their groups (b) among the STEC isolates. Panel a shows the distribution of main virulence genes while panel b shows the distribution of different groups of virulence genes. Columns in pink displays the percentage of STECs isolated from the feces and intestinal contents of pigs; Columns in sky blue displays the percentage of STECs isolated from the feces of cows; Columns in gray displays the percentage of the total STECs isolated herein (STECs from pigs plus STECs from cows) In combination the serogroups with the virulence genes, isolates with different serogroups except O157 carried at least one Stx encoding gene (Table 1). In addition, all O100, O149, O26, O34, O91, and O97 isolates (the number of isolates with these serogroups is more than three) were negative to eae, while all O102, O149, O157, O26, and O34 isolates were PCR-negative for the presence of saa (Table 1).

Cytotoxicity

Cytotoxicity tests showed that all isolates positive to stx1 and/or stx2 were capable of making Vero cells rounding and exfoliation. However, no cytopathic effect was observed in the cells inoculated with the isolates negative to both stx1 and stx2.

Antimicrobial susceptibility

Antimicrobial susceptibility testing results showed that more than 50% of the STEC isolates were sensitive to ofloxacin (71.43%; 65/91), and norfloxacin (61.54%; 56/91). However, less than 10% of the isolates were sensitive to amoxicillin (7.69%; 7/91), ampicillin (4.40% 4/91), and kanamycin (4.40% 4/91). In particularly, all isolates were resistant to erythromycin (100%, 91/91) (Fig. 4). Most of the isolates from cattle feces were sensitive to norfloxacin (97.37%; 37/38), trimethoprim-sulfamethoxazole (84.21%, 32/38), and streptomycin (76.32%; 29/38). All isolates tested herein were sensitive to colistin; the MIC values were determined as ≤1 μg/ml. Approximately half of the bovine isolates were sensitive to sulfafurazole (55.26%; 21/38) and ofloxacin (47.37%; 18/38). For isolates from pigs, 88.68% (47/53) of the isolates were sensitive to ofloxacin. However, there were no isolates from pig intestines and/or feces sensitive to trimethoprim-sulfamethoxazole, streptomycin, sulfafurazole, neomycin, gentamicin, tetracycline, amoxicillin, ampicillin, kanamycin, and cefotaxime (Fig. 4).
Fig. 4

Antimicrobial susceptibility of the 91 STEC isolates. AMX: amoxicillin; AMP: ampicillin; SIX: sulfafurazole; STM: streptomycin; NRF: norfloxacin; GEN: gentamicin; TET: tetracycline; NEO: neomycin; DOX: doxycycline; SXT: trimethoprim-sulfamethoxazole; KAN: kanamycin; CFX: cefotaxime; ERY: erythromycin; OFX: ofloxacin. Columns in pink displays the percentage of STECs isolated from the feces and intestinal contents of pigs; Columns in sky blue displays the percentage of STECs isolated from the feces of cows; Columns in gray displays the percentage of the total STECs isolated herein (STECs from pigs plus STECs from cows)

Antimicrobial susceptibility of the 91 STEC isolates. AMX: amoxicillin; AMP: ampicillin; SIX: sulfafurazole; STM: streptomycin; NRF: norfloxacin; GEN: gentamicin; TET: tetracycline; NEO: neomycin; DOX: doxycycline; SXT: trimethoprim-sulfamethoxazole; KAN: kanamycin; CFX: cefotaxime; ERY: erythromycin; OFX: ofloxacin. Columns in pink displays the percentage of STECs isolated from the feces and intestinal contents of pigs; Columns in sky blue displays the percentage of STECs isolated from the feces of cows; Columns in gray displays the percentage of the total STECs isolated herein (STECs from pigs plus STECs from cows)

