Literature DB >> 31729096

Ubiquitin carboxyl-terminal hydrolase L1 promotes hypoxia-inducible factor 1-dependent tumor cell malignancy in spheroid models.

Xuebing Li1, Akira Hattori1, Senye Takahashi1, Yoko Goto2, Hiroshi Harada3, Hideaki Kakeya1.   

Abstract

Hypoxia-inducible factor 1 (HIF-1) is a critical heterodimeric transcription factor for tumor malignancy. Recently, ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) has been reported to function as a deubiquitinating enzyme for the stabilization of its α subunit (HIF-1α). In the present study, we showed that UCHL1 inhibition can be an effective therapeutic strategy against HIF-1-dependent tumor malignancy. In 2D monolayer culture, a UCHL1 inhibitor suppressed HIF activity and decreased the transcription of HIF downstream genes by inhibiting the UCHL1-mediated accumulation of HIF-1α. Phenotypically, UCHL1 inhibition remarkably blocked cell migration. In 3D spheroid culture models, ectopic expression of UCHL1 significantly upregulated malignancy-related factors such as solidity, volume, as well as viable cell number in an HIF-1α-dependent manner. Conversely, inhibition of the UCHL1-HIF-1 pathway downregulated these malignancy-related factors and also abolished UCHL1-mediated cell proliferation and invasiveness. Finally, inhibition of UCHL1 promoted HIF-1α degradation and lowered the expression of HIF-1 target genes in the 3D model, as also observed in 2D monolayer culture. Our research indicates that the UCHL1-HIF-1 pathway plays a crucial role in tumor malignancy, making it a promising therapeutic target for cancer chemotherapy.
© 2019 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Entities:  

Keywords:  hypoxia-inducible factor 1; molecular target; spheroid; tumor malignancy; ubiquitin carboxyl-terminal hydrolase L1

Mesh:

Substances:

Year:  2019        PMID: 31729096      PMCID: PMC6942421          DOI: 10.1111/cas.14236

Source DB:  PubMed          Journal:  Cancer Sci        ISSN: 1347-9032            Impact factor:   6.716


INTRODUCTION

Ubiquitin carboxyl‐terminal hydrolase L1 (UCHL1) is a 223‐amino acid protein that belongs to the ubiquitin carboxyl‐terminal hydrolase (UCH) family of deubiquitinating enzymes.1, 2 UCHL1 catalyzes the release of a ubiquitin (Ub) moiety from C‐terminal extended Ub, such as Ub precursors and C‐terminal Ub thioesters, to generate a monomeric Ub pool via de novo synthesis and salvage pathways.3 It is also reported that UCHL1 digests poly‐Ub chains conjugated to β‐catenin by SCFβ‐Trcp E3 ligase complex.4, 5 Conversely, homodimeric and membrane‐associated farnesylated UCHL1 is able to catalyze the formation of Lys48‐linked poly‐Ub chains on α‐synuclein by acting as an E3 Ub ligase.6 Ubiquitin carboxyl‐terminal hydrolase L1 was originally identified as a brain‐specific protein, known as protein‐gene‐product (PGP) 9.5, by 2D polyacrylamide gel electrophoresis analysis.7 The distribution of this enzyme in normal tissue is known to be highly limited, particularly in the brain,8 and moderately expressed in the pancreas,9 testis10 and urinary bladder.11 Aberrant expression of UCHL1 has been reported in renal cancer,12 non‐small cell lung cancer,13 gastric cancer14 and colorectal cancer.5 In colorectal tumor tissues, UCHL1 was shown to activate the β‐catenin/TCF signaling pathway by releasing an Ub moiety conjugated to β‐catenin, resulting in the promotion of tumor malignancy.15 Hypoxia‐inducible factor (HIF) is known to have pivotal roles in tumor malignancy16 and is considered a promising molecular target for cancer chemotherapy.17, 18, 19 HIF is a heterodimeric protein comprising α and β subunits: HIF‐1α, HIF‐2α and HIF‐3α, and HIF‐1β.20, 21 The protein expression levels of HIF‐1α and HIF‐2α are oxygen‐dependent and are tightly regulated by the ubiquitin‐proteasome pathway.22 Briefly, under aerobic conditions, two proline residues in the oxygen‐dependent degradation (ODD) domain (eg, Pro‐402 and Pro‐564 of human HIF‐1α) are hydroxylated by a dioxygenase named prolyl‐4‐hydroxylase (PHD).23 The von‐Hippel‐Lindau tumor suppressor‐elongin B/C‐cullin 2 (VHL‐EloBC‐Cul2) E3 ligase complex is recruited onto the hydroxylated Pro‐residues, and conjugates Lys48‐linked poly‐Ub chain on the ε‐NH2 residue of HIF‐1α and HIF‐2α.24 Conversely, in hypoxic microenvironments such as those in solid tumors, α subunit escapes degradation and is translocated to the nucleus, forming a heterodimer with HIF‐1β.25 HIF specifically transactivates a variety of genes under promoter containing hypoxia‐responsive elements (HRE), including GLUT1 and CA9.20, 26 Previously, we reported that UCHL1 functions as a deubiquitinating enzyme for the stabilization of HIF‐1α while blockade of the UCHL1‐HIF‐1α pathway suppresses the formation of metastatic tumors in mouse models.27 Recently, 3D culture systems have been increasingly and widely applied in preclinical studies to provide more physiologically relevant information. Compared with 2D cell culture, 3D cultured cells exhibit more similarities with tumor tissues with regards to cell morphology, proliferation, stage of cell cycle, gene expression and drug sensitivity.28 Among these, higher expression of HIF‐1α is considered as a critical factor that contributes to these features of 3D culture.29 Therefore, we consider it crucial to elucidate the significance of the UCHL1‐HIF‐1α pathway in a 3D culture system. In the present study, we investigated the potential roles of UCHL1 in cancer therapeutic approaches using a 3D spheroid culture system. We revealed that depletion of UCHL1 by siRNA or blockade of its deubiquitinating activity with a specific inhibitor caused a remarkable decrease in HIF‐1α protein levels in 3D spheroid culture models. Resulting reduction in expression of HIF‐1α target genes in the spheroids, which are closely related to tumor malignancy including metastasis, cell proliferation and angiogenesis, was observed. These findings suggest that the UCHL1‐HIF‐1α pathway is a promising therapeutic target in anticancer chemotherapy.

