Literature DB >> 31738789

Overexpression of Saussurea involucrata dehydrin gene SiDHN promotes cold and drought tolerance in transgenic tomato plants.

Xinyong Guo1, Li Zhang1, Xiaozhen Wang1, Minhuan Zhang1, Yuxin Xi1, Aiying Wang1, Jianbo Zhu1.   

Abstract

Dehydrins are late embryogenesis abundant proteins that help regulate abiotic stress responses in plants. Overexpression of the Saussurea involucrata dehydrin gene SiDHN has previously been shown to improve water-use efficiency and enhance cold and drought tolerance of transgenic tobacco. To understand the mechanism by which SiDHN exerts its protective function, we transformed the SiDHN gene into tomato plants (Solanum lycopersicum L.) and assessed their response to abiotic stress. We observed that in response to stresses, the SiDHN transgenic tomato plants had increased contents of chlorophyll a and b, carotenoid and relative water content compared with wild-type plants. They also had higher maximal photochemical efficiency of photosystem II and accumulated more proline and soluble sugar. Compared to those wild-type plants, malondialdehyde content and relative electron leakage in transgenic plants were not significantly increased, and H2O2 and O2- contents in transgenic tomato plants were significantly decreased. We further observed that the production of stress-related antioxidant enzymes, including superoxide dismutase, ascorbate peroxidase, peroxidase, and catalase, as well as pyrroline-5-carboxylate synthetase and lipid transfer protein 1, were up-regulated in the transgenic plants under cold and drought stress. Based on these observations, we conclude that overexpression of SiDHN gene can promote cold and drought tolerance of transgenic tomato plants by inhibiting cell membrane damage, protecting chloroplasts, and enhancing the reactive oxygen species scavenging capacity. The finding can be beneficial for the application of SiDHN gene in improving crop tolerance to abiotic stress and oxidative damage.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31738789      PMCID: PMC6860438          DOI: 10.1371/journal.pone.0225090

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Harsh environmental conditions, including extreme temperatures, saline-alkaline conditions, and drought, can affect plant growth, development, and productivity [1]. More insidiously, these abiotic stresses can also result in excessive generation of reactive oxygen species (ROS), triggering oxidative-induced damages, such as oxidation of protein, DNA, or lipid, destruction of photosynthetic pigments, and inactivation of photosynthetic enzymes, thereby further threatening cellular viability [2-4]. Plants have developed powerful, multifaceted physiological and biochemical mechanisms that concertedly help sense, detoxify, eliminate, and/or neutralize ROS overproduction. Currently, there is a great deal of interest in identifying the genes conferring the greatest degrees of stress tolerance as targets for genetic engineering of crop plants. Late embryogenesis abundant (LEA) proteins are closely linked with the environmental stress tolerance of plants and, as their name suggests, are accumulated during the late stages of seed development [5-6]. Dehydrins (DHNs) are the most commonly described group of hydrophilin LEA proteins. They have high hydrophilicity, containing a high proportion of charged and polar amino acids, but a low fraction of hydrophobic, non-polar residues; they also often lack cysteine and tryptophan [7-8]. Based on the number and distribution of conserved sequences (i.e., Y-, S-, and K-segments), dehydrins are subdivided into five types: Kn, SKn, YnSKn, YnKn, and KnS [9-10]. Dehydrins are known to promote plant stress tolerance [9]. Earlier studies have reported that dehydrins were active in ion sequestration and membrane stabilization, and as chaperones [11-13]. More recent studies have identified, in a series of papers, that dehydrins also have ROS scavenging abilities [14-21]. For instance, Halder et al [16-18] showed that overexpression of Sorghum bicolor dehydrin genes in transgenic tobacco promoted temperature and osmotic stress tolerance by scavenging superoxide anions (O2-) and conferring protective effects to the enzymes responsible for dismutation of O2-. Similarly, Liu et al [20] reported that the expression of ZmDHN13, a maize dehydrin gene induced by hydrogen peroxide (H2O2), led to decreases in O2- generation in transgenic tobacco plants subjected to oxidative stress. Cao et al [21] also demonstrated that overexpression of Hevea brasiliense dehydrins, HbDHNs, in Arabidopsis thaliana led to increased tolerance to salt, drought, and osmotic stresses of the plant. They also found that the plants exhibited higher activity of antioxidant enzymes and lowered accumulation of ROS. In our previous study, we also identified that dehydrin (SiDHN) from Saussurea involucrata Kar. et Kir. (a perennial herb that grows in the cold, high alpine mountains of central Asia) facilitated abiotic stress tolerance [22]. Despite these findings, the precise mechanism of action of dehydrins in promoting plant stress tolerance remains obscure [9]. Additionally, the effects of SiDHN gene on cold and drought tolerance of transgenic tomato plants have not been determined. Therefore, in this work, we overexpressed S. involucrata dehydrin SiDHN gene in transgenic tomato (Solanum lycopersicum L.) plants, one of the most important horticultural crops across the globe. We then determined the plants’ tolerance to cold and drought stress by evaluating agronomic traits, changes of chlorophyll content, morphology and physiology of the plants. We also determined gene expression and activity of antioxidant enzymes involving in plants’ responses to cold and drought stress, as well as the accumulation of H2O2 and O2-.

Materials and methods

Plant materials and growth conditions

Plantlets of S. involucrata were prepared by tissue culture from sterile S. involucrata leaf (explant) cut into small pieces with sizes of about 1.5–2 cm. To produce callus, the explant was grown on callus induction medium MSB supplemented with 6-BA (6-benzyladenine; 0.05 mg/L) and 2,4-D (2,4-dichlorophenoxyacetic acid; 0.3 mg/L), and the medium was changed every 15 d. After that, they were transferred to callus differentiation medium MS supplemented with 6-BA (2.0 mg/L) and NAA (α-naphthaleneacetic acid; 0.5 mg/L), during which the medium was changed every 15 d. Small buds obtained after callus differentiation were cut and transferred to rapid propagation medium MS containing 6-BA (0.5 mg/L) and NAA (0.01 mg/L) to obtain plantlets. The tissue culture was carried out in a laboratory incubator on a 21°C/19°C day/night schedule, with a 16 h light/8 h dark cycle and at a light intensity of 70 μmol m−2 s−1. Seeds of tomato plant variety ‘Yaxin 87-5’ (wild-type) were provided by Yaxin Seed Co. Ltd. (Shihezhi City, Xinjiang, China). The wild-type tomato plants were grown from the seeds in our laboratory and were used to produce transgenic tomato plants. The plants were initially grown in a tissue culture room at 25°C with a 12 h light/12 h dark cycle, 60–70% humidity, and a light intensity of 70 μmol m−2 s−1. After that, the plantlets were transplanted in plastic pots containing composite substrates consisting of equal parts of peat, vermiculite, and soil and then were allowed to grow in a naturally lit greenhouse at 22–28°C and relative humidity of 60–70%.

Plant treatments

Cold treatment of S. involucrata plantlets was carried out based on Liu et al [23], by which six-week-old S. involucrata plantlets were kept at 4°C for 48 h, followed by 0°C for additional 48 h. The drought treatment was carried out according to Zhu et al [24]. In this treatment, after plants were washed thoroughly with tap water to eliminate substrates and their surface water was wiped off, they were dehydrated on filter papers for 48 h. Untreated S. involucrata plantlets were used as a control. All plants were cultured in parallel in an incubator with 21°C day/19°C night cycle. Following the treatments, plant leaves at the same position (on each plant) were harvested at 0, 1, 3, 6, 9, 12, 24, and 48 h. Cold treatment of tomato plants is similar to that of S. involucrata plantlets. Three wild-type and nine T2 transgenic tomato plants (all were ten weeks old) were kept at 4°C for 48 h, followed by 0°C for additional 48 h. For drought treatment, the plants were grown without water for 24 days and thereafter were re-watered for recovery. After the treatments, the plants were grown at 25°C in a greenhouse and were watered at about 1 L per basin once a week. Tomato leaves (the second and third leaves from the top) were collected after 48 h of the cold treatments (4oC and 0oC), or after 0, 16 and 24 d of the drought treatment. Immediately after harvest, the leaves were frozen in liquid nitrogen and stored at -80°C until subsequent experiments. All experiments were repeated three times, and each sample was prepared in triplicate.

RNA extraction and quantitative RT–PCR analysis

Total RNA was isolated using the RNAisoPlus kit (TaKaRa) with on-column DNase I treatment, according to the manufacturer’s instructions. First-strand cDNA was synthesized from the total RNA using oligo(dT) primers and PrimeScript®RTase (TaKaRa) enzyme. The expression patterns of SiDHN gene and ROS-related stress-responsive genes were subsequently determined by quantitative RT-PCR, which was carried out using a LightCycler 480 instrument (Roche Diagnostics, Basel, Switzerland) and SYBR® Premix Ex Taq™ (TaKaRa, China), according to the supplier’s instructions and the MIQE guidelines [25]. Each qRT-PCR reaction mixture (10 μL) was composed of 50 ng of cDNA, 5 μL of 2 × SYBR® Green MasterMix Reagent (Applied Biosystems) and 0.2 μM of the corresponding gene-specific primers shown in Table 1. For the analysis of SiDHN gene, the qRT-PCR thermal cycles were set as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, and 60°C for 25 s. The expression level of the gene was normalized to that of the GAPDH gene from S. involucrate (Accession No.: KF563904.1). For the analysis of ROS-related stress-responsive genes, the qRT-PCR thermal cycles were set as follows: predenaturation at 94°C for 4 min, followed by 94°C for 40 s, 30 cycles of 95°C for 5 s, and 52°C for 40 s. The expression levels of these genes were normalized to those of an internal control, the SlEF1α gene (GenBank ID: X53043) [26]. For the analysis of SlEF1α gene, the qRT-PCR thermal cycles were as follows: denaturation at 95°C for 30 s, followed by 50 cycles at 95°C for 5 s, 60°C for 10 s, and 68°C for 10 s. Each analysis was repeated three times, and three replicate reactions were prepared for each analysis. The relative gene expression was calculated using the ΔΔCt method previously described [27].
Table 1

Sequences of primers used for qRT-PCR analysis.

PrimerGenBank IDSense (5'→3')Antisense (5'→3')
SiDHNKJ145794TGTGGTGGAGCAGATCAAGGTATGTCCATCGGCGACACCATGA
SikGAPDHKF563904.1TAGCAAGGATGCTCCCATGTTGGAGCAAGGCAGTTGGTTGTG
SlEF1αX53043GGAACTTGAGAAGGAGCCTAAGCAACACCAACAGCAACAGTCT
SlAPXNM_001247853GATGTTCCCTTTCACCCTGCCCCTCTTTTTCCCCACT
SlCATNM_001247898GGTGGATTATTTGCCCTCGACCTCTCCCCTGCCTGTTT
SlPOXNM_001247203CACATACATTTGGAAGGGCTTTATTGTTGGATCAGGGC
SlSODNM_001247840GGCCAATCTTTGACCCTTTAAGTCCAGGAGCAAGTCCAGT
SlP5CSU60267.1ACGGTCTTTACAGTGGTCAAGCAGCATACATAGCAG
SlLTP1NM_001247806.2TCTAGGAGGCTGTTGTGGTGGTGGAGGGGCTGATCTTGTA

Primers were designed at the 5′- and 3′- ends of the full-length DNA sequences retrieved using the corresponding GenBank IDs.

Primers were designed at the 5′- and 3′- ends of the full-length DNA sequences retrieved using the corresponding GenBank IDs.