MLST genotypes

A total of 13 categories of sequence types (STs) were determined among the 91 STEC isolates using the MLST method (Fig. 5). Among these STs, ST297 (31.87%; 29/91) was the most frequent, followed by ST602 (14.29%; 13/91). The other determined STs included ST29 (12.09%; 11/91), ST1294 (8.79%; 8/91), ST101 (7.69%; 7/91), ST1623 (6.59%; 6/91), ST10 (5.49%; 5/91), ST813 (4.39%; 4/91), ST542 (2.20%; 2/91), ST1721 (2.20%; 2/91), ST26 (2.20%; 2/91), ST156 (1.10%; 1/91), and ST793 (1.10%; 1/91). For the 53 porcine isolates, a total of 11 types of STs were determined, and ST29 (20.75%; 11/53), ST602 (15.09%; 8/53), ST101 (13.21%; 7/53), ST297 (11.32%; 6/53), and ST1294 (11.32%; 6/53) were the common STs (Fig. 5). For the 38 bovine isolates, seven types of STs were identified, and ST297 (60.53%; 23/38), ST602 (13.16%; 5/38), ST542 (5.26%; 2/38), and ST1623 (10.53%; 4/38) were commonly present (Fig. 5).
Fig. 5

Distribution of the sequence types (STs) among the STEC isolates. Columns in pink displays the percentage of STECs isolated from the feces and intestinal contents of pigs; Columns in sky blue displays the percentage of STECs isolated from the feces of cows; Columns in gray displays the percentage of the total STECs isolated herein (STECs from pigs plus STECs from cows)

Distribution of the sequence types (STs) among the STEC isolates. Columns in pink displays the percentage of STECs isolated from the feces and intestinal contents of pigs; Columns in sky blue displays the percentage of STECs isolated from the feces of cows; Columns in gray displays the percentage of the total STECs isolated herein (STECs from pigs plus STECs from cows) Phylogenetic analysis showed that the MLST genotypes ST297, ST602, ST101, and ST26 displayed a relationship, and they also showed a close relatedness to the epidemic MLST genotypes ST678 (O104: H4) and ST17 (O45: H2) (Fig. 6). In addition, genotype ST29 was closely related to ST16 (O111: H8), ST21 (O26: H11; O145: H+), and ST723 (O103: H11) (Fig. 6).
Fig. 6

Phylogenetic analysis on different STEC sequence types clones. The tree was constructed based on the MLST data by MEGAX [26], using neighbor-joining algorithm with 1000 bootstrapping

Phylogenetic analysis on different STEC sequence types clones. The tree was constructed based on the MLST data by MEGAX [26], using neighbor-joining algorithm with 1000 bootstrapping