MATERIALS AND METHODS

Plasmids and purification of recombinant protein

To construct pGEX6p‐2/UCHL1, DNA encoding human UCHL1 gene was digested between EcoRV and XhoI in pcDNA4/UCHL1. This DNA fragment was then inserted between the SmaI and XhoI sites of PGEX6p‐2 (Invitrogen). E coli DH5α harboring pGEX6p‐2/UCHL1 plasmid was induced with isopropyl β‐D‐1‐thiogalactopyranoside. E coli DH5α was treated with sonication and dissolved in lysis buffer (50 mmol/L Tris‐HCl [pH 8.0], 0.1 mol/L NaCl, 1 mmol/L EDTA, 1 mmol/L DTT, 1% Triton X‐100) The fusion protein GST/UCHL1 was first purified with glutathione‐Sepharose 4B beads (GE Healthcare UK) and eluted with 20 mmol/L of glutathione (GSH; pH 8.5).

Cell culture and reagents

HeLa, MDA‐MB‐231 and MDA‐MB‐436 cells were purchased from the American Type Culture Collection. Cells were incubated in DMEM containing 10% FBS and cultured in a well‐humidified incubator with 5% CO2 and 95% air. For ˂0.1% O2 hypoxic incubation, cells were kept in a Bactron Anaerobic Chamber, BACTRONEZ (Sheldon Manufacturing, Cornelius). For ˂1% O2 incubation, cells were kept in a multi‐gas incubator, MCO‐5M (Panasonic). Camptothecin (CPT) and LDN57444 were obtained from FUJIFILM Wako Pure Chemical and Sigma‐Aldrich, respectively. For 2D culture, Falcon tissue culture plates from Corning are used.

Transient transfection

In HeLa cells, Lipofectamine 2000 (Thermo Fisher Scientific) was used at a ratio of 3:1 (reagent : DNA) to transiently transfect HeLa/5HRE‐Luc cells with pcDNA4/UCHL1 plasmid. In MDA‐MB‐231 and MDA‐MB‐436 cells, Lipofectamine LTX Reagent (Thermo Fisher Scientific) was used at a ratio of 9:1 (reagent : DNA) for transfection. Lipofectamine 3000 (Thermo Fisher Scientific) was used at a ratio of 2:1 (reagent : DNA) and 1:10 (μL of reagent : pmol of siRNA) for the co‐transfection in MDA‐MB‐231 cells.

Luciferase assay and western blotting

For luciferase assays, HeLa/5HRE‐Luc or HeLa/ ODD‐Luc cells were seeded in 96‐well plates at a concentration of 1 × 105 cells/mL and incubated under normoxic conditions. After a 24‐hour incubation, cells were treated with each reagent for 1 hour. Cells were then transferred to normoxic or hypoxic conditions for another 24‐hour incubation and harvested in 100 μL of passive lysis buffer (Promega). Luciferase assays were performed using 100 μL of luciferase assay reagent (Promega) or dual luciferase assay kit (Promega) according to the manufacturer’s instructions. Western blotting analysis was performed using anti–HIF‐1α (BD Biosciences), anti–UCHL1 (R&D Systems), anti–α‐tubulin (Sigma‐Aldrich), anti–β‐actin (Sigma‐Aldrich) and anti–β‐tubulin (Abcam) as primary antibodies. Alkaline‐phosphatase conjugated goat anti–mouse IgG antibody (Promega) was used as the secondary antibody. 5‐Bromo‐4‐chloro‐3‐indolyl‐phosphate 4‐toluidine salt (BCIP) and nitroblue tetrazolium (NBT) (Nacalai Tesque) was used to detect the indicated proteins.

Wound healing assay and transwell migration assay

In the wound healing assay, MDA‐MB‐231 and MDA‐MB‐436 cells were seeded at a concentration of 5 × 105 cells/mL into 24‐well plates (Corning). A wound was stimulated perpendicularly in each well of cells by scratching the cells with 200‐μL pipette tips. Cells were washed with PBS (−) to remove debris and then incubated under normoxia or hypoxia. After 8, 24 and 48 hours, the recovery of gaps was measured by microscopy. In the transwell migration assay, MDA‐MB‐231 and MDA‐MB‐436 cells were seeded at a concentration of 5 × 105 cells/mL in Chemotaxicell chambers (8.0 μm pore; Kurabo) inserted into 24‐well plates (Corning). Cells were pre–incubated with DMEM containing 10% FBS for 24 hours and transferred into serum‐free medium with chemoattractant for another 24‐hour incubation period. Cells were immobilized with methanol and stained with crystal violet (Nacalai Tesque). The number of migrated cells was counted under the microscope.

siRNA transfection

For the depletion of UCHL1 and HIF‐1α in MDA‐MB‐436 cells, cells were plated in 6‐well or 24‐well tissue culture plates (Corning) at a concentration of 1.2 × 105 cells/mL and cultured in antibiotic‐free DMEM medium containing 10% of FBS. For transfection of 6‐well or 24‐well cultures, 10 or 50 pmol of siRNA (siUCHL1: silencer Select Validated siRNA, Cat# 4390824‐s14616; Thermo Fisher Scientific: 5′‐AAGUUAGUCCUAAAGUGUATT‐3′, 4390824‐s14617: 5′‐GCACAAUCGGACUUAUUCATT‐3′ siHIF‐1α: silencer Select Validated siRNA, Cat# 4390824‐s6539 and Cat# 4390824‐s6541) with Lipofectamine RNAiMAX or Lipofectamine 3000 (Thermo Fisher Scientific) was used, respectively. After 48‐hour transfection, the cells were lysed and subjected to western blotting analysis or immunofluorescent staining. For the negative control, scrambled siRNA (Cat# 12935‐300, sequence information not disclosed; Life Technologies) was used. For 3D culture, cells were first cultured and transfected with siRNA as indicated above, then collected after a 24‐hour incubation and cultured on 3D culture 96‐well plates (Corning).