Isolation and sequence analysis of Full-Length SiDHN cDNA

The construction of full-length SiDHN cDNA library was conducted using the Creator TMSMARTTM cDNA Library Construction Kit (Clontech, USA) as described previously [28]. Ninety-six single cells containing SiDHN were randomly selected and then subjected to plasmid extraction. After that, the plasmid was sequenced, and the identity of the inserted cDNA was confirmed by DNA sequencing [The obtained cDNA sequence showed homology to a gene encoding a water stress-induced dehydrin-like protein known as SiDHN gene]. The 5′ and 3′ ends and the CDS region of the SiDHN gene were identified using ORF finder by which the sequence was aligned with known sequences in the databases. Protein secondary structure and intrinsic disorder of the deduced SiDHN protein were predicted using PHYRE2 Protein Fold Recognition Server [29]. The obtained SiDHN amino acid sequence was searched against the NCBI database using Standard Protein BLAST. Dehydrin protein sequences from a total of 7 species including three most similar species (Cynara cardunculus var. scolymus (XP_024979388.1), Artemisia annua (PWA89867.1) and Lactuca sativa (XP_023764814.1), denoted as CsDHN, AaDHN and LsDHN, respectively) and four species of Solanum (Solanum habrochaites (AHB20199.1), Solanum chilense (ADQ73964.1), Solanum peruvianum (ADQ73992.1) and Solanum lycopersicum (NP_001316365.1), denoted as ScDHN, SpDHN, SlDHN and ShDHN, respectively) were retrieved. The sequences were then subjected to multiple sequence alignments using DNAMAN8.0 software [30], and the identification of Y-, K-, and S-segments of the sequence was carried out using the PROSITE database [31]. A phylogenetic tree was constructed by the Neighbor-Joining method with 1,000 bootstrap replicates using MEGA 5.1 software (http://www.megasoftware.net/); bootstrap scores <50% were deleted.

Plant transformation and transgenic tomato identification

In construction of pBIN438-SiDHN plasmid, SiDHN gene fragment was amplified from cDNA using the forward primer 5′- (the underline sequence indicates the BamHI site) and the reverse primer 5′- (the underline sequence indicates the SalI site). The amplicon were ligated with plant expression vector pBIN438 at the BamHⅠ and SalⅠ sites, and the obtained plasmid was transformed into Escherichia coli DH5 alpha. The plasmid was transformed into Agrobacterium tumefaciens GV3101 using the method described previously [32]. A single cell was selected from the medium containing kanamycin, gentamicin and rifampicin, and the identity of the inserted gene was confirmed by DNA sequencing. To produce transgenic tomato plants, the wild-type tomato plants were transformed with SiDHN-containing plasmid by Agrobacterium-mediated method. Briefly, leaves from the middle part of eight- to ten-day-old tomato plants were punched out to obtain leaf discs of about 0.5×0.5 cm2 and used as the explant. The leaf discs were cultured on MS medium supplemented with ZT (zeatin; 1.0 mg/L) and IAA (indole-3-acetic acid; 0.3 mg/L) in the dark for 3 d. Subsequently, the cultured leaves were co-cultured with activated pBIN438-SiDHN bacterial liquid for 15 min; after that, they were removed and placed on a sterile filter paper to remove the bacterial liquid. The infected leaves were cultured for 3 d on a culture plate containing solid MS medium supplemented with ZT (1.0 mg/L) and IAA (0.3 mg/L) covered with a sterile filter paper. After 3 days, the leaves were transferred to a bud differentiation medium MS containing ZT (1.0 mg/L), IAA (0.3 mg/L), kanamycin (80 mg/L) and Tim (timentin; 100 mg/L), followed by 1 successive generation of about 15 d. A single bud was cut off and then cultured in a rooting medium (1/2 MS) containing IAA (0.6 mg/L), Kanamycin (80 mg/L) and Tim (100 mg/L) for 1 month. After that, the plants were transferred to a pot and allowed to grow in the conditions described in the ‘Plant materials and growth conditions’ section. Primary (T0) tomato transformants were verified by PCR and T1 transgenic lines were selected by qRT-PCR both using the forward primer 5′- (the underlined section indicates the BamHI site) and the reverse primer 5′- (the underlined section indicates the SalI site), synthesized by the Beijing Genomics Institute (TIANGEN Biotech Co. Ltd., Beijing, China). The T2 homozygous lines were selected by segregation analysis as described by Pino et al [33], and three independent T2 generation homozygous lines (denoted as OE-2, OE-5, and OE-8) with comparatively high expression levels of SiDHN were selected for further studies.

Measurement of chlorophyll pigment content

Chlorophyll is responsible for absorption, transfer and conversion of light into energy in photosynthesis. When plants are subjected to stress, the content and composition of chlorophyll pigment are altered, which affects its photosynthetic ability [34]. In the measurement of chlorophyll pigment content, 0.1 g of leaves from WT and transgenic tomato treated with cold and drought conditions were cut into strips of 1-mm width and then added to test tubes. After that, 15 ml of acetone:ethanol mixture (V:V = 1:1) was added to extract chlorophyll. The extraction was performed at room temperature in the dark until the leaf strips became white. After centrifugation, the supernatant was subjected to absorbance measurements at 470 nm, 645 nm, and 663 nm, and the contents of chlorophyll a (Chl a), chlorophyll b (Chl b), and carotenoids (Car) were calculated by the following equations: Chl a = 12.21*A663 – 2.81*A645; Chl b = 20.13*A645 – 5.03*A663; and Car = (1000*A470 – 3.27*Chl a – 104*Chl b)/229.

Determination of morphological and physiological traits

Various morphological and physiological traits, including leaf relative water content (RWC), malondialdehyde (MDA) content, relative electrolyte leakage (REL), maximal photochemical efficiency of photosystem II (PSII), and contents of proline and total soluble sugar (soluble osmotic regulators), were measured at different stages after both stress treatments. Leaf relative water content is a physiological index used to evaluate the water retention capacity and is a parameter that can appropriately measure water status and osmotic adjustment of plants under abiotic stresses [35]. RWC was determined following the method described by Lara et al [36] and was calculated by the following equation: RWC = (FW − DW)/(TW − DW) × 100%, where FW is the fresh weight of the leaves, TW is the weight at full turgor (measured after floating the leaves in distilled water for 24 h under light at room temperature), and DW is the weight after drying the leaves at 70°C until a constant weight was achieved. Malondialdehyde is a product of lipid peroxidation and is an important indicator determining the destructive effects of ROS and membrane damage upon stress [37]. Thus, measurement of MDA content can reflect the degree of membrane damage. Leaves were excised from the tomato plants and then washed with deionized water. After that, leaf discs were punched out, and the MDA contents in the leaf discs were quantified by the modified thiobarbituric acid reaction outlined in Du et al using a spectrophotometer (UV-160A, Shimadzu Scientific Instruments, Japan) [38]. In a plant system, abiotic stresses primarily target cell membrane, interfering with the membrane stability and integrity, and relative electrolyte leakage (REL) is a parameter generally used to indicate such interference [39]. Relative electrolyte leakage was determined following the method of Du et al using an EC 215 Conductivity Meter (Markson Science Inc., Del Mar, CA, USA) [38]. Young, fully-grown leaves were randomly selected and then subjected to electrolyte leakage analysis using a conductivity meter. The relative conductivity was calculated using the following equation: REL = (C1 − CW)/(C2 − CW) × 100, where C1 is the electrical conductivity value during the first measurement, C2 the conductivity value after boiling, and CW the conductivity of deionized water. Maximal photochemical efficiency of photosystem II (PSII) is the efficiency at which light is absorbed by PSII. It determines the photochemistry of PSII when all of its reaction centers are open. Maximal photochemical efficiency of PSII (Fv/Fm) is a parameter indicating the degree of photoinhibition of PSII and its structural integrity [40]. The Fv/Fm value of the tomato leaves was measured using a portable fluorescence analyzer (DUAL-PAM-100, Walz, Germany). Leaves were allowed to adapt to darkness for 30 min and then exposed to a flash of saturated light for 1 s. The minimal fluorescence (F0) in the dark-adapted state (or when all PSII reaction centers are open) and the maximal fluorescence (Fm) during exposure to the saturated light pulse (or when all PSII reaction centers are closed) were measured, and the variable fluorescence (Fv = Fm – F0) was calculated [41]. Proline and soluble sugars are soluble osmotic regulators that regulate and maintain integrity in plant cell membrane; thus, their contents can be used to indicate membrane integrity [42-43]. The content of free proline were measured according to the method described by Bates et al. [44]. Briefly, about 200 mg of ground leaf was extracted with 4 mL of 3% sulphosalicylic acid at 100°C for 10 min. The homogenate was centrifuged at 12,000×g for 2 min, and 2 mL of the supernatant was then mixed with 2 mL of acid-ninhydrin reagent and 2 mL of glacial acetic acid. The mixture was boiled for 30 min and then soaked in an ice bath to terminate the reaction. The mixture was extracted with toluene (4 mL), and an absorbance at 520 nm of the organic phase was determined. To determine proline content, the absorbance values were compared with a standard curve constructed using known amounts of proline. Measurement of total soluble sugar content was carried out using the anthrone method in which glucose was used as the standard [45]. Approximately 200 mg of ground leaf was homogenized in 1 mL of distilled water and then boiled for 20 min. After centrifugation at 13,000×g for 10 min, 2 mL of the supernatant was mixed with 1.8 mL of distilled water and 2.0 mL of 0.14% (w/v) anthrone solution in 100% H2SO4 and then soaked in boiling water for 20 min. After cooling, an absorbance at 620 nm of the mixture was determined. The absorbance values were compared with a standard curve constructed using known amounts of glucose. Each experiment was carried out in triplicate, and three replicate samples were prepared in parallel.

Determination of antioxidant enzyme activity and content of reactive oxygen species

After exposure to cold and drought treatments, 0.5 g of fresh T2 wild-type and transgenic tomato plant leaves were collected. The leaves were cut into small pieces and then homogenized in 4 mL of 50 mM sodium phosphate buffer (pH 7.8) containing 1% polyvinylpyrrolidone and 10 mM β-mercaptoethanol in an ice bath. The homogenate was centrifuged at 17,426×g for 15 min at 4°C. The enzyme activity of the supernatant was then determined. Ascorbate peroxidase (APX) activity was determined following the method of Nakano and Asada [46] as the decrease in absorbance at 290 nm of ascorbate. Catalase (CAT) activity was determined according to the method described by Cakmak et al [47]. Superoxide dismutase (SOD) activity was assessed by an absorbance at 560 nm based on the methods of Beauchamp and Fridovich [48]. Peroxidase (POX) activity was determined according to the method described by Doerge et al [49]. All absorbance measurements were carried out on an Infinite M200 Pro microplate reader (Tecan Group Ltd., Männedorf, Switzerland). Contents of H2O2 and O2− were determined using a standard curve following the method described by Benikhlef et al [50], in which an absorbance at 415 and 530 nm was measured using a UV-160A spectrophotometer (Shimadzu Scientific Instruments, Japan).

Statistical analysis

Statistical analysis of the data was performed using GraphPad Prism 7.0 and SigmaPlot 12 (SYSTAT Software). Data are expressed as means ± standard deviations of three replicate experiments. The expression level at 0 h (control time point) was defined as 1.0. Significant differences between the wild-type and transgenic plant lines were determined using Dunnett’s multiple comparisons test, and P < 0.05 and P < 0.01 are considered significantly different.

Results

Sequence analysis of SiDHN gene from S. involucrata

The sequence analysis showed that the full-length cDNA of SiDHN consists of 703 base pairs with a 333-base-pair open reading frame, encoding a protein of 111 amino acids (GenBank accession No. KJ145794). It contains one Y-segment “TDEYVHNP” and two K-segments (“HEQGGKGVVEQI” and “HEKKGVMEKIKEKIPG”; Fig 1A); the latter are found in nearly all dehydrins [51]. In addition, in silico secondary structure and intrinsic disorder prediction using PHYRE2 showed that SiDHN protein comprises 36% α-helices located mainly in the Y-segment and both of the two K-segments, and over 78% of its amino acid residues are disordered.
Fig 1

Sequence analysis of SiDHN gene from Saussurea involucrata.

