Since the discovery and extensive utilization of antibiotics, multidrug-resistant strain of Staphylococcus aureus has emerged. Originally, methicillin-resistant S. aureus (MRSA) was discovered in hospitals in the 1960s, which then spread worldwide in community and hospitals in the 1990s, creating reservoirs in both settings [1]. Various infections, ranging from minor skin infections to severe diseases, such as urinary tract infections (UTIs), toxic shock, septicemia, and endocarditis, could be caused by S. aureus. The adaptive power of S. aureus to antibiotics produced to the emergence of MRSA. MRSA strain is characterized by its potential to express many virulence factors such as Panton-Valentine leukocidin (PVL). Thus, MRSA is one of the important pathogens implicated in hospital-acquired infection. S. aureus is an important pathogen responsible for both nosocomial and community-acquired infections in people and also causes common diseases in animals, especially mastitis. This ubiquitous organism is carried asymptomatically in 20-30% of the human population [2].It can lead to a wide range of maladies such as skin and soft tissue infections, mastitis, bone, joint and implant infections, pneumonia, and septicemia. It might be the cause of similar diseases in animals; however, is most economically significant as a cause of bovine mastitis (BM) [3]. The extensive use of antibiotics that accounted for the hasty dissemination of antibiotic resistance in S. aureus has become a global concern; the most notable example of this phenomenon is MRSA. The first clinical isolate of MRSA was confirmed in 1961, just 1 year after the launch of methicillin, and in the 1980s, it became a widespread health-care concern [3,4]. Methicillin resistance may be attributed to a penicillin-binding protein (PBP) 2a with an altered β-lactam affinity [5,6]. The mecA gene encodes for PBP 2a protein, which is carried by a mobile element “Staphylococcal chromosomal cassette (SCC)” and used as a molecular marker for MRSA [7]. Simultaneously, certain factors essential for methicillin resistance (fem) [8] are found in both methicillin-susceptible and MRSA. The part of fem’s factor that combines physically distant from SCC affects the level of the resistance [9]. Integration of the mec complex and neighboring regions into an SCC element was one of the factors contributing to the evolution of mecA-mediated β-lactam resistance in Staphylococci [10]. MRSA was phenotypically detected in 68.7% of samples obtained from cattle with mastitis while the methicillin-susceptible S. aureus was detected in 31.3% of these samples. Genotypic analysis revealed that 54.5% phenotypically methicillin resistance isolates were mecA gene positive, while 45.5% of the isolates were mecA gene negative [11]. This organism is one of the important pathogens in hospital-acquired infection. It has developed resistance to a wide range of antimicrobial drugs, which complicates the treatment of infections. In particular, MRSA has become a disreputable etiological agent for several infections and among the foremost necessary health facility pathogens worldwide [12]. S. aureus is characterized by its several specific virulence factors. The PVL is a major virulence factor related to death lesions of the skin and body covering tissues (e.g., furuncles) and also with community-acquired severe necrotic pneumonia [13]. In humans, S. aureus is found in the anterior nares. Nasal carriage of these organisms in hospital staff is a potential source for infection in hospitalized patients, and elimination of nasal carriage has been reported to reduce the incidence of S. aureus infections. The antimicrobial resistance profile of human S. aureus is of great public health concern, especially in developing countries where health facilities are inadequate [14].This study aimed to detect the prevalence of S. aureus and the frequency of methicillin-resistant genes and the prevalence of UTI in human and BM caused by S. aureus.
Materials and Methods
Ethical approval
The Animal Ethical Committee of the College of Veterinary Medicine, University of Al-Qadisiyah, Iraq, has approved this study.
Samples
Samples were obtained from 72 individuals suffering from UTI at the hospital in Al-Qadisiyah Governorate during January 2016-March 2016, and at the same time, samples were also obtained from 30 cows having acute mastitis.
Bacterial diagnosis
Bacterial isolates were identified based on cultural and biochemical criteria. The method followed was adapted from a previous study that reported that VITEK2 cards inoculated with fluids sampled directly from culture bottles are suitable for speedy identification and susceptibility testing [15]. A sterile swab or applicator stick was used to transfer a sufficient number of colonies of a pure culture in 3.0 mL of sterile saline (0.45% NaCl, pH 4.5-7.0) in a 12×75 mm clear plastic (polystyrene) test tube. The turbidity was adjusted to 0.50-0.63 Mf and measured using a turbidity meter known as DensiChek [15]. Results were read overnight.