Immunofluorescent staining

For HIF‐1α and UCHL1 staining in 2D culture, cells treated with each condition were washed with PBS (−) and fixed in 4% paraformaldehyde at room temperature for 15 minutes, followed by permeabilization with 0.1% Triton X‐100 for 10 minutes on ice. The coverslips were blocked with 3% BSA for 12 hours and incubated with anti–HIF‐1α (1:500; BD Biosciences) and anti–UCHL1 (1:500; R&D Systems) antibodies for 1 hour at 4°C. After three 5‐minute washes with PBS (–), samples were probed with goat anti–rabbit polyclonal secondary antibody (Alexa Fluor 488, 1:1000; Abcam) or goat anti–mouse polyclonal secondary antibody (Alexa Fluor 568, 1:1000; Abcam) mixed with 4′,6‐diamino‐2‐phenylindole (DAPI) (1:5000, Roche) at room temperature for 1 hour. The coverslips were mounted onto slides with Dako Fluorescence Mounting Medium (Agilent). Fluorescence was detected by fluorescence microscopy (Olympus).

Quantitative RT‐PCR analysis

For 2D culture, total RNA was extracted from cells untreated or treated with 3.7 μmol/L LDN57444 for 24 hours using the Total RNA Extraction Miniprep System (Viogene). Reverse transcription was performed using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO). Quantitative real‐time PCR (qRT‐PCR) reactions were performed in duplicate in a 20‐μL volume containing 0.25 μmol/L of each primer, 2 μL of cDNA template and 1 × SYBR Green (Applied Biosystems). qRT‐PCR was performed using the StepOnePlus Real‐Time PCR System (Thermo Fisher Scientific) according to the manufacturer’s instructions. The primers used for PCR were as follows: human GLUT1: 5′‐TGACAAGACACCCGAGGAGC‐3′ (forward), 5′‐GTCCAGCCCTACAGATTAGC‐3′ (reverse); human CA9: 5′‐AACGTCCCACCCTGCTGCTTTT‐3′ (forward), 5′‐TGTACAGCTTCAGTTTCCCCCGGA‐3′ (reverse); and human HIF1α: 5′‐TACTAGCTTTGCAGAATGCTC‐3′ (forward), 5′‐GCCTTGTATAGGAGCATTAAC‐3′ (reverse). The relative expression levels of HIF1α, GLUT1 and CA9 mRNA were normalized to 18S RNA.

3D culture and cell viability analysis

In the 3D culture, cells were cultured at a concentration of 1 × 105 cells/mL on ultra‐low attachment (ULA) spheroid microplates (Corning) for specific time periods. The viability of cultured cells was measured using the CellTiter‐Glo Luminescent Cell Viability Assay (Promega).

Morphological analysis of 3D tumor cultures

To evaluate characteristics including equivalent diameter, spheroid area, volume, solidity and sphericity, images of spheroid cells were taken using an Olympus CKX53 inverted microscope. Photos were then processed with open source image processing suites written in MATLAB (Te MathWorks), AnaSP and ReViSP to acquire 3D brightfield images and morphological 2D and 3D malignancy‐related factors.

Spheroid invasion assay

Five days after plating in ULA spheroid microplates, the culture medium was changed to DMEM, containing FBS (final concentration = 10%), penicillin‐streptomycin (final concentration = 1%), collagen I (final concentration = 0.5 mg/mL) and basement membrane extract (BME; final concentration = 5 mg/mL). Photo of cells was taken after another 2‐day incubation. The surface area of the invaded cells was measured using ImageJ.30

Spheroid viability staining and spheroid immunofluorescent staining

Five days after plating in ULA spheroid microplates, cells were stained with a mixture of 1 mmol/L of Calcein‐AM, 1 mmol/L of EthD‐1 and 20 μmol/L of Hoechst 33342 for 4 hours and then imaged. Images were acquired with a confocal fluorescence microscope (Nikon) at room temperature. For 3D staining, spheroids were washed with PBS (−) and fixed in 4% paraformaldehyde at room temperature for 20 minutes and then permeabilized with 0.3% Triton X‐100/PBS (−) and protease inhibitors for 20 minutes on ice. Samples were blocked with 3% of BSA/1% Triton X‐100/PBS (−) at room temperature for 1 hour and incubated at 4°C with primary antibodies against HIF‐1α (1:400; BD Biosciences) and anti–UCHL1 (1:400; R&D Systems) overnight. After three washes with 0.1% Triton X‐100/PBS (−), samples were probed with goat anti–rabbit polyclonal secondary antibody (Alexa Fluor 488, 1:500; Abcam) or goat anti–mouse polyclonal secondary antibody (Alexa Fluor 568, 1:500; Abcam) mixed with DAPI (Roche) at room temperature for 1 hour. Images were acquired with a confocal fluorescence microscope (Nikon) at room temperature. Fluorescent intensity was quantified using cellSens software (Olympus).

RESULTS

Ubiquitin carboxyl‐terminal hydrolase L1 is involved in the regulation of hypoxia‐inducible factor 1α protein expression

