| Literature DB >> 31766667 |
Almudena Urbieta-Magro1, Mariano Higes1, Aránzazu Meana2, Laura Barrios3, Raquel Martín-Hernández1,4.
Abstract
The microsporidian parasite Nosema ceranae is a highly prevalent, global honey bee pathogen. Apis mellifera is considered to be a relatively recent host for this microsporidia, which raises questions as to how it affects its host's physiology, behavior and longevity, both at the individual and colony level. As such, honey bees were inoculated with fresh purified spores of this pathogen, both individually (Group A) or collectively (Group B) and they were studied from 0 to 15 days post-emergence (p.e.) to evaluate the effect of bee age and the method of inoculation at 7 days post-infection. The level of infection was analyzed individually by qPCR by measuring the relative amount of the N. ceranae polar tubule protein 3 (PTP3) gene. The results show that the bee's age and the method of infection directly influence parasite load, and thus, early disease development. Significant differences were found regarding bee age at the time of infection, whereby the youngest bees (new-born and 1 day p.e.) developed the highest parasite load, with this load decreasing dramatically in bees infected at 2 days p.e. before increasing again in bees infected at 3-4 days p.e. The parasite load in bees infected when older than 4 days p.e. diminished as they aged. When the age cohort data was pooled and grouped according to the method of infection, a significantly higher mean concentration and lower variation in N. ceranae infection was evident in Group A, indicating greater variation in experimental infection when spores were administered collectively to bees through their food. In summary, these data indicate that both biological and experimental factors should be taken into consideration when comparing data published in the literature.Entities:
Keywords: Apis mellifera; Nosema ceranae; age of infection; epidemiology; host-parasite interactions; method of infection; parasite load
Year: 2019 PMID: 31766667 PMCID: PMC6956240 DOI: 10.3390/insects10120417
Source DB: PubMed Journal: Insects ISSN: 2075-4450 Impact factor: 2.769
Total number of bees in each cohort and infection type.
| Experimental Design | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 90 | 60 | 60 | - | 60 | 60 | 60 | 60 | 60 | 60 | 60 | 60 | 60 | 60 | 60 | 60 | - |
|
| 20 | 20 | - | - | 20 | 20 | - | - | 20 | - | - | 20 | - | 20 | 20 | - | - |
|
| - | 20 | 20 | 20 | - | - | 20 | 20 | 20 | 20 | 20 | 20 | - | 20 | 20 | 20 | 20 |
|
| - | 20 | - | - | - | - | - | 20 | 20 | - | 20 | 20 | - | - | 20 | - | - |
Group A, individually infected bees (n = 20 bees × 3 cages), Group B, collectively infected bees (n = 20 bees × 1 cage) and uninfected control Groups: CA (individually fed with spore-free water) and CB (collectively fed with the plain sucrose solution). Hyphen (-) indicates bees not available. The bees that died were removed from the study.
PTP3 gBlock® Gene Fragment.
| Method | Organism |
| Source |
|---|---|---|---|
| qPCR |
| 5′_TGAAGCTAAAAAAGAAGAACAACTTGACCAAATAGCTAAAAAGAATGCAGAGACAGAGAAACAACACAGAGAGGTACTTCTCAAAGAACATCAAGA | gi|557790804|gb|KC520145.1| |
A 281 nucleotide fragment of the N. ceranae genome including the NC-PTP3 primer sequences (underlined in bold), and the sequence of the UPL#72 probe in bold and lowercase.
Number of bees and the percentage of bees infected by N. ceranae at 7 days post-inoculation (p.i.).
| Infected Bees (7 Days p.i.) | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| |
|
| n | 30 | 30 | 24 | - | 30 | 30 | 30 | 30 | 21 | 30 | 30 | 30 | 30 | 30 | 30 | 19 * | - |
| qPCR+ | 30 | 29 | 24 | - | 30 | 30 | 30 | 30 | 21 | 30 | 30 | 30 | 30 | 30 | 30 | 19 | - | |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| |
|
| n | - | 10 | 10 | 10 | - | - | 10 | 10 | 10 | 10 | 10 | 10 | - | 10 | 10 | 10 | 10 |
| qPCR+ | - | 10 | 9 | 10 | - | - | 10 | 10 | 9 | 10 | 9 | 8 | - | 5 | 8 | 1 | 10 | |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| |
Group A, bees infected individually with N. ceranae spores; (*) n < 30 bees due to the high accumulated mortality of the bees at 7 days p.i. Group B, bees infected collectively with the same spores. All control bees analyzed (Group CA and Group CB) were negative for N. ceranae infection and they are not shown in the table. n: number of samples analyzed. qPCR +: indicates number of positive samples.
Figure 1Average concentration of the N. ceranae-PTP3 DNA (µg/µL) in Group A bees 7 days p.i. The letters (a, b) indicate statistical significance p < 0.05 (Mann-Whitney-U test). *: extreme cases (any value > Q1 − 1.5 * IQR or > Q3 + 1.5 * IQR; Q: quartile; IQR: interquartile range). o: very unlikely cases (any value > Q1 – 3 * IQR or > Q3 + 3 * IQR; Q: quartile; IQR: interquartile range). Extreme cases and very unlikely cases were calculated separately within each age. nd: no data.
Figure 2Average concentration of the N. ceranae-PTP3 DNA (µg/µL) 7 days after the collective infection of the bees in Group B: *: extreme cases (any value > Q1 − 1.5 * IQR or > Q3 + 1.5 * IQR; Q: quartile; IQR: interquartile range). o: very unlikely cases (any value > Q1 − 3 * IQR or > Q3 + 3 * IQR; Q: quartile; IQR: interquartile range). Extreme cases and very unlikely cases were calculated separately within each age. nd: no data. As indicated, bees were exposed collectively to the N. ceranae spores on day 0 p.e. and analyzed 24 h later (after consuming the contaminated food).