Molecular detection of virulence genes
Multiplex polymerase chain reaction (PCR) was performed to amplify target genes using primers for the following genes: femA (specific for S. aureus), mecA gene (encoding PBP 2a), and lukS (responsible for the production of PVL). The sequences of these primers are listed in Table-1 [16,17].
Table 1
Sequences of primers used for multiplex PCR.
Product genes
Primer name
5’–3’
Size (bp)
Reference
femA
femA-FfemA-R
CGATCCATATTTACCATATCA ATCACGCTCTTCGTTTAGTT
450
[17]
mecA
mecA-FmecA-R
ACGAGTAGATGCTCAATATAA CTTAGTTCTTTAGCGATTGC
293
lukS
lukS-FlukS-R
CAGGAGGTAATGGTTCATTT ATGTCCAGACATTTTACCTAA
151
PCR=Polymerase chain reaction
Sequences of primers used for multiplex PCR.PCR=Polymerase chain reaction
DNA extraction of bacterial genome
Fresh bacterial genomic DNA of S. aureus was extracted from nutrient broth samples using Presto™ Mini Genomic DNA Bacteria Kit (Geneaid, China), according to a previously described method [17]. The extracted DNA was validated by Nanodrop spectrophotometer and stored at −20°C in the refrigerator until further usage.
Polymerase chain reaction (PCR)
The femA gene (specific to S. aureus species), mecA gene (encoding PBP 2a), and lukS gene (responsible for the production of PVL) were detected using multiplex PCR. The primers were prepared by Bioneer, Korea.
DNA sequencing
DNA sequencing was performed for confirmative detection of S. aureus strain; based on positive detection of femA and mecA, two isolates were obtained from humans and one from cattle, and the respective PCR products were purified from agarose gel. The purified femA and mecA fractions were sent to Bioneer, Korea, for DNA sequencing using Applied Biosystems DNA sequencing system. The genomic sequences were assembled and submitted in GenBank-National Center for Biotechnology Information followed by multiple sequence alignment using Basic Local Alignment Search Tool for phylogenetic tree construction and phylogenetic analysis by MEGA10 program (https://www.megasoftware.net/).
Results
Culture and biochemical evaluation of the samples revealed the presence of S. aureus with positive detection of mecA, femA, and lukS, respectively, in 68 (94.4%), 36 (50%), and 20 (27.7%) of samples isolated from methicillin-resistant human samples. Similarly, mecA, femA, and lukS were positively detected, respectively, in 27 (90%), 14 (46.7%), and 11 (36.7%) of samples isolated from methicillin-resistant cattle. The MRSA was confirmed by the detection of mecA gene, considered as a genotyping marker, in 68 of 72 (94.4%) samples, while the remaining four isolates were methicillin-sensitive S. aureus, although these were methicillin-resistant phenotypically. The multiplex PCR revealed significant differences in the band sizes of mecA, femA, and lukS (450, 293, and 151 bp, respectively) as illustrated in Figure-1.
Figure-1
Multiplex polymerase chain reaction for the detection of three genes: femA (450 bp), mecA (293 bp), and lukS (151 bp).
Multiplex polymerase chain reaction for the detection of three genes: femA (450 bp), mecA (293 bp), and lukS (151 bp).The results of nucleotide sequencing of human and cattle MRSA isolates revealed the sequences of targeted genes (mecA and femA partial gene) that were recorded in Genbank with accession numbers MG696860.1 and MK474469.1 for human isolates and with accession numbers MG696861.1 and MG696862.1 for bovine milk isolates, respectively. Comparative analysis of nucleotide sequences from Iraq samples with the number of global strains present in the Genbank database is shown in Figure-2.
Figure-2
Genetic tree interpretation based on mecA and femA gene partial sequences used for methicillin-resistant Staphylococcus aureus genetic changes according to host and regions.
Genetic tree interpretation based on mecA and femA gene partial sequences used for methicillin-resistant Staphylococcus aureus genetic changes according to host and regions.
