| Literature DB >> 31766638 |
Chunxiao Mou1, Minmin Wang1, Shuonan Pan1, Zhenhai Chen1,2,3.
Abstract
Porcine circovirus type 3 (PCV3) contains two major open reading frames (ORFs) and the ORF2 gene encodes the major structural capsid protein. In this study, nuclear localization of ORF2 was demonstrated by fluorescence observation and subcellular fractionation assays in ORF2-transfected PK-15 cells. The subcellular localization of truncated ORF2 indicated that the 38 N-terminal amino acids were responsible for the nuclear localization of ORF2. The truncated and site-directed mutagenesis of this domain were constructed, and the results demonstrated that the basic amino acid residues at positions 8-32 were essential for the strict nuclear localization. The basic motifs 8RRR-R-RRR16 and 16RRRHRRR22 were further shown to be the key functional nucleolar localization signals that guide PCV3 ORF2 into nucleoli. Furthermore, sequence analysis showed that the amino acids of PCV3 nuclear localization signals were highly conserved. Overall, this study provides insight into the biological and functional characteristics of the PCV3 ORF2 protein.Entities:
Keywords: ORF2 protein; nuclear localization signal; porcine circovirus type 3
Mesh:
Substances:
Year: 2019 PMID: 31766638 PMCID: PMC6950156 DOI: 10.3390/v11121086
Source DB: PubMed Journal: Viruses ISSN: 1999-4915 Impact factor: 5.048
Oligonucleotides.
| Name | Oligonucleotide Sequence in 5′–3′ Direction | Restriction Site |
|---|---|---|
| pEGFP-ORF2 F | CTC | |
| pEGFP-ORF2 R | GGT | |
| pEGFP-ORF2-1 R | GGT | |
| pEGFP-ORF2-2 F | CTC | |
| pEGFP-ORF2-2 R | GGT | |
| pEGFP-ORF2-3 F | CTC | |
| pEGFP-ORF2-3 R | GGT | |
| pEGFP-ORF2-4 F | CTC | |
| pEGFP-ORF2-1-1 F | ||
| pEGFP-ORF2-1-1 R | ||
| pEGFP-ORF2-1-2 F | ||
| pEGFP-ORF2-1-2 R | ||
| pEGFP-ORF2-1-3 F | ||
| pEGFP-ORF2-1-3 R | ||
| pEGFP-ORF2-1-4 F | ||
| pEGFP-ORF2-1-4 R | ||
| pEGFP-ORF2-1-5 F | ||
| pEGFP-ORF2-1-5 R | ||
| pEGFP-ORF2-1-6 F | ||
| pEGFP-ORF2-1-6 R | ||
| pEGFP-ORF2-1-7 F | ||
| pEGFP-ORF2-1-7 R | ||
| pEGFP-ORF2-1-8 F | ||
| pEGFP-ORF2-1-8 R | ||
| pEGFP-ORF2-1-9 F | ||
| pEGFP-ORF2-1-9 R | ||
| pEGFP-ORF2-1-10 F | ||
| pEGFP-ORF2-1-10 R | ||
| pEGFP-ORF2-1-11 F | ||
| pEGFP-ORF2-1-11 R | ||
| pEGFP-ORF2-1-12 F | ||
| pEGFP-ORF2-1-12 R | ||
| pEGFP-ORF2-1-13 F | ||
| pEGFP-ORF2-1-13 R | ||
| pEGFP-ORF2-1-14 F | ||
| pEGFP-ORF2-1-14 R | ||
| pEGFP-ORF2-1-15 F | ||
| pEGFP-ORF2-1-15 R | ||
| pEGFP-ORF2-1-16 F | ||
| pEGFP-ORF2-1-16 R | ||
| pEGFP-ORF2-∆NLS 2,3 F1 | AAGACCCCGCCCAAGCCCACAGCTGGCACATAC | |
| pEGFP-ORF2-∆NLS 2,3 F2 | GAGACACAGAGCTATATTCAGAAGAAGACCCCGCCCAAG | |
| pEGFP-ORF2-∆NLS 1,3 F1 | CGACGACGCCACAGAAGGCGCCCCACAGCTGGCACATAC | |
| pEGFP-ORF2-∆NLS 1,3 F2 | CACAGAGCTATATTCCGACGACGCCACAGA | |
| pEGFP-ORF2-∆NLS 1,2 F | CACAGAGCTATATTCAGGCGCTATGTCAGA | |
| pEGFP-ORF2-∆NLS 1,2,3 F | CACAGAGCTATATTCCCCACAGCTGGCACATAC |
The nucleotides of restriction sites are underlined and mutants are bolded.