Discussion

STEC is a leading cause of foodborne and waterborne infections worldwide, food-producing animals such as cattle, and pigs are major reservoirs for STEC [23]. Among different kinds of food producing animals, cattle and other ruminants are considered to be the major reservoirs for STEC [23, 27, 28]. STEC strains are more frequently isolated from cattle and other ruminants than from other animals such as pigs, cats, and dogs [23, 29]. In agreement with these suggestions, the rate of STEC isolation from cattle (9.57%) was higher than that from pigs (5.81%). However, the isolate rate of STEC from cattle feces (9.57%) in present study is different from the reports from the other countries [2, 29]. These differences might be explained by differences in feed, seasonal peak, age, or detecting methods [2]. A total of 30 types of O-antigen were determined for the 91 STEC isolates by O-serotyping methods, with the exception of 4 isolates which were not typable (Fig. 2). This might be because there are only 50 types of O antisera are available, and these four strains do not react with the available antisera. Among these 30 categories of O-serogroups, the most frequently occurring serogroups were O100, O97, O91, O149, O26, O92, O102, O157, and O34 (Fig. 2). These serogroups have been isolated from pigs, cattle, sheep, and water in both China and the other countries [30-37]. It has been known that O157 is the most common serogroup that causes human illness in most parts of the world [4]. It has been also reported that cattle are the most common reservoir of E. coli O157 [38]. Corresponding to this suggestion, the O157 serogroup was only determined within the isolates from cattle in the present study (Fig. 2). Although there was no STEC O157 being isolated from pigs in Central China in the present study, a recent study has revealed that the overall prevalence of E. coli O157:H7 in pig farms around Hubei, a province located in Central China, is approximately 12.8% (16/125) [13]. These findings suggest that the prevalence of E. coli O157 in this region is still a problem. In addition to O157, O26 also displayed a high proportion of identification (Fig. 2). It is worthy of note that this type of O-antigen has been declared by the U.S. Department of Agriculture (USDA) as one of the “Big 6” (O26, O45, O103, O111, O121, and O145) non-O157 serogroups that are most commonly associated with severe illness in humans [4]. STEC O26 has been detected and isolated from diarrheal patient in China [11]. It should be noted that another member of the “Big 6”, the O145, was also identified in the present study (Fig. 2). In addition, STEC O149 has been also detected and isolated from diarrheal patient in China [11]. The determination of these non-O157 serogroups represents a great risk on public health and should also receive more attentions. Virulence genotyping based on the detection of six virulence genes (stx1, stx2, ehxA, eae, and saa) showed that the detection rates of stx1 (82.42%), stx2 (89.01%), and ehxA (86.81%) were higher than those of the other virulence genes (Fig. 3a); most of the STEC isolates possess stx1, stx2, and ehxA simultaneously (Fig. 3b). It is known that both stx1 and stx2 are responsible for encoding the Shiga toxin, which is the most important and common virulence factors of STEC [15]. In particular, the detection rate of stx2 (89.01%) was higher than stx1 (82.42%), and a small proportion of isolates (5.49%, 5/91) only carried stx2 (Fig. 3a and b). It has been reported that stx2 is more often associated with severe disease [39]. Therefore, those strains might be more harmful. Both Stx1 and Stx2 have several subtypes, and some subtypes are more frequently associated with human disease [4]. It has been widely documented that STEC isolates from pigs normally harbor Stx2e subtype [40-42], and in agreement with these studies [40-42], approximately 91.20% of the porcine isolates positive to stx2 determined in the present study harbored this subtype (Stx2e). STEC producing Stx2e is known to be closely associated with edema disease in pigs [43], the high proportion of stx2e detection in STEC isolates from pig intestines and/or feces in this study suggest a big threat to the pig health. Although Stx2e-producing STEC strains are still not proposed as pathogens for humans [43], active actions are still required to control and decrease the prevalence of such strains in pigs in a One Health perspective. In the present study, we also identified several other Stx-subtypes such as Stx1a, Stx1c, Stx1d, Stx2b, Stx2d, Stx2a, Stx2c, and Stx2g. Among these subtypes, stx2a and stx2c are proposed to be associated with high virulence and the ability to cause hemolytic-uremic syndrome (HUS), while stx2d, stx2e, stx1a, and stx1c occurred in milder or asymptomatic infections [43, 44]. The detection of those subtypes in STEC strains from food producing animals such as pigs and cows we detected in this study represents a high risk on public health. It is worthy of note that stx1d, stx2b, stx2g have been also detected in STEC strains from patients in Demark, however, HUS does not develop in these patients [45-47]. In addition to stx1 and stx2, the prevalence of ehxA (86.81%) was also very high, showing a good agreement with previously studies [48-51]. It is worthy of note that ehxA is generally used as a diagnostic indicator because the presence of ehxA is frequently correlated with the Shiga toxin [49, 51]. In agreement with this conclusion, ehxA displayed a high detection rate from the stx-positive STEC strains in the present study (Fig. 3b). In contrast to these genes which have high rates of detection, the detection rates of eae, and saa were relatively low. These results are similar to previously studies [50, 51], suggesting that these virulence genes are not common. However, their presence in particularly the detection of eae should be given a concern. It has been reported that the combination of eae and stx2 has an especial association with the development of HUS and bloody diarrhea [46, 47, 52]. In the present study, all eae-positive STEC strains isolated in Central China were detected to be positive for stx2 (Table 1). The determination of such strains represents a high risk on public health in this region. The antimicrobial resistance (AMR) of STEC is also a serious problem that the world is now facing. It has been reported that STEC isolates from both humans and food-producing animals displayed resistance most often to tetracycline, kanamycin, trimethoprim-sulfamethoxazole, streptomycin, amoxicillin, and ampicillin [36, 53–56]. In agreement with these studies, a low proportion of STEC isolates from the present study was susceptible to those types of antimicrobials (Fig. 4). These findings suggest a serious profile of AMR in STEC in food-producing animals. While there is a number of articles reporting the colistin resistance prevalence in E. coli [57-59], it is worthy of note that all STEC isolates were sensitive to colistin in the present study. MLST is also a strategy commonly used for STEC surveillance [36, 60]. In this study, 13 types of STs were determined for the 91 STEC isolates. In particularly, many isolates belonging to different STs possessed the same serogroups (Table 1). These findings are consistent with the findings of other publications [61, 62], suggesting that STEC isolates with the same serogroups might have genotypical diversity. Among the determined STs, ST297 possesses the highest rate of isolation (31.87%) compared to the remaining identified STs (Fig. 5). Interestingly, ST297 is rarely reported in STEC. A previous study determined five ST297 from 75 STEC food strains, with a detection rate of 6.67% [63]. In another study, the detection rate of ST297 among STEC isolates from cattle in Korea was only 4.69% (3/64) [64]. Our results are quite different from these studies, suggesting that the prevalence of the ST in different regions of the world might be different. The ST297 isolates harbored many types of O-antigens, including O26 and O145, the important members of the “Big 6” declared by the USDA [4]. In particular, all O26 isolates recovered in the present study are ST297 clone (Table 1). It has been reported that the STs of STEC O26 associated with a broad spectrum of diseases in Europe are ST29 and/or ST21 [65-70]. In addition, the ST297 clones isolated in this study displayed a close relationship to STEC ST678 (O104: H4) (Fig. 6). It should be noted that the STEC ST678 (O104: H4) isolates have caused the outbreak of human gastroenteritis and human hemolytic-uremic syndrome in Europe [8, 71]. In the next step, we intend to do follow up study to determine the genetic and phenotypical characteristics of these ST297 clones. In addition, the sequence types of the two STEC O157 were determined as ST542 (Table 1). Although the sequence type of STEC O157 is normally determined as ST11 [61, 72], O157 isolates determined as non-ST11 have been also documented elsewhere. For instance, four O157 isolates from the US and/or UK are determined as ST1804 [62]. These findings suggest there might be other STs for STEC O157. In the next step, we will do follow up study to determine the genetic and phenotypical characteristics of these two isolates.