(A) Protein secondary structure and intrinsic disorder of deduced SiDHN protein predicted by PHYRE2 protein fold recognition server. (B) Protein sequence alignment of SiDHN protein with dehydrin proteins from Cynara cardunculus var. scolymus DHN (XP_024979388.1), Lactuca sativa DHN (XP_023764814.1), Artemisia annua DHN(PWA89867.1), Solanum habrochaites DHN (AHB20199.1), Solanum chilense DHN (ADQ73964.1), Solanum peruvianum DHN (ADQ73992.1) and Solanum lycopersicum DHN (NP_001316365.1). (C) Phylogenetic tree of SiDHN and dehydrins from species of Solanum and other Asterid members analyzed by the Neighbor-Joining method in MEGA 5.1. Bootstrap value was obtained from 1000 replicates.

Sequence analysis of SiDHN gene from Saussurea involucrata.

(A) Protein secondary structure and intrinsic disorder of deduced SiDHN protein predicted by PHYRE2 protein fold recognition server. (B) Protein sequence alignment of SiDHN protein with dehydrin proteins from Cynara cardunculus var. scolymus DHN (XP_024979388.1), Lactuca sativa DHN (XP_023764814.1), Artemisia annua DHN(PWA89867.1), Solanum habrochaites DHN (AHB20199.1), Solanum chilense DHN (ADQ73964.1), Solanum peruvianum DHN (ADQ73992.1) and Solanum lycopersicum DHN (NP_001316365.1). (C) Phylogenetic tree of SiDHN and dehydrins from species of Solanum and other Asterid members analyzed by the Neighbor-Joining method in MEGA 5.1. Bootstrap value was obtained from 1000 replicates. Protein sequence alignment revealed that the deduced protein sequence of SiDHN shared 46%, 38%, and 42% similarity with dehydrin proteins from C. cardunculus var. scolymus (XP_024979388.1), A. annua (PWA89867.1), and L. sativa (XP_023764813.1), respectively (Fig 1B). By contrast, SiDHN protein is rather different from dehydrin proteins from four species of Solanum [23]: it shared only 19.4% similarity with S. habrochaites (AHB20199.1), 15.6% similarity with S. chilense (ADQ73964.1), 15.6% similarity with S. peruvianum (ADQ73992.1), and 15.0% similarity with S. lycopersicum (NP_001316365.1). The phylogenetic tree (Fig 1C) further showed that these proteins belong to three (YK2, YSK2, and SK3) of the five types of dehydrins: SiDHN protein belongs to YK2 type and is closely related to dehydrins from C. cardunculus var. scolymus, Lactuca sativa and Artemisia annua genes, which belong to YSK2 type.

Expression of SiDHN gene in S. involucrata under cold and drought stress

At both temperatures, the gene expression levels of SiDHN in leaves of S. involucrata under cold stress steadily increased with increasing treatment time, reaching maximum values at 48 h (Fig 2A and 2B), and decreased thereafter (Data not shown). The expression in plants treated with 0°C for 48 h were 10 times higher than those at 0 h and were nearly double those in the plants treated with 4°C for 48 h. Similarly, the expression of SiDHN gene in S. involucrata treated with drought was also increased with increasing treatment time, reaching a peak value only after 12 h (Fig 2C), while gradually declined thereafter. Nonetheless, the expression at 48 h remained high with a value of 7 times higher than that at 0 h. The SiDHN was also found to constitutively express in roots and stems of plant under cold stress; however, the level in leaves was significantly higher than that in other two tissues (Fig 2D).
Fig 2

Relative expression of SiDHN gene in Saussurea involucrata under cold and drought stress.

(A) Expression under cold treatment at 4°C for 0, 1, 3, 6, 9, 12, 24, and 48 h. (B) Expression under cold treatment at 0°C for 0, 1, 3, 6, 9, 12, 24 and 48 h. (C) Expression under drought stress for 0, 1, 3, 6, 9, 12, 24 and 48 h. (D) Expression in different plant tissues under cold stress. The values are means from 3 repeated experiments.

Relative expression of SiDHN gene in Saussurea involucrata under cold and drought stress.

(A) Expression under cold treatment at 4°C for 0, 1, 3, 6, 9, 12, 24, and 48 h. (B) Expression under cold treatment at 0°C for 0, 1, 3, 6, 9, 12, 24 and 48 h. (C) Expression under drought stress for 0, 1, 3, 6, 9, 12, 24 and 48 h. (D) Expression in different plant tissues under cold stress. The values are means from 3 repeated experiments.

Transformation and molecular characterization of SiDHN-overexpressing transgenic tomato plants

Following the method described in Pino et al [33], 30 independent kanamycin-resistant primary transformant plants (T0 generation) were generated, and the successful transformation of the SiDHN gene was confirmed by PCR amplification. Among these transformant plants, 15 were confirmed by PCR amplification using a CaMV35S forward and gene-specific reverse primer pair, and 10 were found to posses kanamycin resistance and have a 3:1 segregation ratio in the T1 generation. Three independent homozygous lines (OE-2, OE-5, and OE-8) that had higher expression levels of SiDHN were selected for further studies (Fig 3).
Fig 3

Expression levels of SiDHN in wild-type and SiDHN-overexpressing transgenic tomato plant lines.

Agronomic traits of SiDHN-overexpressing transgenic tomato plants

Comparison of 80-day-old wild-type and SiDHN-overexpressing transgenic tomato plants showed that the leaves of the transgenic plants had denser and darker color than the wild-type plants (Fig 4), and each of the transgenic plants was shorter than the wild-type plants (Fig 5A). The fresh weights of both types of plants were not different; however, dry weights of the transgenic plant lines were higher than those of the wild-type plants (Fig 5B and 5C). Length of root (Fig 5D) and fresh and dry weight of root (Fig 5E and 5F) of the transgenic plants were greater than those of the wild-type plants. The transgenic tomato plants also had higher stem diameters than the wild-type plants (Fig 5G).
Fig 4

Phenotypes of the aboveground parts (Left), underground parts (Middle), and leaves (Right) of wild-type and SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5, and OE-8).

Fig 5

Agronomic traits of 80-day-old wild-type and SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5, and OE-8).

(A) Plant height. (B) Fresh weight of plant. (C) Dry weight of plant. (D) Length of root. (E) Fresh weight of root. (F) Dry weight of root. (G) Stem diameter. Data are means ± SD of three replicate experiments. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01.

Phenotypes of the aboveground parts (Left), underground parts (Middle), and leaves (Right) of wild-type and SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5, and OE-8).

Agronomic traits of 80-day-old wild-type and SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5, and OE-8).

(A) Plant height. (B) Fresh weight of plant. (C) Dry weight of plant. (D) Length of root. (E) Fresh weight of root. (F) Dry weight of root. (G) Stem diameter. Data are means ± SD of three replicate experiments. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01.

Chlorophyll pigment content in SiDHN-overexpressing transgenic tomato plants

Chlorophyll a (Chl a) levels in the transgenic plants were significantly higher than those in the wild-type plants (Fig 6A). Chlorophyll b (Chl b) content in the OE-2 and OE-8 lines was significantly greater that that in the wild-type plants. The Chlb content in OE-5 line was also greater, but the difference was not significant (Fig 6B). The Chl a+Chl b content in all three transgenic plant lines was higher than that in the wild-type plants (Fig 6C). The carotenoid (Car) content in the three transgenic plants lines was also higher than the wild-type plants, but the differences were only significant between the OE-2 and OE-8 plant lines and the wild-type plants (Fig 6D).
Fig 6

Chlorophyll pigment content in wild-type and SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5, and OE-8).

(A) Chl a content. (B) Chl b content. (C) Chl a+Chl b content. (D) Car content. Data are means ± SD of three replicates. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01.

Chlorophyll pigment content in wild-type and SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5, and OE-8).

(A) Chl a content. (B) Chl b content. (C) Chl a+Chl b content. (D) Car content. Data are means ± SD of three replicates. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01.

Morphological changes of SiDHN-overexpressing transgenic tomato plants under cold and drought stress

The phenotypes of the transgenic and wild-type plants at room temperature (25°C) were different. After being exposed to 4°C for 48 h, the wild-type plants exhibited signs of severe wilting; in contrast, the transgenic plants showed only slight signs of leaf wilting. After exposure to 0°C for 12 h, the leaves of the wild-type tomato turned a deeper green color and signs of wilting became more severe, whereas the leaves of the transgenic plants exhibited no substantial changes (Fig 7A).
Fig 7

Phenotypes of wild-type and SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5, and OE-8) under cold and drought stress.

(A) Six-week-old wild-type and SiDHN-overexpressing transgenic tomato plants subjected to cold stress (4°C and 0°C) and allowed to recover for 3 days at 25°C. (B) Six-week-old wild-type and SiDHN-overexpressing transgenic tomato plants subjected to drought stress for 28 days. Photographs were taken at 0, 16, 24, and 28 d after the treatments were initiated.

Phenotypes of wild-type and SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5, and OE-8) under cold and drought stress.

(A) Six-week-old wild-type and SiDHN-overexpressing transgenic tomato plants subjected to cold stress (4°C and 0°C) and allowed to recover for 3 days at 25°C. (B) Six-week-old wild-type and SiDHN-overexpressing transgenic tomato plants subjected to drought stress for 28 days. Photographs were taken at 0, 16, 24, and 28 d after the treatments were initiated. Aside from the difference in height, which was insignificant, no significant phenotypic differences were observed between the transgenic and wild-type plants under drought stress (Fig 7B). After 16 d without water, however, the wild-type plants exhibited clear signs of wilting, with the leaves near the base particularly flaccid and yellowed; by contrast, the leaves of the transgenic tomato plants showed minimal wilting with only a few yellowish leaves. This pattern was maintained after 24 d, but the OE-8 plants were also considerably more wilted and shorter than other transgenic plants. After 3 d of re-watered, the wild-type plants had recovered, but the stems were soft and limp. The OE-8 plants were also recovered, while the OE-2 and OE-5 plants were nearly unchanged. The stems of all transgenic plants remained turgid throughout the treatment.

Physiological changes in SiDHN-overexpressing transgenic tomato plants under cold and drought stress

Relative water content reflects the water retention capacity of the plants; it is used to measure water status and osmotic adjustments of the plants [35]. Before exposure to the stresses, RWC levels in the leaves of the transgenic and wild-type plants were similar (Figs 8A and 9A). By contrast, after exposure to the stresses, RWC decreased in both plant types, but the decline in the wild-type plants were considerably more accentuated than that in the transgenic plants. Under both stresses, the transgenic plants had significantly higher RWC levels than wild-type plants (P<0.01).
Fig 8

Physiological changes of wild-type and SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5, and OE-8) under cold stress.

(A) Relative water content. (B) Fv/Fm values. (C) Relative electrolyte leakage. (D) MDA content. (E) Proline content. (F) Solute sugar content. Data are means ± SD of three replicates. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01.

Fig 9

Physiological changes of wild-type and SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5, and OE-8) under drought stress.

(A) Relative water content. (B) Relative electrolyte leakage. (C) MDA content. (D) Proline content. (E) Solute sugar content. (F) Fv/Fm values. Data are means ± SD of three replicates. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01.

Physiological changes of wild-type and SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5, and OE-8) under cold stress.

(A) Relative water content. (B) Fv/Fm values. (C) Relative electrolyte leakage. (D) MDA content. (E) Proline content. (F) Solute sugar content. Data are means ± SD of three replicates. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01.

Physiological changes of wild-type and SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5, and OE-8) under drought stress.