Because UCHL1 has been reported to stabilize HIF‐1α with its deubiquitinating activity, we first tested whether knockdown of UCHL1 gene could lead to a decrease in the protein levels of HIF‐1α. As expected, less HIF‐1α accumulation was confirmed in human breast adenocarcinoma‐derived MDA‐MB‐436 cells, which have endogenous UCHL1 expression, when treated with siUCHL1 compared with the mock group under hypoxia (Figure 1A). Under normoxia, due to the oxygen‐dependent degradation, the HIF‐1α immunoblotting signal was too weak to detect (data not shown). We further tested whether a UCHL1 inhibitor could have the same effect. We found that the well‐known UCHL1 inhibitor, LDN57444 with an IC50 of 3.7 μmol/L, lowered HIF‐1α protein stability to the same extent as that of siUCHL1 (Figure 1B). We also examined whether the UCHL1 inhibitor could have the same inhibitory effect on HIF‐1α accumulation in the case of ectopic UCHL1 expression. In MDA‐MB‐231 cells, a human breast cancer cell line with no endogenous UCHL1 protein expression, protein expression of HIF‐1α was elevated by the overexpression of UCHL1, while LDN57444 treatment canceled this effect (Figure 1C). Because the translocation of HIF‐1α into the nucleus is necessary for its transactivation activity, we examined where silencing of UCHL1 would affect HIF‐1α protein expression. Depletion of UCHL1 lowered HIF‐1α protein expression not only in the nucleus but also in cytosol under both normoxia and hypoxia, indicating that the stabilization of HIF‐1α by UCHL1 is before its translocation into the nucleus (Figure 1D,E and S1). Taken together, UCHL1 was demonstrated to upregulate HIF‐1α protein expression, and its knockdown or pharmacological inhibition could counteract this effect.
Figure 1

Ubiquitin carboxyl‐terminal hydrolase L1 (UCHL1) is involved in the regulation of hypoxia‐inducible factor 1α (HIF‐1α) protein expression. A, Scrambled siRNA (Scr) or UCHL1‐siRNA (siUCHL1) transfected MDA‐MB‐436 cells were incubated under hypoxic conditions (1% O2) for 24 h before western blotting analysis using the indicated antibodies. B, MDA‐MB‐436 cells were treated with 3.7 or 7.5 μmol/L of LDN57444 under normoxia (21% O2) for 24 h and then incubated under hypoxia (1% O2) for another 24 h. Cells were then lysed and subjected to western blotting analysis. C, MDA‐MB‐231 cells were transiently transfected with either pcDNA4/UCHL1 (UCHL1) or pcDNA4/myc‐His A (empty vector (EV)) and treated with DMSO or LDN57444 (3.7 μmol/L) under normoxia (21% O2) for 24 h. Cells were then transferred to hypoxia (1% O2) for another 24 h incubation before western blotting analysis. D, E, Scr‐ or siUCHL1‐transfected MDA‐MB‐436 cells were incubated under hypoxic conditions (1% O2) for 24 h. Cells were then fixed and subjected to immunostaining

Ubiquitin carboxyl‐terminal hydrolase L1 (UCHL1) is involved in the regulation of hypoxia‐inducible factor 1α (HIF‐1α) protein expression. A, Scrambled siRNA (Scr) or UCHL1‐siRNA (siUCHL1) transfected MDA‐MB‐436 cells were incubated under hypoxic conditions (1% O2) for 24 h before western blotting analysis using the indicated antibodies. B, MDA‐MB‐436 cells were treated with 3.7 or 7.5 μmol/L of LDN57444 under normoxia (21% O2) for 24 h and then incubated under hypoxia (1% O2) for another 24 h. Cells were then lysed and subjected to western blotting analysis. C, MDA‐MB‐231 cells were transiently transfected with either pcDNA4/UCHL1 (UCHL1) or pcDNA4/myc‐His A (empty vector (EV)) and treated with DMSO or LDN57444 (3.7 μmol/L) under normoxia (21% O2) for 24 h. Cells were then transferred to hypoxia (1% O2) for another 24 h incubation before western blotting analysis. D, E, Scr‐ or siUCHL1‐transfected MDA‐MB‐436 cells were incubated under hypoxic conditions (1% O2) for 24 h. Cells were then fixed and subjected to immunostaining

Ubiquitin carboxyl‐terminal hydrolase L1 inhibition or deficiency lowers hypoxia‐inducible factor 1 activity and blocks the metastatic potential of tumor cells

As HIF‐1α is a critical factor in transactivation modulation, we conducted 5HRE‐luciferase (5HRE‐Luc) gene reporter assays in which HeLa cells were stably transfected with the firefly luciferase gene driven by 5HRE to measure HIF activity. The UCHL1‐expressing group showed a significant increase in 5HRE‐Luc activity under both normoxia and hypoxia (Figure 2A). To investigate whether the UCHL1 inhibitor could affect HIF‐1 activity, we further stably transfected HeLa/5HRE‐Luc cells with UCHL1 expressing vector and treated these cells with various concentrations of LDN57444. This resulted in a significant decrease in the reporter activity in a dose‐dependent manner (IC50: 3.7 μmol/L; Figure 2B). Using the same cells, we also found that treatment of LDN57444 decreased the accumulation of 5HRE‐luciferase protein expression compared with the DMSO‐treated group under hypoxia. Camptothecin, a type I topoisomerase inhibitor that blocks global transcription activation was used as a positive control (Figure 2C). We then performed ODD‐luciferase (ODD‐Luc) assays to further determine the effect of UCHL1 on HIF‐1α stability. HeLa cells were stably transfected with a gene encoding luciferase N‐terminally fused with the ODD domain of HIF‐1α, which was driven by the SV40 promoter. Under normoxia, the ODD domain is hydroxylated and subsequently ubiquitinated by pVHL to be rapidly degraded with a fused luciferase protein. However, under hypoxia, because of the insufficient oxygen for hydroxylation, the ODD‐luciferase protein escapes from ubiquitination to release luminescence. Thus, this ODD‐luciferase assay exactly mimics the process by which HIF‐1α is accumulated or degraded but in a highly quantitative manner. We found that under both normoxia and hypoxia, the overexpression of UCHL1 led to a significant increase in the ODD‐Luc activity while LDN57444 eliminated this effect (Figure 2D and S2). When confirming by immunostaining analysis, the protein expression of HIF‐1α was significantly elevated in UCHL1‐transfected cells, while treatment with LDN57444 abrogated this increase in both nucleus and cytosol (Figure 2E,F and S1). To identify whether inhibition of UCHL1 could deactivate the downstream activity of the UCHL1‐HIF‐1α axis, we analyzed the effect of LDN57444 on the expression of two typical cancer‐related HIF‐1α target genes, GLUT1 and CA9, in both MDA‐MB‐231 and MDA‐MB‐436 cells. In UCHL1‐non‐expressing MDA‐MB‐231 cells, blockade of UCHL1 by LDN57444 had no significant influence on the expression of both genes. In UCHL1‐expressing MDA‐MB‐436 cells, however, LDN57444 lowered the expression of both genes remarkably under normoxia, while this effect was further amplified under hypoxia, revealing the specificity of the UCHL1 inhibitor (Figure 2G,H). In conclusion, UCHL1 increased the stability of HIF‐1α protein to promote HIF‐1 activity while UCHL1 inhibition could eliminate this effect.
Figure 2