Conclusions

In conclusion, the present study performed an isolation and a characteristic analysis of STEC from pigs and cattle. Our preliminary data revealed that a heterogeneous group of STEC is present, but the non-O157 serogroups and some ST clones such as ST297 should receive more attentions. In the next step, we intend to do a follow up study to correlate the pathogenicity of these STEC with the stx-subtypes as well as the ST clones.

Methods

Sample collection and bacterial isolation

A total of 1477 samples were tested in this study. These samples included intestinal contents from pigs with diarrhea (432 samples), fecal samples from pigs (480 samples) and cows (397 samples) with diarrhea, fresh milk (99 samples), and water samples from dairy farms (69 samples) (Fig. 1a). The 912 pig-associated samples (feces and intestinal contents) were collected from 323 pig farms in Central China (Hubei, Anhui, Hunan, Henan) between 2016 and 2017, while the 565 cow-associated samples (feces, milk, and water samples from dairy farms) were from three dairy farms in different regions Hubei Province in 2017 (Fig. 1a and b). Bacterial isolation was performed following a previously described protocol with some modifications [2]. In brief, each of the samples were mixed in sterilized 0.9% normal saline by vortexing. After a centrifugation at 500×g for 1 min, 500 μL of the supernatant of the mixture was inoculated into 5 mL modified E. coli broth (Nissui, Tokyo, Japan) and incubated at 37 °C for 18~24 h. After that, genomic DNA was extracted from the cultures by boiling 100 μL aliquot of each incubated broth directly, as described previously [2]. The extracted DNA was evaluated by electrophoresis on a 1% agarose gel and/or using a Nanodrop2000 (Thermo Scientific, Waltham, USA). Presence of the Stx encoding gene stx1 and/or stx2 was determined by PCR assays using the genomic DNA extracted herein as the template and the primers listed in Table 2. PCR reaction was performed in a 25 μL mixture containing 2 μL of the template DNA, 2.5 μL of 10× PCR Buffer (TAKARA, Japan), 2 μL of dNTP (TAKARA, Japan), 0.5 μL of rTaq (TAKARA, Japan), each of the forward and reverse primers 0.5 μL, and 17.0 μL of nucleotide-free water (TAKARA, Japan). Thermocycler conditions used for PCR were 95 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at different temperatures listed in Table 2 for 40 s, and extension at 72 °C for 1 min, with a final extension at 72 °C for 10 min before storage at 4 °C. DNA from STEC O157:H7 strain EDL933 and nucleotide-free water were included as positive and blank controls, respectively. The PCR product was visualized using 1% agarose gel electrophoresis under ultraviolet light.
Table 2