Figure 1The localization of nuclear localization signals (NLSs) in ORF2. (A) Recombinant plasmids containing ORF2 or truncated ORF2 fragments with EGFP in the N-terminus were constructed. The subcellular localization of fusion proteins is indicated by N (nuclear) or C (cytoplasmic). (B) The localization of fusion proteins in transfected cells was observed by confocal microscopy. Scale bars = 20 μm. (C) and (D) Transfected cells were subjected to nuclear and cytoplasmic extraction. The abundance of expressed proteins in the nuclear and cytoplasmic extracts were detected by western blot. Nuclear/cytoplasmic distribution of the expressed proteins was further analyzed through densitometric quantification using Image-Pro software, data from three independent experiments are shown on the graph as the average ± standard error. One-way ANOVA; ** p < 0.01.
Figure 2The NLS motifs in ORF2-1. (A) pEGFP-ORF2-1-1 (1–10 aa), pEGFP-ORF2-1-2 (8–22 aa), pEGFP-ORF2-1-3 (23–38 aa) were constructed and predicted NLSs were listed. (B) PK-15 cells were transfected with recombinant plasmids and observed by confocal microscopy after 24 h. Scale bars = 20 μm. (C) and (D) The nucleus and cytoplasm were extracted from the transfected PK-15 cells, and the abundance of expressed proteins in the extracts were detected by western blot after nuclear and cytoplasmic extraction, nuclear/cytoplasmic distribution of the expressed proteins was analyzed through densitometric quantification using Image-Pro software, data from three independent experiments are shown on the graph as the average ± standard error. One-way ANOVA; ** p < 0.01.
Figure 3The main nucleolar localization signal motifs in ORF2-1-2. (A) Mutants of ORF2-1-2 gene were inserted into pEGFP-C3 and predicted nucleolar localization signal motifs are underlined. (B) PK-15 cells were transfected with plasmids, after 24 h, the cells were fixed and the localization of fusion proteins was observed by confocal microscopy. Scale bars = 20 μm.
Figure 4The key amino acids of NLS in ORF2-1-3. (A) Mutants of ORF2-1-3 gene were inserted into pEGFP-C3, and the key amino acids predicted in ORF2-1-3 are listed by underline. (B) PK-15 cells were transfected with mutant plasmids, and the localization of fusion proteins was observed by confocal microscopy. Scale bars = 20 μm. (C) and (D) After 24 h, the nucleus and cytoplasm in transfected cells were extracted and the expressed proteins were determined by western blot. Nuclear/cytoplasmic distribution of the expressed proteins was further analyzed through densitometric quantification using Image-Pro software, data from three independent experiments are shown on the graph as the average ± standard error. One-way ANOVA; ** p < 0.01.
Figure 5The map of NLSs in ORF2. (A) The main motifs of the NLSs in the N-terminal ORF2 (1–38 aa) are bold and the three NLSs are listed. (B) A sketch of the ORF2 indicating putative NLSs motifs by red boxes is shown, and the mutated fragments of the ORF2 are shown. (C) PK-15 cells were transfected with plasmids carrying mutated ORF2 gene (pEGFP-ORF2-∆NLS 2,3, pEGFP-ORF2-∆NLS 1,2, pEGFP-ORF2-∆NLS 1,3, and pEGFP-ORF2-∆NLS 1,2,3) to analyze their subcellular location. Subcellular localization of green fusion proteins was analyzed by confocal microscopy. Scale bars = 20 μm.
Figure 6The variability of PCV3-ORF2 NLSs. (A) Logo of the N-terminal of all PCV3 ORF2 proteins (1–40 aa) reported and their complementary sequences, the nuclear localization signal peptide is showed by red ◊. (B) The NLSs sequence alignment between PCV3 ORF2 and other PCVs is showed and the key amino acids are bold.