Ubiquitin carboxyl‐terminal hydrolase L1 (UCHL1) inhibition or deficiency lowers hypoxia‐inducible factor (HIF‐1) activity and blocks the metastatic potential of tumor cells. A, HeLa/5HRE‐luciferase cells were transiently transfected with either empty vector (EV) or UCHL1. Cells were then transferred to normoxic (21% O2) or hypoxic (1% O2) conditions for 5HRE‐luciferase assays. B, 5HRE‐luciferase‐UCHL1 cells were treated with various concentrations of LDN57444 for 1 h and transferred to hypoxic conditions for another 24 h incubation before measuring luciferase activity. C, 5HRE‐luciferase‐UCHL1 cells were treated with DMSO, camptothecin (CPT; 0.25 μmol/L) or LDN57444 (3.7 μmol/L) for 1 h and incubated under hypoxic conditions for 24 h to be subjected to western blotting analysis. D, HeLa/ODD‐Luc cells were treated with LDN57444 (3.7 μmol/L) or DMSO for 1 h under normoxia and transferred to hypoxia for another 24‐h incubation before obtaining luminescence measurements. Relative firefly luciferase activity was normalized using Renilla luciferase activity. E, F, MDA‐MB‐231 cells were transfected with the indicated plasmids and treated with LDN57444 (3.7 μmol/L) for 1 h under normoxia before being transferred to hypoxic conditions for a 4‐h incubation. Immunostaining was then performed with the indicated antibodies. G, H, MDA‐MB‐231 or MDA‐MB‐436 cells were treated with LDN57444 (3.7 μmol/L) and maintained under normoxic or hypoxic conditions for another 24 h. RNA was then collected and subjected to RT‐qPCR to quantify the mRNA levels of the indicated genes. I, J, Wound healing assays were conducted with MDA‐MB‐231 and MDA‐MB‐436 cells. Cells were treated with DMSO or LDN57444 (2.5 μmol/L) for 24 h and then scratched with a P200 tip. Recovery rate of scratched gaps were measured over time (middle) and after 48 h (right). K, L, Transwell migration assays were conducted with MDA‐MB‐231 and MDA‐MB‐436 cells. Cells were pre–incubated with serum‐free medium for 24 h and transferred into 10% FBS/DMEM medium with DMSO or LDN57444 (2.5 μmol/L) for 24 h before measuring the number of migrated cells. M, MDA‐MB‐231 and MDA‐MB‐436 cells were treated with LDN57444 (2.5 μmol/L) and cell number was measured after 8, 24 and 48 h. Data is shown as mean ± SD; n = 3. Error bar indicates SD of the mean of three independent tests. *P < 0.05, **P < 0.01 was verified with Tukey’s honestly significant difference test or Student’s t‐test

Ubiquitin carboxyl‐terminal hydrolase L1 (UCHL1) inhibition or deficiency lowers hypoxia‐inducible factor (HIF‐1) activity and blocks the metastatic potential of tumor cells. A, HeLa/5HRE‐luciferase cells were transiently transfected with either empty vector (EV) or UCHL1. Cells were then transferred to normoxic (21% O2) or hypoxic (1% O2) conditions for 5HRE‐luciferase assays. B, 5HRE‐luciferase‐UCHL1 cells were treated with various concentrations of LDN57444 for 1 h and transferred to hypoxic conditions for another 24 h incubation before measuring luciferase activity. C, 5HRE‐luciferase‐UCHL1 cells were treated with DMSO, camptothecin (CPT; 0.25 μmol/L) or LDN57444 (3.7 μmol/L) for 1 h and incubated under hypoxic conditions for 24 h to be subjected to western blotting analysis. D, HeLa/ODD‐Luc cells were treated with LDN57444 (3.7 μmol/L) or DMSO for 1 h under normoxia and transferred to hypoxia for another 24‐h incubation before obtaining luminescence measurements. Relative firefly luciferase activity was normalized using Renilla luciferase activity. E, F, MDA‐MB‐231 cells were transfected with the indicated plasmids and treated with LDN57444 (3.7 μmol/L) for 1 h under normoxia before being transferred to hypoxic conditions for a 4‐h incubation. Immunostaining was then performed with the indicated antibodies. G, H, MDA‐MB‐231 or MDA‐MB‐436 cells were treated with LDN57444 (3.7 μmol/L) and maintained under normoxic or hypoxic conditions for another 24 h. RNA was then collected and subjected to RT‐qPCR to quantify the mRNA levels of the indicated genes. I, J, Wound healing assays were conducted with MDA‐MB‐231 and MDA‐MB‐436 cells. Cells were treated with DMSO or LDN57444 (2.5 μmol/L) for 24 h and then scratched with a P200 tip. Recovery rate of scratched gaps were measured over time (middle) and after 48 h (right). K, L, Transwell migration assays were conducted with MDA‐MB‐231 and MDA‐MB‐436 cells. Cells were pre–incubated with serum‐free medium for 24 h and transferred into 10% FBS/DMEM medium with DMSO or LDN57444 (2.5 μmol/L) for 24 h before measuring the number of migrated cells. M, MDA‐MB‐231 and MDA‐MB‐436 cells were treated with LDN57444 (2.5 μmol/L) and cell number was measured after 8, 24 and 48 h. Data is shown as mean ± SD; n = 3. Error bar indicates SD of the mean of three independent tests. *P < 0.05, **P < 0.01 was verified with Tukey’s honestly significant difference test or Student’s t‐test In murine models of pulmonary metastasis, UCHL1 has previously been shown to have an important role in the promotion of tumor cell metastasis.27 To evaluate whether UCHL1 inhibitor has an anti–metastasis effect, we performed wound healing and transwell migration assays in cultured cells. Treatment with LDN57444 significantly suppressed the recovery of the scratched gap in MDA‐MD‐436 cells (76% inhibition), but not in MDA‐MB‐231 cells (Figure 2I,J). In the transwell migration assay, a similar result was obtained. LDN57444 treatment led to a striking decrease in the number of migrated MDA‐MB 436 cells. Meanwhile, in MDA‐MB‐231 cells, no such effect was confirmed (Figure 2K,L). Finally, we examined whether this difference was possibly induced by a potential inhibitory effect of LDN57444 on the proliferation of MDA‐MB‐436 cells. We treated both MDA‐MB‐231 and MDA‐MB‐436 cells with 2.5 μmol/L of LDN57444 and found no difference in cell number between both cell lines after 8, 24 and 48 hours (Figure 2M). Overall, UCHL1 inhibition showed efficacy against UCHL1‐mediated cell migration in endogenous UCHL1‐expressing cells.