Primers used in this study

PrimersSequences (5′-3′)Annealing Temp. (°C)Product size (bp)FunctionReferences
Bacterial identification and virulence genotyping
 stx1-FACACTGGATGATCTCAGTGG60614Amplifying stx1Botteldoorn et al., 2003b
 stx1-RCTGAATCCCCCTCCATTATG
 stx2-FGGCACTGTCTGAAACTGCTCC64255Amplifying stx2Leung et al., 2001d
 stx2-RTCGCCAGTTATCTGACATTCTG
 16S-FATGGCTCAGATTGAACGC501505Amplifying 16 SrRNAREN et al., 2012g
 16S-RCAGGTTCCCCTACGGTTA
 eae-FGTGGCGAATACTGGCGAGACT64890Amplifying eaeNielsen et al., 2003e
 eae-RCCCCATTCTTTTTCACCGTCG
 ehxA-FGCATCATCAAGCGTACGTTCC60534Amplifying ehxABandyopadhyay et al., 2011a
 ehxA-RAATGAGCCAAGCTGGTTAAGCT
 saa-FCCTCACATCTTCTGCAAATACC601688Amplifying saaPaton et al., 2001f
 saa-RGTTGTCGTTCATATTTTACCATCCAATGGACATG
MLST genotyping
 Adk-F1TCATCATCTGCACTTTCCGC54583Amplifying adkDing et al., 2012c
 Adk-R1CCAGATCAGCGCGAACTTCA
 FumC-F1TCACAGGTCGCCAGCGCTTC54806Amplifying fumC
 FumC-R1GTACGCAGCGAAAAAGATTC
 GyrB-F1TCGGCGACACGGATGACGGC60911Amplifying gyrB
 GyrB-R1ATCAGGCCTTCACGCGCATC
 Icd-F1ATGGAAAGTAAAGTAGTTGTT CCGGCACA54878Amplifying icd
 Icd-R1GGACGCAGCAGGATCTGTT
 Mdh-F1ATGAAAGTCGCAGTCCTCGGC GCTGCTGGCGG60932Amplifying mdh
 Mdh-R1TTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT
 PurA-F1TCGGTAACGGTGTTGTGCTG54816Amplifying purA
 PurA-R1CATACGGTAAGCCACGCA GA
 RecA-F1CGCATTCGCTTTACCCTGACC58780Amplifying recA
 RecA-R1TCGTCGAAATCTACGGACCGGA
 Adk-F2TCATCATCTGCACTTTCCGCadk Sequencing
 Adk-R2CCAGATCAGCGCGAACTTCA
 FumC-F2TCACAGGTCGCCAGCGCTTCfumC Sequencing
 FumC-R2TCCCGGCAGATAAGCTGTGG
 GyrB-F2TCGGCGACACGGATGACGGCgyrB Sequencing
 GyrB-R2GTCCATGTAGGCGTTCAGGG
 Icd-F2ATGGAAAGTAAAGTAGTTGTTCCGGCACAicd Sequencing
 Icd-R2GGACGCAGCAGGATCTGTT
 Mdh-F2AGCGCGTTCTGTTCAAATGCmdh Sequencing
 Mdh-R2CAGGTTCAGAACTCTCTCTGT
 PurA-F2CGCGCTGATGAAAGAGATGApurA Sequencing
 PurA-R2CATACGGTAAGCCACGCAGA
 RecA-F2ACCTTTGTAGCTGTACCACGrecA Sequencing
 RecA-R2TCGTCGAAATCTACGGACCGGA

aBandyopadhyay S, Mahanti A, Samanta I, Dutta TK, Ghosh MK, Bera AK, Bandyopadhyay S, Bhattacharya D. Virulence repertoire of Shiga toxin-producing Escherichia coli (STEC) and enterotoxigenic Escherichia coli (ETEC) from diarrhoeic lambs of Arunachal Pradesh, India. Trop Anim Health Prod. 2011;43(3):705-10

bBotteldoorn N, Heyndrickx M, Rijpens N, Herman L. Detection and characterization of verotoxigenic Escherichia coli by a VTEC/EHEC multiplex PCR in porcine faeces and pig carcass swabs. Res Microbiol. 2003;154(2):97-104

cDing Y, Tang X, Lu P, Wu B, Xu Z, Liu W, Zhang R, Bei W, Chen H, Tan C. Clonal analysis and virulent traits of pathogenic extraintestinal Escherichia coli isolates from swine in China. BMC Vet Res. 2012;8:140