(A) Relative water content. (B) Relative electrolyte leakage. (C) MDA content. (D) Proline content. (E) Solute sugar content. (F) Fv/Fm values. Data are means ± SD of three replicates. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01. Malondialdehyde (MDA) is the product of lipid peroxidation caused by ROS and, combined with relative electrolyte leakage (REL), can reflect the permeability of the plasma membrane. MDA content and REL levels in the wild-type and transgenic plants were immediately elevated when exposed to cold (Fig 8B and 8C) and drought stresses (Fig 9B and 9C). Both MDA and REL in the wild-type plants were significantly higher than those the transgenic plants (P<0.01). Proline and soluble sugar contents were also elevated in all plants under stresses, but the levels in the transgenic plants were higher than those in the wild-type plants. Under cold stress at both temperatures (4°C and 0°C), proline and soluble sugar contents of the wild-type plants were significantly lower than those of the transgenic plants (P < 0.01) (Fig 8D and 8E). Similarly, after 16 and 24 d of drought stress, proline and soluble sugar contents of the wild-type plants were significantly lower than those of the transgenic plants (P < 0.01) (Fig 9D and 9E). Of all transgenic plant lines, OE-2 had the highest proline and soluble sugar contents. The maximal photochemical efficiency of photosystem II (PSII) is expressed as Fv/Fm. The Fv/Fm values of the transgenic and wild-type plants before exposure to cold and drought stress were not significantly different (Figs 8F and 9F). But upon exposure to cold and drought, the values became significantly different (P<0.01); the values steadily decreased in all plants, but the decline in the wild-type plants was much more accentuated compare with that in the transgenic plants. To study how the overexpression of SiDHN genes in transgenic plants under stresses affect the activities of ROS scavenging enzymes, the enzymatic activities of ascorbate peroxidase (APX), catalase (CAT), superoxide dismutase (SOD), and peroxidase (POX), as well as the contents of ROS hydrogen peroxide (H2O2) and superoxide anion (O2-) were measured. The data showed that in response to both cold and drought stresses, the enzymatic activities of APX (Figs 10A and 11A), CAT (Figs 10B and 11B), POX (Figs 10C and 11C) and SOD (Figs 10D and 11D) were up-regulated compared to those of the wild-type plants. Under drought stress, the activity levels between the two plant types were significantly different, except for CAT activities of the OE-8 plants. Under cold treatments, the levels were also significantly different among the two plant types, except for CAT activities of the OE-5 and OE-8 plant lines. Amongst the transgenic plant lines, the OE-2 had the highest expression of SiDHN gene and enzyme activities, whereas OE-8 had the lowest.
Fig 10

Activities of antioxidant enzymes and contents of ROS in wild-type and SiDHN-expressing transgenic tomato plant lines (OE-2, OE-5, and OE-8) under cold stress determined at 48 h after the treatment.

(A) APX activity. (B) CAT activity. (C) POX activity. (D) SOD activity. (E) H2O2 content. (F) O2- content. Data are means ± SD of three replicates. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01.

Fig 11

Activities of antioxidant enzymes and accumulation of ROS in wild-type and SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5 and OE-8) under drought stress.

(A) APX activity. (B) CAT activity. (C) POX activity, (D) SOD activity. (E) H2O2 content. (F) O2- content. Data are means ± SD of three replicates. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01.

Activities of antioxidant enzymes and contents of ROS in wild-type and SiDHN-expressing transgenic tomato plant lines (OE-2, OE-5, and OE-8) under cold stress determined at 48 h after the treatment.

(A) APX activity. (B) CAT activity. (C) POX activity. (D) SOD activity. (E) H2O2 content. (F) O2- content. Data are means ± SD of three replicates. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01.

Activities of antioxidant enzymes and accumulation of ROS in wild-type and SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5 and OE-8) under drought stress.

(A) APX activity. (B) CAT activity. (C) POX activity, (D) SOD activity. (E) H2O2 content. (F) O2- content. Data are means ± SD of three replicates. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01. Before cold and drought treatments, the contents of H2O2 and O2− in both the wild-type and transgenic plants were low and were nearly the same. Following exposure to cold stress (Fig 10E and 10F), however, ROS levels increased, and the increase in the wild-type plants was considerably more accentuated than that in the transgenic plants. The contents of H2O2 and O2− were significantly different between the wild-type and transgenic plants under both stresses (Fig 11E and 11F). The OE-8 plant line had the highest H2O2 and O2- contents among all transgenic plants. To study why transgenic plants can maintain relatively high antioxidant enzyme activity under low temperature and drought stress, we measured the expression patterns of genes SlAPX, SlCAT, SlPOX, and SlSOD, which encode the tomato’s antioxidant enzymes APX, CAT, POX, and SOD, respectively, as well as genes SlP5CS and SlLTP1 encoding pyrroline-5-carboxylate synthetase and lipid transfer protein 1, in both the wild-type and transgenic plants. Prior to cold treatment, the expression levels of wild-type and transgenic lines were similar; but upon treatment with low temperature, the expression levels of all plants increased, However, the expression levels of genes in transgenic lines were significantly higher than those in wild-type lines, and the expression levels increased with decreasing temperature (Fig 12). The expression of ROS-related genes SlAPX, SlCAT, SlPOX, SlSOD, SlP5CS, and SlLTP1 were up-regulated in response to drought stress. The expression of these genes in the transgenic plants were significantly higher than that in the wild-type plants, even after 16 d. Amongst the transgenic plant lines, OE-2 had the highest expression levels, whereas OE-8 had the lowest (Fig 13). The expression levels of genes SlAPX, SlCAT, SlPOX, and SlSOD in plants under stress were highly similar to those of antioxidant enzymes, which suggests that the relative level of antioxidant enzymes may be determined by the level of their genes. The results indicate that overexpression of SiDHN may be able to improve the expression of antioxidant related genes, thus increasing the activity of the corresponding antioxidant enzymes, improving the ROS clearance, and in turn reducing the cell membrane damage caused by low temperature- and drought-induced oxidative stress.
Fig 12

Relative gene expression of SlAPX, SlCAT, SlPOX, SlSOD, SLP5CS, and SlLTP in SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5, and OE-8) under cold stress (4°C and 0°C).

Data are means ± SD of three replicates. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01.

Fig 13

Relative expression of SlAPX, SlCAT, SlPOX, SlSOD, SLP5CS and SlLTP genes in SiDHN-overexpressing transgenic tomato plants lines (OE-2, OE-5, and OE-8) under drought conditions for 16 and 24 d.

Data are means ± SD of three replicates. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01.

Relative gene expression of SlAPX, SlCAT, SlPOX, SlSOD, SLP5CS, and SlLTP in SiDHN-overexpressing transgenic tomato plant lines (OE-2, OE-5, and OE-8) under cold stress (4°C and 0°C).

Data are means ± SD of three replicates. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01.

Relative expression of SlAPX, SlCAT, SlPOX, SlSOD, SLP5CS and SlLTP genes in SiDHN-overexpressing transgenic tomato plants lines (OE-2, OE-5, and OE-8) under drought conditions for 16 and 24 d.

Data are means ± SD of three replicates. Asterisk(s) indicate significant difference between the wild-type and transgenic plants: * represents P < 0.05 and ** represents P < 0.01.