Ubiquitin carboxyl‐terminal hydrolase L1 deficiency or inhibition leads to ubiquitin carboxyl‐terminal hydrolase L1‐dependent cell death in 3D culture

It has been demonstrated in many studies that anchorage‐independent cultured cells can form spheroids.28 Spheroids usually contain three areas: the proliferative area in the outer layer, the quiescent area in the intermediate layer and the necrotic core area in the central layer. Compared with traditional 2D monolayer cultures, spheroids share more similarities with solid tumor tissues in features such as lower pH, cell‐cell interactions, interstitial pressure, and drug accessibility, as well as variations in O2 and nutrient accessibility.28, 31 Among these, the specific property that makes them good models in the study of HIF‐related malignancies is that they exhibit areas of varied oxygen conditions. Therefore, we performed 3D spheroid cell culture to learn more about the link between UCHL1 and HIF1‐dependent tumor malignancy. We first compared typical malignancy‐related factors, such as equivalent diameter, spheroid area, volume, solidity, sphericity and viable cell number when cells were incubated in an anchorage‐independent condition.32 In UCHL1‐transfected MDA‐MB‐231 cells, all factors were evidently elevated (Figure 3A,B). However, these factors were drastically reduced in siUCHL1‐transfected MDA‐MB‐436 cells. In the case of UCHL1 inhibitor treatment in MDA‐MB‐436 cells, LDN57444 abated the diameter, area, volume and viable cell number but had no significant effect on solidity and sphericity (Figure 3B).
Figure 3

Ubiquitin carboxyl‐terminal hydrolase L1 (UCHL1) deficiency or inhibition leads to UCHL1‐dependent cell death in 3D culture. A, MDA‐MB‐231 cells were transiently transfected with either empty vector (EV) or UCHL1. MDA‐MB‐436 cells were transfected with either scrambled siRNA (Scr), or UCHL1‐siRNA (siUCHL1), or treated with LDN57444 (15 μmol/L). Cells were seeded on ultra‐low attachment (ULA) spheroid microplates and incubated for 6 d before imaging. B, Corresponding 3D reconstructions of cells were obtained using ReViSP. Malignancy‐related factors including equivalent diameter, spheroid area, volume, solidity and sphericity were further analyzed with AnaSP. Spheroid cell number was measured with a CellTiter‐Glo 3D cell viability assay. C, UCHL1‐ or mock‐transfected MDA‐MB‐231 cells, and siUCHL1‐transfected or Scr‐transfected or LDN57444 (15 μmol/L)‐treated MDA‐MB‐436 cells were seeded on ULA spheroid microplates. On the last day of incubation, cells were stained with Hoechst 33342 (blue), Calcein‐AM (green) and EthD1 (red) for imaging by confocal fluorescence microscopy. D, UCHL1‐transfected or mock‐transfected MDA‐MB‐231 cells were seeded on ULA spheroid microplates for 6 d. Medium was replaced with a mixture of DMEM, FBS, Collagen I, basement membrane extract (BME), and DMSO or LDN57444 (15 μmol/L) for another 2‐d incubation period. The surface area of the invaded cells was measured using ImageJ. Data is shown as mean ± SD; n = 3. Error bar indicates SD of the mean of three independent tests. *P < 0.05, **P < 0.01 was verified with Tukey’s honestly significant difference test or Student’s t‐test

Ubiquitin carboxyl‐terminal hydrolase L1 (UCHL1) deficiency or inhibition leads to UCHL1‐dependent cell death in 3D culture. A, MDA‐MB‐231 cells were transiently transfected with either empty vector (EV) or UCHL1. MDA‐MB‐436 cells were transfected with either scrambled siRNA (Scr), or UCHL1‐siRNA (siUCHL1), or treated with LDN57444 (15 μmol/L). Cells were seeded on ultra‐low attachment (ULA) spheroid microplates and incubated for 6 d before imaging. B, Corresponding 3D reconstructions of cells were obtained using ReViSP. Malignancy‐related factors including equivalent diameter, spheroid area, volume, solidity and sphericity were further analyzed with AnaSP. Spheroid cell number was measured with a CellTiter‐Glo 3D cell viability assay. C, UCHL1‐ or mock‐transfected MDA‐MB‐231 cells, and siUCHL1‐transfected or Scr‐transfected or LDN57444 (15 μmol/L)‐treated MDA‐MB‐436 cells were seeded on ULA spheroid microplates. On the last day of incubation, cells were stained with Hoechst 33342 (blue), Calcein‐AM (green) and EthD1 (red) for imaging by confocal fluorescence microscopy. D, UCHL1‐transfected or mock‐transfected MDA‐MB‐231 cells were seeded on ULA spheroid microplates for 6 d. Medium was replaced with a mixture of DMEM, FBS, Collagen I, basement membrane extract (BME), and DMSO or LDN57444 (15 μmol/L) for another 2‐d incubation period. The surface area of the invaded cells was measured using ImageJ. Data is shown as mean ± SD; n = 3. Error bar indicates SD of the mean of three independent tests. *P < 0.05, **P < 0.01 was verified with Tukey’s honestly significant difference test or Student’s t‐test The central part of a spheroid, which is named the necrotic area, has been reported to have a relatively lower cell viability. Thus, we first determined whether UCHL1 transfection could rescue these centrally located cells. Living and dead cells were stained with Calcein‐AM and EthD1, respectively. Surprisingly, transfection of UCHL1 in MDA‐MB‐231 cells was confirmed to rescue cells not only in the central but also in the intermediate layer of the quiescent area. Moreover, more living cells were confirmed in the proliferative area of UCHL1‐transfected cells, suggesting a proliferation‐promoting effect of UCHL1 under 3D culture conditions (Figure 3C and S3). When MDA‐MB‐436 cells were treated with LDN57444 or transfected with siRNA against UCHL1, global cell death was dramatically increased compared with the control group. Therefore, we consider that the rescue of cell death and the increase in proliferation both contributed to the increase in total viable cell number (Figure 3C). In 3D cultured models, metastasis in breast cancer cell is promoted due to features such as low oxygen, low pH and low glucose environments.33 Therefore, we applied a 3D cell invasion assay to confirm whether UCHL1 could have a metastasis‐promoting effect in spheroid models. Transfection of UCHL1 substantially promoted cell invasion under 3D culture conditions, while treatment with LDN57444 eliminated this increase (Figure 3D). In conclusion, UCHL1 increases malignant potential in spheroid cultured tumor cells, while its deficiency or inhibition can abrogate this effect.