dLeung PH, Yam WC, Ng WW, Peiris JS. The prevalence and characterization of verotoxin-producing Escherichia coli isolated from cattle and pigs in an abattoir in Hong Kong. Epidemiol Infect. 2001;126(2):173-9

eNielsen EM, Andersen MT. Detection and characterization of verocytotoxin-producing Escherichia coli by automated 5' nuclease PCR assay. J Clin Microbiol. 2003;41(7):2884-93

fPaton AW, Srimanote P, Woodrow MC, Paton JC. Characterization of Saa, a novel autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect Immun. 2001;69(11):6999-7009

gREN L, YU X, SONG D, ZHEN K, QIN Y, WANG Y. Isolation, identification and phylogenetic analysis of E. coli from Yaks. China Animal Husbandry & Veterinary Medicine. 2012;39(1): 168-171

Primers used in this study aBandyopadhyay S, Mahanti A, Samanta I, Dutta TK, Ghosh MK, Bera AK, Bandyopadhyay S, Bhattacharya D. Virulence repertoire of Shiga toxin-producing Escherichia coli (STEC) and enterotoxigenic Escherichia coli (ETEC) from diarrhoeic lambs of Arunachal Pradesh, India. Trop Anim Health Prod. 2011;43(3):705-10 bBotteldoorn N, Heyndrickx M, Rijpens N, Herman L. Detection and characterization of verotoxigenic Escherichia coli by a VTEC/EHEC multiplex PCR in porcine faeces and pig carcass swabs. Res Microbiol. 2003;154(2):97-104 cDing Y, Tang X, Lu P, Wu B, Xu Z, Liu W, Zhang R, Bei W, Chen H, Tan C. Clonal analysis and virulent traits of pathogenic extraintestinal Escherichia coli isolates from swine in China. BMC Vet Res. 2012;8:140 dLeung PH, Yam WC, Ng WW, Peiris JS. The prevalence and characterization of verotoxin-producing Escherichia coli isolated from cattle and pigs in an abattoir in Hong Kong. Epidemiol Infect. 2001;126(2):173-9 eNielsen EM, Andersen MT. Detection and characterization of verocytotoxin-producing Escherichia coli by automated 5' nuclease PCR assay. J Clin Microbiol. 2003;41(7):2884-93 fPaton AW, Srimanote P, Woodrow MC, Paton JC. Characterization of Saa, a novel autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect Immun. 2001;69(11):6999-7009 gREN L, YU X, SONG D, ZHEN K, QIN Y, WANG Y. Isolation, identification and phylogenetic analysis of E. coli from Yaks. China Animal Husbandry & Veterinary Medicine. 2012;39(1): 168-171 In the next step, bacterial cultures positive to at least one of stx1 and stx2 were streak-plated onto sorbitol MacConkey agar (Hangzhou Microbial Reagent CO., LTD, Hangzhou, China), and incubated at 37 °C for 18~24 h. After this stage, the isolates were purified and cultured following the standard methods used for bacterial identification [73]. Presumptive isolates of E. coli were finally confirmed via Galanz staining, biochemical testing, and 16S rRNA amplification and sequencing.

Serotyping and virulence genotyping

O-polysaccharide antigens serogroups of STEC isolates were determined by Slide agglutination test based on the reaction of the bacterial strains against the 50 kinds of O antisera purchased from China Institute of Veterinary Drug Control (Beijing, China). STEC O157:H7 strain EDL933 was used as positive control. Virulence genotyping was performed by PCR assays amplifying another three virulence associated genes eae, ehxA, and saa of with primers listed in Table 2. The PCR volume and procedure were the same as that used for determining the Stx encoding genes. Positive and blank control samples were included in each set of reactions. The PCR product was visualized using 1% agarose gel electrophoresis under ultraviolet light. The stx subtypes (stx1a, stx1c, stx1d, stx2a, stx2b, stx2c, stx2d, stx2e, stx2f, stx2g) were also determined by PCR assays with primers and reaction procedures described previously [16]. Vero cells (purchased from ATCC) were used to test the cytotoxicity of the STEC strains isolated herein. In brief, isolates were inoculated in Luria-Bertani (LB) broth (Sigma-Aldrich, MO) and shaken at 37 °C for 18~24 h. Bacterial culture were then centrifuged at 20000×g for 40 min, followed by a filtration through a 0.22 μm membrane. Filtrate was inoculated into Vero cells and the cells were incubated at 37 °C for 18~24 h to observe the morphology. Filtrates collected from STEC O157:H7 strain EDL933, E. coli DH5α, cell medium were included as controls.