Discussion
S. aureus has been recognized as an important pathogen that causes serious problems in community and hospitalized patients [18]. UTI is the most consequence of common community and hospital bacterial infection and characterized by high rate of treatment failure and high prevalence of S. aureus [19].About 36.3% of clinical samples isolated from patients with respiratory tract infections in Shiraz province were positive for MRSA, among which the most commonly detected antibiotic resistance genes were tetK (89.18%) and mecA (71.62%) [20], which suggested that MRSA has more affinity to the UIT than the respiratory infection with the similarity in the presence of the résistance genes, especially mecA. In a total of 152 studies on the community-associated MRSA; the highest prevalence was found in India (16.5-23.5%) followed by Vietnam (7.9%) and Taiwan (3.5-3.8%) [21]; the difference of these countries from Iraq may be attributed to the cruel circumstances of people in Iraq through the past few decades. A previous study showed that 81 MRSA strains (71.05%) were mecA gene positive [22], which was slightly less than the results of our study (94.4%); it may be because, for the previous study, samples were obtained from multilocal lesions; nasal swab, burns, and urine, while we obtained the samples from only UTI in our study.On the other side, MRSA is highly prevalent in cattle causing mastitis, the most common cattle infection, which leads to a huge economic loses. Hence, the use of right antibiotic in the treatment and control of BM caused by S. aureus is crucial [11]. This corroborated with the results found in our study, in which S. aureus was detected. This study focused on mastitis associated with S. aureus as an important cattle disease with a high incidence in buffaloes, as reported previously [23,24].This study was designed to provide information about the distribution of MRSA based on genotypic marker, mecA, among UTI patients in Al-Qadisiyah Governorate and phylogenic relationship with MRSA isolated from milk obtained from cattle. The gene mecA was detected in 94.4% of oxacillin-resistant S. aureus [18] which reveals it to be a potential genotypic marker for this criterion.Among 72 isolates used in this study, 50% of the isolates did not harbor the gene femA and these isolates might possess femB marker. The results revealed that 29.4% of mecA-positive samples expressed lukS gene and all were positive for femA, indicating the correlation between the presence of lukS and the presence of femA because all the isolates that did not possess femA also lacked lukS gene. There was high variation for this gene among MRSA isolates. In India, a previous study reported that 85.1% of MRSA expressed PVL gene [25], while another study reported a prevalence of 64% for lukS gene among MRSA samples [26]. Such differences in the results were attributed to the geographical variation.To determine the degree of relatedness between the two clinically isolated local strains of S. aureus from human and cattle, phylogenetic trees for femA and mecA were constructed based on each gene separately (Figure-2). The sequences of femA from the two clinically isolated animal and human strains belonged to Clade I and Clade II, respectively. On the contrary, mecA sequences from the two clinically isolated animal and human strains belonged to the same clade. The present data suggested the novelty of the two clinically isolated animal and human strains. This result indicates the indispensable need to employ an Multilocus sequence type (ST) approach in the future analyses to assign the ST of each strain and the likelihood of raising a novel ST from the strains under study.
Conclusion
S. aureus is recognized as an important pathogen that causes serious problems in community, hospitalized patients, and animals. The present data suggested the novelty of the two clinically isolated local strains from animal and human. Consequently, the continuous monitoring of methicillin susceptibility pattern of S. aureus isolates that have high standards of infections might help in the prevention of MRSA transmission in either direction between human and cattle, the risk of dairy milk on humans, or self-direction between the same genus.
Authors’ Contributions
YIK and HNA proposed the hypothesis. AJN designed the study. AJN and HNA collected the samples from human while the samples were collected from cattle by YIK and MHH. AJN and SFK conducted the experiments. All authors collected the references, read and approved the final manuscript after editing by MHH.
Authors: G Lina; Y Piémont; F Godail-Gamot; M Bes; M O Peter; V Gauduchon; F Vandenesch; J Etienne Journal: Clin Infect Dis Date: 1999-11 Impact factor: 9.079
Authors: Muhammad Shoaib; Amjad Islam Aqib; Muhammad Muddassir Ali; Muhammad Ijaz; Huma Sattar; Awais Ghaffar; Muhammad Sajid Hasni; Zeeshan Ahmad Bhutta; Khurram Ashfaq; Muhammad Fakhar-E-Alam Kulyar; Wanxia Pu Journal: Front Vet Sci Date: 2022-06-02
Authors: Eman E Abdeen; Walid S Mousa; Sarah Y Abdelsalam; Hanim S Heikal; Reyad R Shawish; Mohammed Nooruzzaman; Mohamed M Soliman; Gaber E Batiha; Ahmed Hamad; Ahmed Abdeen Journal: Antibiotics (Basel) Date: 2021-01-14