Ubiquitin carboxyl‐terminal hydrolase L1 inhibition decreases viable cell number and invasiveness under 3D culture in a hypoxia‐inducible factor 1a‐dependent manner

To examine whether the phenotypes observed in Figure 3 were induced in an HIF‐1α‐dependent manner, we performed a co‐transfection of UCHL1 and siHIF‐1α in MDA‐MB‐231 cells (Figure 4A). We first examined whether the overexpression of UCHL1 in HIF‐1α deficient cells could still affect spheroid phenotypes due to its deubiquitinating activity against other potential substrates except for HIF‐1α. We found that neither the transfection of UCHL1 nor the treatment of LDN57444 showed any effect on the invasiveness in the siHIF‐1α transfected groups (Figure 4B). We further examined other malignancy‐related factors and found that the siHIF‐1α‐transfected spheroids were hollowed in the central part of the sphere, despite UCHL1‐transfection, LDN57444‐treatment or their combination (Figure 4C). Because HIF‐1α is mostly accumulated in the necrotic and quiescent layers of spheroids and is indispensable for their viability,29 depletion of HIF‐1α almost completely disassembled the spheroid. When quantified (Figure S4), siHIF‐1α groups in general showed a drastically lower solidity, sphericity, volume and cell number compared with the scrambled‐transfected group. When HIF‐1α deficient cells were transfected with UCHL1 or further treated with LDN57444, no variation was found in these malignancy‐related factors.
Figure 4

Ubiquitin carboxyl‐terminal hydrolase L1 (UCHL1) inhibition decreases viable cell number and invasiveness under 3D culture in a hypoxia‐inducible factor 1α (HIF‐1α)‐dependent manner. A, MDA‐MB‐231 cells co‐transfected with empty vector (EV)/UCHL1 and Scr/HIF‐1α siRNA (siHIF‐1α) for 48 h and were collected to be applied to western blotting analysis. B, MDA‐MB‐231 cells co‐transfected with EV/UCHL1 and Scr/siHIF‐1α were cultured in ULA spheroid microplates for 3 d to form spheroids. Medium was then replaced with a mixture of DMEM, FBS, collagen I, basement membrane extract (BME) and DMSO or LDN57444 (15 μmol/L) for another 2‐d incubation period. Quantification data for malignancy‐related factors are shown in Figure S4. C, D, MDA‐MB‐231 cells co‐transfected with EV/UCHL1 and scrambled/siHIF‐1α for 24 h and were collected to be cultured in ULA spheroid microplates for another 5 d before their images were taken (C) or spheroid viability staining was performed (D). Data is shown as mean ± SD; n = 3. Error bar indicates SD of the mean of three independent tests. *P < 0.05, **P < 0.01 was verified with Tukey’s honestly significant difference test or Student’s t‐test

Ubiquitin carboxyl‐terminal hydrolase L1 (UCHL1) inhibition decreases viable cell number and invasiveness under 3D culture in a hypoxia‐inducible factor 1α (HIF‐1α)‐dependent manner. A, MDA‐MB‐231 cells co‐transfected with empty vector (EV)/UCHL1 and Scr/HIF‐1α siRNA (siHIF‐1α) for 48 h and were collected to be applied to western blotting analysis. B, MDA‐MB‐231 cells co‐transfected with EV/UCHL1 and Scr/siHIF‐1α were cultured in ULA spheroid microplates for 3 d to form spheroids. Medium was then replaced with a mixture of DMEM, FBS, collagen I, basement membrane extract (BME) and DMSO or LDN57444 (15 μmol/L) for another 2‐d incubation period. Quantification data for malignancy‐related factors are shown in Figure S4. C, D, MDA‐MB‐231 cells co‐transfected with EV/UCHL1 and scrambled/siHIF‐1α for 24 h and were collected to be cultured in ULA spheroid microplates for another 5 d before their images were taken (C) or spheroid viability staining was performed (D). Data is shown as mean ± SD; n = 3. Error bar indicates SD of the mean of three independent tests. *P < 0.05, **P < 0.01 was verified with Tukey’s honestly significant difference test or Student’s t‐test Finally, spheroid cells showed no difference in the number of live or dead between the empty vector (EV)‐transfected and UCHL1‐transfected groups (Figure 4D) in siHIF‐1α‐transfected groups. These results demonstrate the dependency on HIF‐1α for UCHL1 to raise tumor cell malignancy, while the blockade of the UCHL1‐HIF‐1α axis abrogated this effect.