Antimicrobial susceptibility tests

Antimicrobial susceptibility of the STEC isolates was determined by using the disc diffusion method, following the protocols recommended by Clinical and Laboratory Standards Institute [74]. A total of 14 types of antibiotics including amoxicillin (AMX), ampicillin (AMP), sulfafurazole (SIX), streptomycin (STM), norfloxacin (NRF), gentamicin (GEN), tetracycline (TET), neomycin (NEO), doxycycline (DOX), trimethoprim-sulfamethoxazole (SXT), kanamycin (KAN), cefotaxime (CFX), erythromycin (ERY), and ofloxacin (OFX) were tested. Results were interpreted using the CLSI breakpoints, when available. Resistance to colistin was also tested using broth microdilution method, as recommended by CLSI [74]. Colistin with final concentrations of 1 μg/mL, 2 μg/mL, and 4 μg/mL was made in a 96-well plate in pre-reduced supplemented Mueller-Hinton (MH) broth (Hopebio, Qingdao, China). Interpretation of testing results was based on EUCAST breakpoint (> 2 μg/mL), as the CLSI document (VET01S) does not provide a breakpoint for interpretation of colistin. Each antibiotic was tested with three duplicates. E. coli ATCCR 25922 was used as quality control.

Multilocus sequence typing

Multilocus sequence typing (MLST) was performed using the previously described protocols [60]. Nucleotide sequences of seven housekeeping genes (adk, fumC, gyrB, icd, mdh, purA, and recA) were amplified and sequenced using the primers listed in Table 2. PCR reaction was performed in a 50-μl reaction mixture containing 2 μl of the template DNA, 2 μL of dNTP mixture (TAKARA, Japan), 5 μL of 10 × PCR buffer (TAKARA, Japan), 0.5 μL of rTaq polymerase (TAKARA, Japan), each of the forward and reverse primer 1 μL, and 38.5 μL of nuclease-free water. The reaction was performed under the following standard cycling procedure: an initial denaturation at 95 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 54–60 °C for 45 s (see Table 2), extension at 72 °C for 1 min, and a final extension at 72 °C for 10 min. The PCR products were initially analyzed by electrophoresis on a 1% agarose gel. Products with the correct size were sequenced at Sangon (Shanghai, China). Nucleotide sequences of the housekeeping genes were submitted to the Escherichia coli MLST Database (http://mlst.warwick.ac.uk/mlst/dbs/Ecoli) to determine the sequence types automatically. Phylogenetic tree was generated based on the MLST data by MEGAX [26], using neighbor-joining algorithm with 1000 bootstrapping.
  71 in total

1.  Escherichia coli harboring Shiga toxin 2 gene variants: frequency and association with clinical symptoms.

Authors:  Alexander W Friedrich; Martina Bielaszewska; Wen-Lan Zhang; Matthias Pulz; Thorsten Kuczius; Andrea Ammon; Helge Karch
Journal:  J Infect Dis       Date:  2001-12-14       Impact factor: 5.226

2.  MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms.

Authors:  Sudhir Kumar; Glen Stecher; Michael Li; Christina Knyaz; Koichiro Tamura
Journal:  Mol Biol Evol       Date:  2018-06-01       Impact factor: 16.240

3.  Prevalence and characteristics of shiga toxin-producing Escherichia coli from healthy cattle in Japan.

Authors:  H Kobayashi; J Shimada; M Nakazawa; T Morozumi; T Pohjanvirta; S Pelkonen; K Yamamoto
Journal:  Appl Environ Microbiol       Date:  2001-01       Impact factor: 4.792

4.  Characterization of Shiga toxin-producing Escherichia coli strains isolated from swine feces.

Authors:  Pina M Fratamico; Arvind A Bhagwat; Lisa Injaian; Paula J Fedorka-Cray
Journal:  Foodborne Pathog Dis       Date:  2008-12       Impact factor: 3.171

5.  Comparison of enrichment procedures for shiga toxin-producing Escherichia coli in wastes from commercial swine farms.