Discussion

The growth, development, and productivity of crops are affected by elevated levels of ROS arising from abiotic stress, including cold temperatures and drought. In response to these stresses, a number of regulatory and/or protective proteins are produced to stabilize membrane phospholipids, membrane proteins, and cytoplasmic proteins [52], to maintain hydrophobic interactions and ion homeostasis, and to scavenge ROS [53]. Among these proteins, dehydrins are known as the characteristic stress proteins produced during abiotic stress [54]. In this study, we first investigated dehydrin gene isolated from S. involucrate (SiDHN) and its expression levels in response to cold and drought stress. Our sequence analysis indicated that SiDHN protein is highly hydrophilic and belongs to the dehydrin YK2-type (Fig 1). According to Qiu et al. and Guo et al. [55, 22], such sequence properties are plants’ essential ability to reduce water loss when they are under stress conditions. The SiDHN protein also contains over 78% of disordered structure, suggesting that it is an intrinsically disordered protein (IDP). We further found that the expression of SiDHN gene was up-regulated in S. involucrata treated with cold and drought stress (Fig 2), confirming that the SiDHN gene is involved in the plant’s response to abiotic stress [54]. Tissue-specific profiles also showed that SiDHN was expressed in the roots, stems, and leaves of S. involucrate, and the levels in leaves were highest among all three tissues, suggesting that leaves may be the first targets of abiotic stress. We then determined whether the SiDHN gene could help other plants protect against abiotic stress, and investigate the mechanism in which it exerts the effects. We transformed the SiDHN gene isolated from S. involucrata into wild-type tomato plants to produce transgenic tomato plants. We then observed agronomic traits, morphological changes and physiological changes, and determined changes of chlorophyll content, various gene expressions and enzyme activities of the transgenic plants. We found that the leaves of transgenic plants had denser and darker color (Fig 4) and contained higher Chl a and Chl b contents in the transgenic tomato plants (Fig 6) compared with the wild-type plants. Chlorophylls are the core components of pigment-protein complexes and play a major role in photosynthesis. They also help degrade ROS. Chlorophylls localize in chloroplasts, which are a major source of ROS largely produced during cold and drought stress; thus, when plants are exposed to cold and drought stress, chlorophylls are largely produced to help degrade ROS [56]. As a result, chlorophyll contents increased. The carotenoid (Car) content in the two of the three plant lines generated (OE-2 and OE-8) was also higher compared to that in the wild-type plants. The heights of transgenic tomato plants were shorter than those of he wild-type plants, in addition longer length of root, higher fresh and dry weight of root, and higher stem diameters (Fig 5), which indicates that the overexpression of SiDHN gene affects the growth and development of transgenic tomato plants. Cold and drought stress generally leads to the decline of RWC. The decline in RWC in the wild-type plants was more accentuated compared to that in the transgenic plants (Figs 8A and 9A), suggesting that SiDHN gene may play a role in protecting the transgenic tomato plants against cold and drought stress. Similar observations have been reported, in which the overexpression of wheat DHN-5 and Musa DHN-1 in transgenic Arabidopsis thaliana under drought stress was found to help alleviate the declined RWC [57]. Other studies have also shown that dehydrin can replace water molecules and combine with negatively charged biofilm liposomes to maintain the stability of biofilm [56]; thus, when combines with water molecules, they can reduce the water loss rate in leaves during water deficit stress [57, 58]. ROS produced when plants are under oxidative stress leads to higher production of MDA due to lipid peroxidation of cell membranes. Liu et al have previously shown that the heterologous expression of the maize ZmDHN13 gene causes the reduction of in MDA content in tobacco subjected to oxidative stress [20]. This is similar to our results, which showed that MDA contents in the transgenic plants under both cold and drought stress were lower compared with those in the wild-type plants (Figs 8D and 9D). The REL in transgenic lines were also higher, implying that overexpression of SiDHN could increase plants’ ability to protect against membrane damage (Figs 8C and 9C). Proline and soluble sugar contents in the transgenic plants were also increased compared with those in the wild-type plants (Figs 8 and 9). Proline is considered as a membrane stabilizer, an osmoprotectant, and a scavenger of free radicals [59]. In addition, aside from being a source of energy and carbon, soluble sugar accumulation has been reported to improve osmoregulation, protect proteins, and maintain photosynthesis during low water stress [2]. ROS is removed through the ROS-scavenging enzymes [60]. The superoxide dismutase (SOD) first catalyzes the dismutation of O2− in H2O2, and the H2O2 is subsequently converted to H2O by ascorbate peroxidase (APX), peroxidase (POX), and catalase (CAT). Studies have shown that increases in SOD, POX, and CAT activities enhance stress tolerance of dehydrin-overexpressing plants during oxidative stress [18, 20]. Our study showed that under stress, SOD activity in transgenic plant lines was elevated compared to that in the wild-type plants (Fig 10D and 11D). We also observed that the activity of other antioxidant enzymes also increased, suggesting that after the catalysis of O2- into H2O2 by SOD, POX and APX can reduce H2O2 into water. CAT also appears to help maintain ROS homeostasis, according to our results; however, aside from the OE-2 plants, the CAT activity only slightly increased in activity at 4°C (Fig 10B). Similar results were observed in the study on Sorghum bicolor dehydrins by Hadler et al in which CAT activity was found to be lower, which suggests that CAT activity may depend on H2O2 concentrations [18]. Mittler has previously reported that POX and APX can exert their functions even at low ROS levels, which indicates that both enzymes are responsible for modulation of H2O2 levels through necessary signaling events; whereas, CAT is mainly involved in preventing H2O2- induced cellular damage by removing its excess [3]. We also demonstrated that the expression of SlSOD, SlAPX, SlPOX, and SlCAT genes were up-regulated during cold and drought stress (Figs 12 and 13). Collectively, these results suggest that SiDHN had a regulatory role in mobilizing antioxidant enzymes to catalyze the ROS, lowering its level to a non-toxic level, minimizing oxidative damage to the plants. The expression of gene encoding pyrroline-5-carboxylate synthetase (SlP5CS) and lipid transfer protein (SlLTP1) were also enhanced upon stress treatments. SlP5CS is a key proline synthetase gene and, given the elevated levels of proline previously described, its increase is unsurprising. LTPs are involved in membrane biogenesis and the transport of phospholipids [61-63]. Although their mechanisms are not well understood, high LTP expression has been reported to increase plant tolerance to cold, drought and elevated H2O2 levels [64-65]. These results indicate that SiDHN modulates the expression of genes involved in stress signaling pathways, which may be one the mechanisms of enhancing tolerance to cold and drought stress of plants. Taken together, we observed that SiDHN, a downstream effector of plant responses to cold and drought stress, could improve stress responses of transgenic tomato plants by maintaining the integrity of the cell membrane, reducing chlorophyll photo-oxidation and reactive oxygen species accumulation, and improving antioxidant enzyme activity and photochemical electron transfer efficiency. Tolerance to drought and cold stress is important plant traits; therefore, SiDHN is a promising candidate gene for genetic engineering of plants to have high drought and cold stress tolerance, which could lead to large economic benefits for agricultural production. Nonetheless, further study on functions and activity of SiDHN in S. involucrata should be conducted. 6 Aug 2019 PONE-D-19-17695 Overexpression of Saussurea involucrata Dehydrin Gene SiDHN Promotes Cold and Drought Tolerance in Transgenic Tomato Plants PLOS ONE Dear %Dr. Jianbo Zhu%, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We would appreciate receiving your revised manuscript by %30th September, 2019%. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, T. R. Ganapathi, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 1. We noticed you have some minor occurrence of overlapping text with the following previous publication(s), which needs to be addressed: https://www.sciencedirect.com/science/article/abs/pii/S0098847218310566?via%3Dihub https://link.springer.com/article/10.1007%2Fs00344-017-9718-2 https://www.frontiersin.org/articles/10.3389/fpls.2017.01659/full In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed. 2. Please amend your list of authors on the manuscript to ensure that each author is linked to an affiliation. Authors’ affiliations should reflect the institution where the work was done (if authors moved subsequently, you can also list the new affiliation stating “current affiliation:….” as necessary). Additional Editor Comments (if provided): The manuscript requires major revisions based on the reviewers comments for considering it for publication. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No Reviewer #2: No ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Title of Manuscript: Overexpression of Saussurea involucrata Dehydrin Gene SiDHN Promotes Cold and Drought Tolerance in Transgenic Tomato Plants In the present manuscript, authors reported mechanisms underlying cold and drought tolerance in transgenic tomato through over expression of Saussurea involucrata dehydrin gene SiDHN. The study concluded that the engineered stress tolerance was associated with better osmotic adjustment and reduced oxidative damage. The manuscript appears to be of sufficient scientific interest and originality in its technical content to merit publication. However, it is poorly drafted and need to be re-written in consultation with the language expert. Methodology followed is sufficient to draw the conclusions, however several important details are missing. The data is analyzed statistically. Obtained results have been discussed in light of the earlier scientific reports in the area. Section wise shortcomings are mentioned below, which need to be addressed by the authors before acceptance of the manuscript. 1. Abstract: The term “tolerance” appears to be more appropriate instead of “resistance” for improved performances against abiotic stresses. Conclusion need to be written more specifically. 2. Introduction: Statements need to be supported with published scientific literature. For example please refer line no 92-95. Necessity of the research work also needs to be clearly stated. 3. Materials and methods: Plant lets of S. involucrate were regenerated through tissue culture, therefore use term “plantlets” instead of “seedlings”. Details are missing on explants, medium etc. for tissue culture of the plant. The purpose of using tissue culture raised plants need to be mentioned in the manuscript. 4. Materials and methods: Sequence analysis of SiDHN: Details on primer designing and sequencing of the PCR amplicon are missing. 5. Materials and methods: Plant Transformation: Details are missing on cloning of the gene and Agrobacterium transformation. Important details are missing on genetic transformation of tomato such as explant, co-cultivation, regeneration etc. Details are missing on RNA isolation, RT etc. 6. Materials and methods: Stress tolerance: How many plants were used for treatment? The stress treatment for short period of 2h imposes shock to the plants. Why longer treatments were not given to assess the stress tolerance and real response of the plants? Details pertaining to the bio-chemical analyses are missing. It is important to mention the biological and technical replicates for the analyses. 7. Results: Transgenic confirmation with mere kanamycin selection and PCR may not be sufficient. Statistical significance, if any, for the parameters among the transgenic and wild types need to be clearly stated rather than just mentioning the higher or lower change. The reason behind studying the transcript expression of few genes is not clearly stated. What was the criterion for selection of the genes? Whether, the PCR amplicons for the selected genes were confirmed by sequencing? What was the relation between the transcript level and activity of the coded anti-oxidant enzymes? 8. Discussion: Author stated that “expression of SiDHN was induced in S. involucrata by cold temperatures and drought (Fig 2), confirming that the gene participates in the plant’s defenses to abiotic stress”. However, it is necessary to understand that mere change in expression level of any gene does not confirm its role in plant defence, functional validation is required in support of such statement. Recommendation: Major revision Reviewer #2: The manuscript entitled “Overexpression of Saussurea involucrata Dehydrin Gene SiDHN Promotes Cold and Drought Tolerance in Transgenic Tomato Plants” describes the effect of overexpression of SiDHN in improving cold and drought stress tolerance in tomato. The study is a continuation of their earlier work (Plant Sci. 2017; 256:160–169). It is interesting but lacks detailed discussion, unexplained and/or mechanistic view of the observations. Several papers are published on dehydrins and their role of in improving abiotic stress tolerance in plants. I have the following comments which may help to improve the manuscript. 1- Introduction, material and methods and results are well covered, but the discussion is poorly written. They must explain/discuss the findings in the light of available literature. 2- Resolution of most of the figures is poor. 3- Manuscript requires extensive editing (scientific as well as grammatical). There are several errors across MS. A few are: Line 45: Use specific word than slightly. Line 50: within the transgenic? Line 73: tied to the acquisition? Line 192: change 13000 rpm to x g Youngest fully expanded leaves? Line 120-121: gene and scientific name in italics Line 193: Supernatant fluid? 4- Line 40-45: Write shorter and clear sentences. 5- Line 83-84: References 6- Line 137: Whether author are sure they have used just 80µg/L kanamycin for selection? 7- For the freezing stress, authors gave treatment for 4⁰C/2h and 0⁰C/2h. Why longer duration not selected? 8- Why two methods were used for CAT & POX estimation? 9- What is the relevance of ref. 35? 10- Conditions for the enzyme analysis (4⁰C/2h and 0⁰C/2h) and gene expression analysis (4°C chamber for 48 h and then kept at 0°C for 48 h) were different. Why? 11- Line 366: Authors claim that over-expression of SiDHN does not have any visible effect on transgenic plants. It is contradictory to what they mentioned in 326-355. They must explain why transgenic plants have higher chlorophyll content and a shorter height than control plants? WT-plants does not appear healthy. Under normal growth conditions, why leaves will have less chlorophyll. Why will dehydrin give advantage to transgenic plants under normal condition? They must explain this. 12- 213-214: Dehydrated on filter paper: Is this a standard method for drought stress? To me, it’s not convincing as there can be many variables. 13- 235: For real-time PCR, whether the author followed the MIQE guidelines? If yes, the same should be mentioned. 14- Whether MEANS in Fig. 2 were compared (statistics)? Same is not reflected. 15- There was a continuous increase in SiDHN expression under cold stress during 0-48h, unlike in drought. Why was the expression of SiDHN not monitored beyond 48h? 16- 316-319: SiDHN from S. involucrata was over-expressed (heterologous) in tomato plants. So there should not be any expression of the gene in WT-plants. But in Fig. 3A, a certain level of expression is shown. Also, they should explain if there is no expression in WT-plants, how 292,241, 139-fold mRNA levels than WT-plants was observed? 17- They have not included vector-control plants for any of their studies. Why? 18- Fig. 7: Looking at fig, it's difficult to believe uniformity among control and transgenic plants. To me, a lot of variation is visible even on day 0 in plant phenotype between even cold/drought stress experiments. 19- 454-455: Fig. 10E, F & 11 E,F should be 9 EF & 12 E,F. 20- Why levels of H2O2 and O2- were not monitored on 0, 24, 48h. That would have been one of the important aspects to link with the status of downstream antioxidant enzymes. Levels of H2O2 and O2 should be included in duration dependent ie. 0, 24, 48h to correlate the things with levels of enzymes. 21- Line 524: How would the author explain the higher levels of expression of SiDHN in leaves? 22- Fig: 7, whether the recovery of plants was observed for a longer duration. What were the results post 3days recovery? 23- Levels of SiDHN was found highest in OE8, but levels of most of the antioxidant enzymes including tolerance and survival under stress were observed in OE2 (Recovery). How would the author explain it? Similarly, in the case of expression of analysis of APX, SOD, POX (Fig. 10) shows an increase in their levels with duration. But it’s difficult to understand unless it is shown that H2O2/O2- levels also increased. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Dr Patade Vikas Yadav Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 10 Sep 2019 Comments from Reviewer 1 Comment 1: Abstract: The term “tolerance” appears to be more appropriate instead of “resistance” for improved performances against abiotic stresses. Conclusion need to be written more specifically. Response: Thank you for pointing this out, and we agree that these should be changed. Accordingly, we have changed the term and improved the conclusion in the abstract. Please refer to lines 38 and 50 – 55. Comment 2: Introduction: Statements need to be supported with published scientific literature. For example please refer line no 92-95. Necessity of the research work also needs to be clearly stated. Response: Thank you very much for pointing out. We have ensured that all statements are supported by the published literature. We have also edited and rearranged the statements so that the necessity of the research work is more clearly stated, which can be found in lines 82 – 95. Comment 3: Materials and methods: Plant lets of S. involucrate were regenerated through tissue culture, therefore use term “plantlets” instead of “seedlings”. Details are missing on explants, medium etc. for tissue culture of the plant. The purpose of using tissue culture raised plants need to be mentioned in the manuscript. Response: We agree with the reviewer on these points. Accordingly, we have changed from ‘seedlings’ to ‘plantlets’, where we find necessary, and have provided the details on explants, medium, purpose of using tissues culture to raise plants. We have also included other details necessary for the understanding of the section. We invite the reviewer to check the ‘Plant materials and growth conditions’ section in lines 111 – 122. Comment 4: Materials and methods: Sequence analysis of SiDHN: Details on primer designing and sequencing of the PCR amplicon are missing. Response: We agree with you on this point. We have incorporated the details on how the primer was designed at the bottom of Table 1, as well as on the sequencing of PCR amplicon, which was done after plasmid extraction (Lines 210 – 220). Comment 5: Materials and methods: Plant Transformation: Details are missing on cloning of the gene and Agrobacterium transformation. Important details are missing on genetic transformation of tomato such as explant, co-cultivation, regeneration etc. Details are missing on RNA isolation, RT etc. Response: Thank you so much for pointing this out. We agree with you and have incorporated new details on cloning and Agrobacterium transformation, as well as of transformation of tomato. We invite you to check the ‘Plant transformation and transgenic tomato identification’ section (Lines 210 – 237), which has been largely edited. Comment 6: Materials and methods: Stress tolerance: How many plants were used for treatment? The stress treatment for short period of 2h imposes shock to the plants. Why longer treatments were not given to assess the stress tolerance and real response of the plants? Details pertaining to the bio-chemical analyses are missing. It is important to mention the biological and technical replicates for the analyses. Response: Thank you for this comment. Please find a point-by-point response below. Response to “How many plants were used for treatment?”: We used 3 wild-type and 9 T2 transgenic tomato plants, both were ten weeks old. We have also added the corresponding details in the manuscript. Please refer to lines 141 – 142. Response to “The stress treatment for short period of 2h imposes shock to the plants”: We apologize for this error. The stress treatment was, in fact, carried out for 48 h (or 2 d), and we have changed the content accordingly. Please see line 143. Response to “Why longer treatments were not given to assess the stress tolerance and real response of the plants?”: Thank you for pointing this out. We did, in fact, carry out the treatment at a longer period, at which the stress tolerance appeared to be deteriorated. We decided to not include the data in the manuscript; however, we have included some details in the manuscript (results section) to indicate the finding. Please refer to lines 396 – 397. Response to “Details pertaining to the bio-chemical analyses are missing”: We apologize for this unclarity. We have included more details pertaining the biochemical analyses, which can be found at the beginning of each paragraph of the sections ‘Measurement of chlorophyll pigment content’ (lines 240 – 253) and ‘Determination of morphological and physiological traits’ (lines 268 – 270, lines 276 – 277, lines 283 – 285, lines 293 – 297, lines 304 – 306). Response to “It is important to mention the biological and technical replicates for the analyses”: We have included sentences stating that “Each experiment was carried out in triplicate, and three replicate samples were prepared in parallel” in all sections, where we find appropriate, such as in lines 323 – 324. Comment 7: Results: Transgenic confirmation with mere kanamycin selection and PCR may not be sufficient. Statistical significance, if any, for the parameters among the transgenic and wild types need to be clearly stated rather than just mentioning the higher or lower change. The reason behind studying the transcript expression of few genes is not clearly stated. What was the criterion for selection of the genes? Whether, the PCR amplicons for the selected genes were confirmed by sequencing? What was the relation between the transcript level and activity of the coded anti-oxidant enzymes? Response: Thank you for pointing this out. We carried out the study following a number of publications that have used the same selection method (e.g., reference [22]), which have been proven to be sufficient. We have edited the sentences, incorporating the term ‘significantly different’ or ‘significantly higher or lower’ in various areas of the manuscript, where we find appropriate. We have also largely modified the content to address the concerns above, but made throughout different areas on the manuscript. We invite the reviewer to recheck out new content, such as lines 578 – 582, lines 548 – 556, and the discussion section lines 674 – 706. Comment 8: Discussion: Author stated that “expression of SiDHN was induced in S. involucrata by cold temperatures and drought (Fig 2), confirming that the gene participates in the plant’s defenses to abiotic stress”. However, it is necessary to understand that mere change in expression level of any gene does not confirm its role in plant defence, functional validation is required in support of such statement. Response: Thank you for this comment. In fact, the participation of SiDHN in the plant’s defenses to abiotic stress has been reported previously, as can be found in, for example, reference [22] and [57], and our study confirmed such participation. Comments from Reviewer 2 Comment 1: Introduction, material and methods and results are well covered, but the discussion is poorly written. They must explain/discuss the findings in the light of available literature. Response: Thank you for pointing this out. We have largely edited and rearranged the entire discussion section so that it is presented in the way that the reviewer suggested. We do hope that it is sufficient. We invite you to check the ‘Discussion’ section in lines 609 – 716. Comment 2: Resolution of most of the figures is poor. Response: Thank you for pointing this out. We have increased the resolution of the figures, which we find most important for the comparison. Comment 3: Manuscript requires extensive editing (scientific as well as grammatical). There are several errors across MS. A few are: Line 45: Use specific word than slightly. Line 50: within the transgenic? Line 73: tied to the acquisition? Line 73: tied to the acquisition? Line 192: change 13000 rpm to x g Youngest fully expanded leaves? Line 120-121: gene and scientific name in italics Line 193: Supernatant fluid? Response: We appreciate the reviewer for pointing this out. We have corrected/changed the errors as recommended in the comment, as well as in the entire manuscript as we spotted them. Please refer the specific response below. Response to “Line 45: Use specific word than slightly”: We have changed the sentence to avoid using the word ‘slightly’ in this sentence (lines 45 – 46), as well as in all other sentences, where applicable. In many cases, we have instead incorporated the term ‘significantly’ (based on the statistical analysis). Response to “Line 50: within the transgenic?”: We have changed the expression to ‘in the transgenic plants’ (lines 46 – 47). We have also used similar expression throughout the manuscript, where we find appropriate. Response to “Line 73: tied to the acquisition?”: We have changed this expression to ‘are closely linked with’. Please refer to line 73. Response to “Line 192: change 13000 rpm to x g”: We have changed rpm to xg throughout the manuscript. The original line 192 has now been moved to a new line 332. Response to “Youngest fully expanded leaves?”: The intent of this phrase is to indicate that the leaves are young but are fully-grown. Thus, we have changed this to ‘young, fully-grown leaves’. Please refer to lines 287 – 288. Response to “Line 120-121: gene and scientific name in italics”: We have italicized the gene and scientific names accordingly throughout the manuscript. Response to “Line 193: Supernatant fluid?”: We have changed this to ‘the supernatant’, and have also rearranged the sentence. Please refer to line 309. Comment 4: Line 40-45: Write shorter and clear sentences. Response: We have removed repetition and redundancy in these sentences and changed them to: ‘We observed that in response to stresses, the SiDHN transgenic tomato plants had increased contents of chlorophyll a and b, carotenoid and relative water content compared with wild-type plants. They also had higher maximal photochemical efficiency of photosystem II and accumulated more proline and soluble sugar. Compared to those wild-type plants, malondialdehyde content and relative electron leakage in transgenic plants were not significantly increased, and H2O2 and O2- contents in transgenic tomato plants were significantly decreased.’ Please refer to lines 40 – 47. Comment 5: Line 83-84: References Response: Thank you for pointing this out. We have recounted the references and have inserted the appropriate reference numbers accordingly. Please refer to lines 82 – 84. Comment 6: Line 137: Whether author are sure they have used just 80µg/L kanamycin for selection? Response: Thank you for this question. We carried out the experiment according to the previously published article in which 80µg/L kanamycin was used for selection. We also carried out RT-PCR to confirm that the gene has been transformed. Comment 7: For the freezing stress, authors gave treatment for 4⁰C/2h and 0⁰C/2h. Why longer duration not selected? Response: We apologize for this mistake. We, in fact, conducted the treatment at each temperature for 48 h and have accordingly corrected the detail. We also carried out the treatments at a longer time period, but decided not to include it in the data. We have, however, stated in the manuscript (result section) that the tolerance was decreased at a period longer than 48 h, which can be found in lines 395 – 397. Comment 8: Why two methods were used for CAT & POX estimation? Response: We cited two references (for each estimation) that describe the same method. We have reduced the number of reference and cited to the one published in earlier year. Please refer to lines 336 and 339. Comment 9: What is the relevance of ref. 35? Response: This appears to be a mistake on our end, and we apologize for that. We, however, have made extensive changes in the manuscript, whereby reference [35] is now no longer relevant. We invite you to check the edited content, especially for the section ‘Plant treatments’ (lines 132 – 151), in which the reference [35] was originally cited. Comment 10: Conditions for the enzyme analysis (4⁰C/2h and 0⁰C/2h) and gene expression analysis (4°C chamber for 48 h and then kept at 0°C for 48 h) were different. Why? Response: We apologize for the error. This should, in fact, be 2 d or 48 h. However, I have changed it to 48 h for consistency. Comment 11: Line 366: Authors claim that over-expression of SiDHN does not have any visible effect on transgenic plants. It is contradictory to what they mentioned in 326-355. They must explain why transgenic plants have higher chlorophyll content and a shorter height than control plants? WT-plants does not appear healthy. Under normal growth conditions, why leaves will have less chlorophyll. Why will dehydrin give advantage to transgenic plants under normal condition? They must explain this. Response: We apologize for this mistake. The overexpression of SiDHN did, in fact, affect the phenotypes of the transgenic plants. Thus, we have made some revisions regarding this issue both in the results and the discussion sections, which should cover the questions stated above. We invite the reviewer to re-check the revised contents; for example, in the ‘results’ sections lines 470 – 471, and in the ‘discussion’ section lines 632 – 648. Comment 12: 213-214: Dehydrated on filter paper: Is this a standard method for drought stress? To me, it’s not convincing as there can be many variables. Response: Thank you for this comment. We, in fact, carried out this experiment following the method described in Zhu et al [23], which has been proven to be sufficient. Comment 13: 235: For real-time PCR, whether the author followed the MIQE guidelines? If yes, the same should be mentioned. Response: Thank you for pointing this out. Yes, we did follow the MIQE guidelines and accordingly, have included the statement in the manuscript. Please refer to line 161. Comment 14: Whether MEANS in Fig. 2 were compared (statistics)? Same is not reflected. Response: Thank you for this comment. We did all comparisons statistically and have included the details in the description of figure 2, as well as others where we find necessary for the better understanding of the content. Comment 15: There was a continuous increase in SiDHN expression under cold stress during 0-48h, unlike in drought. Why was the expression of SiDHN not monitored beyond 48h? Response: We, in fact, carried out the treatment at each temperature beyond 48 h but decided not to include it in the data. We have, however, stated the finding in the manuscript (result section), which can be found in lines 396 – 397. Comment 16: 316-319: SiDHN from S. involucrata was over-expressed (heterologous) in tomato plants. So there should not be any expression of the gene in WT-plants. But in Fig. 3A, a certain level of expression is shown. Also, they should explain if there is no expression in WT-plants, how 292,241, 139-fold mRNA levels than WT-plants was observed? Response: Thank you for this comment. Yes, there was indeed no expression of the SiDHN gene in the wild-type potato plants. The comparison was based on the assumption set in ‘Statistical analysis’ section, which states that ‘the expression level at 0 h (control time point) was defined as 1.0’. However, we decided to not include these numbers in the manuscript, rather we stated that ‘Three independent homozygous lines (OE-2, OE-5, and OE-8) that had higher expression levels of SiDHN were selected for further studies (Fig 3).’ Please refer to lines 422 – 423. Comment 17: They have not included vector-control plants for any of their studies. Why? Response: Thank you for pointing this out. We carried out the experiment following the previous publication on SiDHN (e.g. reference [22]); thus, we decided that not including vector-control plants should be appropriate. And we believe that the results should provide insights into the understanding of SiDHN gene expression to some extent. Comment 18: Fig. 7: Looking at fig, it's difficult to believe uniformity among control and transgenic plants. To me, a lot of variation is visible even on day 0 in plant phenotype between even cold/drought stress experiments. Response: We agree with the reviewer on this and have changed/edited some sentences so that the content more clearly presents such differences. We invite the reviewer to re-check the section ‘Morphological changes of SiDHN-overexpressing transgenic tomato plants under cold and drought stress’ (Lines 470 – 471). Comment 19: 454-455: Fig. 10E, F & 11 E,F should be 9 EF & 12 E,F. Response: Thank you very much for pointing out this error. We have changed the content accordingly. Please see lines 558 – 559. Comment 20: Why levels of H2O2 and O2- were not monitored on 0, 24, 48h. That would have been one of the important aspects to link with the status of downstream antioxidant enzymes. Levels of H2O2 and O2 should be included in duration dependent ie. 0, 24, 48h to correlate the things with levels of enzymes. Response: We decided to determine the levels of H2O2 and O2- in correspondent to the enzyme activity (Fig. 9), which was determined at the end of the treatment (48 h). We think that in our future study, we should determine such levels at various times as the reviewer suggested. In addition, because the gene expression does not necessarily determine the enzyme activity; therefore, we measured the levels of the levels of H2O2 and O2- only when the enzyme activity was measured so that we can better correlate the results. Comment 21: Line 524: How would the author explain the higher levels of expression of SiDHN in leaves? Response: There have been only a few studies on the effects of SiDHN overexpression on plant growth and development. For example, Nylander et al. [55] believed the expression of the dehydrin gene may be related to its function and can also be affected by different stages of plant development under stress. Stupnikova et al. [56] proposed that plants have different resilience at different developmental stages: the expression of dehydrin is high when they are under high resilience. These studies have also shown that the expressions of many dehydrins are specific to tissues, and the growth conditions can also affects the expression levels. The studies, however, have not focused on the expression in different plant tissues. Nonetheless, based on out results, we believe that the higher level of expression in leaves may be due to high resilience in leaves, which may be the first target of stress. We have accordingly incorporated the mention in lines 625 – 628. Comment 22: Fig: 7, whether the recovery of plants was observed for a longer duration. What were the results post 3days recovery? Response: Thank you for this comment. We did indeed observed the recovery after 3 days (we decided to not include the data) and found that the wild-type tomato plants could not recover and showed no signs of growth, while the transgenic tomato plants could recover (side buds were exposed in the stem, and middle and bottom leaves were restored) only when the apex remained intact. Comment 23: Levels of SiDHN was found highest in OE8, but levels of most of the antioxidant enzymes including tolerance and survival under stress were observed in OE2 (Recovery). How would the author explain it? Similarly, in the case of expression of analysis of APX, SOD, POX (Fig. 10) shows an increase in their levels with duration. But it’s difficult to understand unless it is shown that H2O2/O2- levels also increased. Response: Thank you very much for this question. In fact, the expression level of SiDHN was highest in OE-2 (was lowest in OE-8; as can be seen in Fig 3) and is correspondent with its tolerance and survival under stress (e.g. Fig 7). Regarding the expression of APX, SOD and POX, we invite the reviewer to compare the levels of APX, SOD and POX at 48 h in Fig 10 with the levels of H2O2 and O2- (measured at 48 h) in Fig 9, particularly for OE-2: we can see that the levels of APX, SOD and POX were highest, while the levels of H2O2 and O2- were lowest. We do hope that the explanation is clear. In addition to the corrections above, we have also checked and corrected other errors found during the revision. Submitted filename: Response to Reviewers.docx Click here for additional data file. 11 Oct 2019 PONE-D-19-17695R1 Overexpression of Saussurea involucrata  Dehydrin Gene SiDHN  Promotes Cold and Drought Tolerance in Transgenic Tomato Plants PLOS ONE Dear %Jianbo Zhu%, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. ============================== ACADEMIC EDITOR: The manuscript needs to be revised based on the comments of reviewer 1. ============================== We would appreciate receiving your revised manuscript by %within one month from the date of this letter%. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, T. R. Ganapathi, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (if provided): Revise the manuscript based on the comments of reviewer 1. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: (No Response) Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Comments Title of Manuscript: Overexpression of Saussurea involucrata Dehydrin Gene SiDHN Promotes Cold and Drought Tolerance in Transgenic Tomato Plants The authors have made efforts to sufficiently revised manuscript based on the comments. However, still there are several shortcomings as mentioned below, which need to be addressed by the authors before acceptance of the manuscript. 1. Abstract: The term “tolerance” appears to be more appropriate instead of “resistance” for improved performances against abiotic stresses. Please check line no 54-56. 2. Materials and methods: Line 111: Plantlets of S. involucrata were prepared by tissue culture. It is not clear why authors followed tissue culture to produce plant lets. Moreover, progeny obtained through indirect regeneration may not be true to type due to somaclonal variations. Whether the obtained plantlets were not hardened? Line No 117: NAA (N-acetyl-aspartate); Please check full form of NAA. Lines 123-124: Tomato plant variety ‘Yaxin 87-5’ used as transgenic plants were grown from 124 seeds provided by Yaxin Seed Co. Ltd. (Shihezhi City, Xinjiang, China). Please rewrite the sentence, as meaning is not clear. Whether, genetic transformation of tomato was carried out by the authors or transgenic seeds provided by Yaxin Seed Co. Ltd were used to grow the transgenic plants for the present study? Line 126-127: After that, they were sown in plastic pots ....Do you mean the plantlets were transplanted in plastic pots.... Line 146-148: Top-second and -third leaves of the plants were harvested at 4°C and 0 °C after the 48 h treatment and at 0, 16 and 24 d after the 148 drought treatment. Meaning of the sentence is not clear. Line 217-218: ....and the obtained plasmid was regenerated in Escherichia coli DH5 alpha. Do you mean “the obtained plasmid was transformed in Escherichia coli strain DH5α ?” Line No. 221-223. To produce transgenic potato plants, the wild-type tomato plants were transformed ….. What do you mean? Transgenic potato plants were developed after transforming tomato? Lines 258 – 260: Measurement of chlorophyll pigment content: ....the supernatant was subjected to absorbance measurements at 470 nm, 645 nm, and 663 nm to determine the contents of chlorophyll a (Chl a), chlorophyll b (Chl b), and carotenoids (Car), respectively. Do you mean, the estimations of chl a, chl b and car are based on absorbance at single wavelength? Line No 318: .....for 10 min, 200 mL of the supernatant was mixed with 1.8.... Is it 200mL or 200µl? 3. Results: Author should elaborate the results on effect of cold and drought treatments on physio-biochemical traits in wild type and transgenic plants. Further, relation between the transcript level and activity of the coded anti-oxidant enzymes need to be stated in detail. Fig 5,6: X Axis title: Instead of “Different strains”, “Different lines” is appropriate. 4. Discussion: Line No 651-652:..... in protecting the transgenic potato plants against cold and drought stress. Potato or tomato? Recommendation: Major revision Reviewer #2: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 24 Oct 2019 October 24, 2019 T. R. Ganapathi, Ph.D. Academic Editor PLOS ONE Dear editor: We highly appreciate you and the reviewers for reviewing our manuscript and giving us the opportunity to submit a revised draft of our manuscript titled “Overexpression of Saussurea involucrata Dehydrin Gene SiDHN Promotes Cold and Drought Tolerance in Transgenic Tomato Plants” to PLOS ONE. We also appreciate your and the reviewers’ valuable and insightful feedback on our manuscript. We have carefully considered the reviewer’s comments and respond to all of the suggested revisions in more detail below. The reviewers’ comments are italics and our responses are in plain text; line and page numbers refer to the revised manuscript. Comments from Reviewer 1 Comment 1: Abstract: The term “tolerance” appears to be more appropriate instead of “resistance” for improved performances against abiotic stresses. Please check line no 54-56. Response: Thank you for this comment. We agree to the reviewer and have changed the term accordingly. Please see line 56. Comment 2: Materials and methods: Comment: Line 111: Plantlets of S. involucrata were prepared by tissue culture. It is not clear why authors followed tissue culture to produce plantlets. Moreover, progeny obtained through indirect regeneration may not be true to type due to somaclonal variations. Whether the obtained plantlets were not hardened? Response: Thank you for this comment. We followed the tissue culture to produce plantlets due to the following reasons: 1.Due to its special growth conditions, artificial propagation of Saussurea involucrata is very difficult. Because plant tissue culture technology is not limited by time, place, climate and other environmental conditions, the culture conditions can be easily controlled and can achieve long-term preservation. This not only allows researchers to produce the plants at a large scale at any time, but also provides an important way for mass propagation of medicinal plant S. involucrata. 2.The sequence of SiDHN was obtained by sequencing of the full-length cDNA library of Saussurea involucrata. And the materials used to build the library were obtained by tissue culture seedling that has been preserved in our laboratory for a long period of time. More importantly, the cloning of SiDHN used in this study was from the same tissue culture and materials. 3.We compared the cDNA sequence of SiDHN gene cloned in this paper with the full-length cDNA sequence of Saussurea involucrata from the database, and found that they were 100% identical. This should be an indication that our method is reliable. 4.This approach has been widely reported. Please see below for example publications that have conducted similar experiments and have used similar methods. �Xinyong Guo, Li Zhang, Gaoquan Dong, Zhihua Xu, Guiming Li, Ning Liu, Aiying Wang, Jianbo Zhu. A novel cold-regulated protein isolated from Saussurea involucrata confers cold and drought tolerance in transgenic tobacco (Nicotiana tabacum). Plant Science, 2019, 289: 110246. �Linhua Zhang, Li Sun, Li Zhang, Hongling Qiu, Chao Liu, Aiying Wang, Jianbo Zhu. A Cu/Zn superoxide dismutase gene from Saussurea involucrata Kar. & Kir., SiCSD, enhances drought, cold, and oxidative stress in transgenic tobacco, Canadian Journal of Plant Science. 2017, 97(5): 816-826. �Liu HL, Shen HT, Chen C, Zhou XR, Liu H, and Zhu JB. Identification of a putative stearoyl acyl-carrier-protein desaturase gene from Saussurea involucrata. Biologia Plantarum. 2015, 59 (2): 316-324. Comment: Line No 117: NAA (N-acetyl-aspartate); Please check full form of NAA. Response: Thank you for pointing this out. We have changed it to the correct name, which is ‘1-Naphthaleneacetic acid’. Please see line 117. Comment: Lines 123-124: Tomato plant variety ‘Yaxin 87-5’ used as transgenic plants were grown from 124 seeds provided by Yaxin Seed Co. Ltd. (Shihezhi City, Xinjiang, China). Please rewrite the sentence, as meaning is not clear. Whether, genetic transformation of tomato was carried out by the authors or transgenic seeds provided by Yaxin Seed Co. Ltd were used to grow the transgenic plants for the present study? Response: Thank you for this comment. Yaxin Seed Co. Ltd. provided the wild-type tomato plant seeds (variety "Yaxin 87-5"), not the transgenic tomato plants/seeds. We then grew tomato plants from the seeds (denoted as wild-type tomato plants), and the plants obtained were used to generate the transgenic tomato plants (denoted as transgenic tomato plants). Accordingly, we have changed the sentence to the following: ‘Seeds of tomato plant variety ‘Yaxin 87-5’ (wild-type) were provided by Yaxin Seed Co. Ltd. (Shihezhi City, Xinjiang, China). The wild-type tomato plants were grown from the seeds in our laboratory and were used to produce transgenic tomato plants.’ Please refer to lines 123-126. We do hope that it is now clearer. Comment: Line 126-127: After that, they were sown in plastic pots ....Do you mean the plantlets were transplanted in plastic pots.... Response: Thank you for the comment. That is correct. Accordingly, we have changed the sentence to ‘After that, the plantlets were transplanted in plastic pots.’ line 128. Comment: Line 146-148: Top-second and -third leaves of the plants were harvested at 4°C and 0 °C after the 48 h treatment and at 0, 16 and 24 d after the 148 drought treatment. Meaning of the sentence is not clear. Response: Thank you for this comment. Please note that there should be no ‘148’ in the manuscript; we are not sure if this number shows in the reviewer’s file. We collected the second and the third leaves from the top of the plants. The leaves of the cold-treated plants (at both temperatures) were collected at 48 h, which is the end of the treatment, and the leaves of the drought-treated plants were collected at day 0, 16, and 24. We have changed the sentence to: ‘Tomato leaves (the second and third leaves from the top) were collected after 48 h of the cold treatments (4oC and 0oC), or after 0, 16 and 24 d of the drought treatment.’ We do hope that it is now clearer. Please see lines 148-150. Comment: Line 217-218: ....and the obtained plasmid was regenerated in Escherichia coli DH5 alpha. Do you mean “the obtained plasmid was transformed in Escherichia coli strain DH5α ?” Response: Thank you for this comment. Yes, it is in fact more accurate to write ‘… and the obtained plasmid was transformed into Escherichia coli strain DH5α’. We have changed the sentence accordingly (lines 218-219). Comment: Line No. 221-223. To produce transgenic potato plants, the wild-type tomato plants were transformed ….. What do you mean? Transgenic potato plants were developed after transforming tomato? Response: We apologize for this error and thank you for pointing it out. All should be ‘tomato’, and we have changed all accordingly. We have also ensured that the word ‘potato’ no longer exists in our manuscript. Thank you very much again. Comment: Lines 258-260: Measurement of chlorophyll pigment content: ....the supernatant was subjected to absorbance measurements at 470 nm, 645 nm, and 663 nm to determine the contents of chlorophyll a (Chl a), chlorophyll b (Chl b), and carotenoids (Car), respectively. Do you mean, the estimations of chl a, chl b and car are based on absorbance at single wavelength? Response: Thank you for this question. We determined the contents of Chl a, Chl b, and Car using the wavelengths described in the sentence. And the contents were calculated by the following equations: Chl a = 12.21*A663 – 2.81*A645 Chl b = 20.13*A645 – 5.03*A663 Car = (1000*A470 – 3.27*Chl a – 104*Chl b)/229. Accordingly, we have changed the content to ‘After centrifugation, the supernatant was subjected to absorbance measurements at 470 nm, 645 nm, and 663 nm, and the contents of chlorophyll a (Chl a), chlorophyll b (Chl b), and carotenoids (Car) were calculated by the following equations: Chl a = 12.21*A663 – 2.81*A645; Chl b = 20.13*A645 – 5.03*A663; and Car = (1000*A470 – 3.27*Chl a – 104*Chl b)/229.’ Please refer to lines 262-264. Comment: Line No 318: .....for 10 min, 200 mL of the supernatant was mixed with 1.8.... Is it 200mL or 200µl? Response: We appreciate the comment and apologize for the error. This should in fact be 2 mL (not 200 mL). We have corrected the sentence accordingly (line 324). Comment 3: Results: Author should elaborate the results on effect of cold and drought treatments on physio-biochemical traits in wild type and transgenic plants. Further, relation between the transcript level and activity of the coded anti-oxidant enzymes need to be stated in detail. Fig 5,6: X Axis title: Instead of “Different strains”, “Different lines” is appropriate. Response: Thank you for this comment. The study showed that overexpression of SiDHN alleviated the accumulation of ROS by upregulating the activity of ROS scavenging enzymes SOD, POD, CAT and POX under low temperature and drought stress conditions (Figs. 10 and 11). To study why transgenic plants can maintain relatively high antioxidant enzyme activity under low temperature and drought stress, we measured the expressions of related genes encoding SOD, POD, CAT and APX. RT-PCR results showed that the expressions of SlSOD, SlPOD, SlCAT and SlAPX were significantly up-regulated in SiDHN transgenic plants OE-2, OE-5 and OE-8 (Figs. 12 and 13). These results indicate that overexpression of SiDHN may be able to improve the expression of antioxidant related genes, thus increasing the activity of the corresponding antioxidant enzymes, enhancing ROS clearance, and in turn reducing cell membrane damage caused by low temperature- and drought-induced oxidative stress. We have incorporated similar details as those outlined above into the manuscript. We invite the reviewer to check the revised paragraph in pages 17 and 18, and we hope that it is now clearer and sufficient. Regarding Figs. 5 and 6, we have accordingly changed the X-axis title (from ‘Different strains’ to ‘Different lines’). Comment 4: Discussion: Line No 651-652:..... in protecting the transgenic potato plants against cold and drought stress. Potato or tomato? Response: We sincerely apologize for this error and thank you very much for pointing it out. All should be ‘tomato’, and we have changed all accordingly. We have also ensured that the word ‘potato’ no longer exists in our manuscript. In addition to the corrections above, we have also checked and corrected other errors found during the revision. We do hope that you find our responses and corrections satisfactory. We look forward to hearing from you regarding our submission and are pleased to respond to any further questions and comments you may have. Sincerely, Jianbo Zhu Key Laboratory of Agricultural Biotechnology College of Life Science, Shihezi University, Shihezi, Xinjiang, China Phone No: 18935701090 Fax No: 18935701090 E-mail Address: jianboz9@sina.com Submitted filename: Response to Reviewers.docx Click here for additional data file. 30 Oct 2019 Overexpression of Saussurea involucrata  Dehydrin Gene SiDHN  Promotes Cold and Drought Tolerance in Transgenic Tomato Plants PONE-D-19-17695R2 Dear Dr. Jianbo Zhu, We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication. Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. With kind regards, T. R. Ganapathi, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): The manuscript is accepted for publication. Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The manuscript has been substantially revised by the authors to address all the comments. Hence the revised manuscript is recommended for publication. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No 8 Nov 2019 PONE-D-19-17695R2 Overexpression of Saussurea involucrata Dehydrin Gene SiDHN Promotes Cold and Drought Tolerance in Transgenic Tomato Plants Dear Dr. Zhu: I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. For any other questions or concerns, please email plosone@plos.org. Thank you for submitting your work to PLOS ONE. With kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. T. R. Ganapathi Academic Editor PLOS ONE
  52 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