Authors:  Michael A Grant; Mark A Mogler; Delbert L Harris
Journal:  J Food Prot       Date:  2009-09       Impact factor: 2.077

6.  Close association of verotoxin (Shiga-like toxin) production with enterohemolysin production in strains of Escherichia coli.

Authors:  L Beutin; M A Montenegro; I Orskov; F Orskov; J Prada; S Zimmermann; R Stephan
Journal:  J Clin Microbiol       Date:  1989-11       Impact factor: 5.948

7.  Pro-inflammatory capacity of Escherichia coli O104:H4 outbreak strain during colonization of intestinal epithelial cells from human and cattle.

Authors:  S Stalb; S A Barth; K Sobotta; E Liebler-Tenorio; L Geue; C Menge
Journal:  Int J Med Microbiol       Date:  2018-06-19       Impact factor: 3.473

Review 8.  Animals as sources of food-borne pathogens: A review.

Authors:  Norma Heredia; Santos García
Journal:  Anim Nutr       Date:  2018-05-04

9.  Shiga toxin-producing E. coli (STEC) in swine: prevalence over the finishing period and characteristics of the STEC isolates.

Authors:  M Tseng; P M Fratamico; L Bagi; D Manzinger; J A Funk
Journal:  Epidemiol Infect       Date:  2014-05-08       Impact factor: 4.434

Review 10.  Advances in Molecular Serotyping and Subtyping of Escherichia coli.

Authors:  Pina M Fratamico; Chitrita DebRoy; Yanhong Liu; David S Needleman; Gian Marco Baranzoni; Peter Feng
Journal:  Front Microbiol       Date:  2016-05-03       Impact factor: 5.640

View more
  6 in total

1.  Isolation of Three Coliphages and the Evaluation of Their Phage Cocktail for Biocontrol of Shiga Toxin-Producing Escherichia coli O157 in Milk.

Authors:  Lili Zhu; Yanyan Hou; Xi Huang; Shuang Wang; Rui Xie; Jie Yang; Qingjie Lv; Lin Hua; Wan Liang; Zhong Peng; Bin Wu
Journal:  Curr Microbiol       Date:  2022-06-09       Impact factor: 2.188

2.  Molecular Detection of Non-O157 Shiga Toxin-Producing Escherichia coli (STEC) Directly from Stool Using Multiplex qPCR Assays.

Authors:  Michael Bording-Jorgensen; Brendon Parsons; Jonas Szelewicki; Colin Lloyd; Linda Chui
Journal:  Microorganisms       Date:  2022-01-31

3.  Genomic Analysis of an I1 Plasmid Hosting a sul3-Class 1 Integron and blaSHV-12 within an Unusual Escherichia coli ST297 from Urban Wildlife.

Authors:  Ethan R Wyrsch; Monika Dolejska; Steven P Djordjevic
Journal:  Microorganisms       Date:  2022-07-10

4.  Multiplex PCR Assays for the Detection of One Hundred and Thirty Seven Serogroups of Shiga Toxin-Producing Escherichia coli Associated With Cattle.

Authors:  Justin B Ludwig; Xiaorong Shi; Pragathi B Shridhar; Elisabeth L Roberts; Chitrita DebRoy; Randy K Phebus; Jianfa Bai; T G Nagaraja
Journal:  Front Cell Infect Microbiol       Date:  2020-07-29       Impact factor: 5.293

5.  Genomic Epidemiology of Shiga Toxin-Producing Escherichia coli Isolated from the Livestock-Food-Human Interface in South America.

Authors:  Nicolás Galarce; Fernando Sánchez; Beatriz Escobar; Lisette Lapierre; Javiera Cornejo; Raúl Alegría-Morán; Víctor Neira; Víctor Martínez; Timothy Johnson; Danny Fuentes-Castillo; Elder Sano; Nilton Lincopan
Journal:  Animals (Basel)       Date:  2021-06-22       Impact factor: 2.752

6.  O-Serogroups and Pathovirotypes of Escherichia coli Isolated from Post-Weaning Piglets Showing Diarrhoea and/or Oedema in South Korea.

Authors:  Jae-Won Byun; Bo-Youn Moon; Kyung-Hyo Do; Kichan Lee; Hae-Yeong Lee; Won-Il Kim; ByungJae So; Wan-Kyu Lee
Journal:  Vet Sci       Date:  2021-12-21
  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.