2.  Differential turnover of the photosystem II reaction centre D1 protein in mesophyll and bundle sheath chloroplasts of maize.

Authors:  Berenika Pokorska; Maksymilian Zienkiewicz; Marta Powikrowska; Anna Drozak; Elzbieta Romanowska
Journal:  Biochim Biophys Acta       Date:  2009-05-18

3.  Effects of Elevated Cytosolic Glutathione Reductase Activity on the Cellular Glutathione Pool and Photosynthesis in Leaves under Normal and Stress Conditions.

Authors:  C Foyer; M Lelandais; C Galap; K J Kunert
Journal:  Plant Physiol       Date:  1991-11       Impact factor: 8.340

4.  Structural investigation of disordered stress proteins. Comparison of full-length dehydrins with isolated peptides of their conserved segments.

Authors:  Jean-Marie Mouillon; Petter Gustafsson; Pia Harryson
Journal:  Plant Physiol       Date:  2006-03-24       Impact factor: 8.340

Review 5.  Leaf disk transformation using Agrobacterium tumefaciens-expression of heterologous genes in tobacco.

Authors:  P Gallois; P Marinho
Journal:  Methods Mol Biol       Date:  1995

6.  Cloning and characterization of SiDHN, a novel dehydrin gene from Saussurea involucrata Kar. et Kir. that enhances cold and drought tolerance in tobacco.

Authors:  Xinyong Guo; Li Zhang; Jianbo Zhu; Hongling Liu; Aiying Wang
Journal:  Plant Sci       Date:  2016-12-26       Impact factor: 4.729

7.  Induction of a Crassulacean acid like metabolism in the C(4) succulent plant, Portulaca oleracea L.: physiological and morphological changes are accompanied by specific modifications in phosphoenolpyruvate carboxylase.

Authors:  María V Lara; Karen B Disante; Florencio E Podestá; Carlos S Andreo; María F Drincovich
Journal:  Photosynth Res       Date:  2003       Impact factor: 3.573

8.  Enhancement of cold tolerance and inhibition of lipid peroxidation by citrus dehydrin in transgenic tobacco.

Authors:  Masakazu Hara; Shogo Terashima; Tomoko Fukaya; Toru Kuboi
Journal:  Planta       Date:  2003-02-15       Impact factor: 4.116

9.  Silencing of dehydrin CaDHN1 diminishes tolerance to multiple abiotic stresses in Capsicum annuum L.

Authors:  Ru-gang Chen; Hua Jing; Wei-li Guo; Shu-Bin Wang; Fang Ma; Bao-Gui Pan; Zhen-Hui Gong
Journal:  Plant Cell Rep       Date:  2015-09-25       Impact factor: 4.570

Review 10.  Proline: a multifunctional amino acid.

Authors:  László Szabados; Arnould Savouré
Journal:  Trends Plant Sci       Date:  2009-12-23       Impact factor: 18.313

View more
  12 in total

1.  Production of purple Ma bamboo (Dendrocalamus latiflorus Munro) with enhanced drought and cold stress tolerance by engineering anthocyanin biosynthesis.

Authors:  Mengqi Xiang; WenSha Ding; Chu Wu; Wenjia Wang; Shanwen Ye; Changyang Cai; Xin Hu; Nannan Wang; Weiyuan Bai; Xiaoshan Tang; Caiping Zhu; Xiaomin Yu; Qian Xu; Yushan Zheng; Zhaojun Ding; Chentao Lin; Qiang Zhu
Journal:  Planta       Date:  2021-08-12       Impact factor: 4.116

Review 2.  Drought tolerance improvement in Solanum lycopersicum: an insight into "OMICS" approaches and genome editing.

Authors:  Sima Taheri; Saikat Gantait; Parisa Azizi; Purabi Mazumdar
Journal:  3 Biotech       Date:  2022-02-08       Impact factor: 2.406

3.  The NAC-type transcription factor GmNAC20 improves cold, salinity tolerance, and lateral root formation in transgenic rice plants.

Authors:  Rajesh Yarra; Wei Wei
Journal:  Funct Integr Genomics       Date:  2021-06-30       Impact factor: 3.410

Review 4.  Involvement of dehydrin proteins in mitigating the negative effects of drought stress in plants.

Authors:  Riyazuddin Riyazuddin; Nisha Nisha; Kalpita Singh; Radhika Verma; Ravi Gupta
Journal:  Plant Cell Rep       Date:  2021-05-31       Impact factor: 4.570

5.  Biochemical and transcriptomic analyses of the symbiotic interaction between Cremastra appendiculata and the mycorrhizal fungus Coprinellus disseminatus.

Authors:  Yanyan Gao; Jun Ji; Yujin Zhang; Ningxian Yang; Mingsheng Zhang
Journal:  BMC Plant Biol       Date:  2022-01-04       Impact factor: 4.215

6.  The key regulator LcERF056 enhances salt tolerance by modulating reactive oxygen species-related genes in Lotus corniculatus.

Authors:  Dan Wang; Zhanmin Sun; Xinxu Hu; Junbo Xiong; Lizhen Hu; Yuandong Xu; Yixiong Tang; Yanmin Wu
Journal:  BMC Plant Biol       Date:  2021-12-29       Impact factor: 4.215

Review 7.  Plant Dehydrins: Expression, Regulatory Networks, and Protective Roles in Plants Challenged by Abiotic Stress.

Authors:  Zhenping Sun; Shiyuan Li; Wenyu Chen; Jieqiong Zhang; Lixiao Zhang; Wei Sun; Zenglan Wang
Journal:  Int J Mol Sci       Date:  2021-11-23       Impact factor: 5.923

8.  Genome-Wide Analysis of the DUF4228 Family in Soybean and Functional Identification of GmDUF4228 -70 in Response to Drought and Salt Stresses.

Authors:  Zhi-Xin Leng; Ying Liu; Zhan-Yu Chen; Jun Guo; Jun Chen; Yong-Bin Zhou; Ming Chen; You-Zhi Ma; Zhao-Shi Xu; Xi-Yan Cui
Journal:  Front Plant Sci       Date:  2021-05-17       Impact factor: 5.753

9.  The Soybean bZIP Transcription Factor Gene GmbZIP2 Confers Drought and Salt Resistances in Transgenic Plants.

Authors:  Yan Yang; Tai-Fei Yu; Jian Ma; Jun Chen; Yong-Bin Zhou; Ming Chen; You-Zhi Ma; Wen-Liang Wei; Zhao-Shi Xu
Journal:  Int J Mol Sci       Date:  2020-01-20       Impact factor: 5.923

10.  CaDHN3, a Pepper (Capsicum annuum L.) Dehydrin Gene Enhances the Tolerance against Salt and Drought Stresses by Reducing ROS Accumulation.

Authors:  Yuan-Cheng Meng; Hua-Feng Zhang; Xiao-Xiao Pan; Nan Chen; Hui-Fang Hu; Saeed Ul Haq; Abid Khan; Ru-Gang Chen
Journal:  Int J Mol Sci       Date:  2021-03-22       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.