Ubiquitin carboxyl‐terminal hydrolase L1 inhibition reduces hypoxia‐inducible factor 1α protein expression under 3D culture

To confirm whether the observed malignancy‐promoting effect could be ascribed to the activation of the UCHL1‐HIF‐1α axis, we investigated HIF‐1α protein levels in scrambled‐transfected or siUCHL1‐transfected cells under 3D culture. We found that the absence of UCHL1 clearly decreased HIF‐1α accumulation (Figure 5A). In MDA‐MB‐231 cells, as confirmed in 2D culture, overexpression of UCHL1 increased the protein expression of HIF‐1α, while LDN57444 treatment eliminated this effect (Figure 5B). Immunostaining of 3D cultures verified that silencing of the UCHL1 gene had a similar effect compared with that of LDN57444, which significantly suppressed the protein expression of HIF‐1α (Figure 5C,D). In addition, MDA‐MB‐231 cells with UCHL1 overexpression showed higher HIF‐1α expression in all central, quiescent and proliferative areas. LDN57444 treatment once again remarkably decreased this effect (Figure 5E,F). The expression of two typical HIF‐1α downstream genes, GLUT1 and CA9, was also elevated by UCHL1 overexpression in MDA‐MB‐231 cells, while this effect was abrogated by LDN57444 (Figure 5G). Finally, UCHL1 failed to increase the expression of both genes in siHIF‐1α‐transfected groups (Figure 5H). Considering that GLUT1 and CA9 are both essential in tumor malignancy, we suppose this HIF‐1α‐dependent upregulation on both genes by UCHL1 is a critical cause of the phenotypes observed in Figure 4. In conclusion, UCHL1 was confirmed to increase cell viability and proliferation as well as metastasis potential by stabilizing HIF‐1α to increase HIF‐1 activity in the spheroid 3D culture system.
Figure 5

Ubiquitin carboxyl‐terminal hydrolase L1 (UCHL1) inhibition reduces hypoxia‐inducible factor 1α (HIF‐1α) protein expression under 3D culture. A, UCHL1‐depleted or mock‐transfected MDA‐MB‐436 cells were seeded on ULA spheroid microplates for 5 d before western blotting analysis. B, UCHL1‐transfected or mock‐transfected MDA‐MB‐231 cells were seeded on ULA spheroid microplates for 5 d, treated with DMSO or LDN57444 (15 μmol/L) for 48 h and subjected to western blotting analysis. C, Scr or siUCHL1‐transfected or LDN57444 (15 μmol/L)‐treated MDA‐MB‐436 cells were seeded on ULA spheroid microplates for 5 d for 3D immunostaining. D, Quantification of results of C. E, UCHL1‐transfected or mock‐transfected MDA‐MB‐231 cells were seeded on ULA spheroid microplates for 5 d, treated with DMSO or LDN57444 (15 μmol/L) for 48 h, and subjected to 3D immunostaining with the indicated antibodies. F, Quantification of results of E. G, H, UCHL1‐transfected or mock‐transfected (G) or empty vector (EV)/UCHL1 and Scr/siHIF‐1α‐co‐transfected (H) MDA‐MB‐231 cells were seeded on ULA spheroid microplates for 5 d, treated with DMSO or LDN57444 (15 μmol/L) for 48 h, and subjected to RT‐qPCR to quantify the mRNA levels of the indicated genes. Data is shown as mean ± SD; n = 3. Error bar indicates SD of the mean of three independent tests. *P < 0.05, **P < 0.01 was verified with Tukey’s honestly significant difference test or Student’s t‐test

Ubiquitin carboxyl‐terminal hydrolase L1 (UCHL1) inhibition reduces hypoxia‐inducible factor 1α (HIF‐1α) protein expression under 3D culture. A, UCHL1‐depleted or mock‐transfected MDA‐MB‐436 cells were seeded on ULA spheroid microplates for 5 d before western blotting analysis. B, UCHL1‐transfected or mock‐transfected MDA‐MB‐231 cells were seeded on ULA spheroid microplates for 5 d, treated with DMSO or LDN57444 (15 μmol/L) for 48 h and subjected to western blotting analysis. C, Scr or siUCHL1‐transfected or LDN57444 (15 μmol/L)‐treated MDA‐MB‐436 cells were seeded on ULA spheroid microplates for 5 d for 3D immunostaining. D, Quantification of results of C. E, UCHL1‐transfected or mock‐transfected MDA‐MB‐231 cells were seeded on ULA spheroid microplates for 5 d, treated with DMSO or LDN57444 (15 μmol/L) for 48 h, and subjected to 3D immunostaining with the indicated antibodies. F, Quantification of results of E. G, H, UCHL1‐transfected or mock‐transfected (G) or empty vector (EV)/UCHL1 and Scr/siHIF‐1α‐co‐transfected (H) MDA‐MB‐231 cells were seeded on ULA spheroid microplates for 5 d, treated with DMSO or LDN57444 (15 μmol/L) for 48 h, and subjected to RT‐qPCR to quantify the mRNA levels of the indicated genes. Data is shown as mean ± SD; n = 3. Error bar indicates SD of the mean of three independent tests. *P < 0.05, **P < 0.01 was verified with Tukey’s honestly significant difference test or Student’s t‐test

DISCUSSION

In the present study, we investigated the impact of pharmacological inhibition of the deubiquitinating activity of UCHL1 on HIF‐1‐dependent tumor malignancy in a 3D cell culture system. We clearly showed that LDN57444 (Figure S5), a well‐known UCHL1 inhibitor, attenuated HIF‐1α protein accumulation and lowered mRNA expression levels, causing cell death and reduced cell invasiveness in MDA‐MB‐436 as well as UCHL1‐transfected MDA‐MB‐231 spheroids in an HIF‐1α‐dependent manner. These results indicated that therapeutic strategies targeting UCHL1 are plausible for HIF‐1α‐dependent tumors. As shown in Figure 2, LDN57444 more effectively suppressed hypoxia‐induced expression of GLUT1 and CA9 in MDA‐MB‐436 cells cultured under hypoxic conditions than normoxia cultured cells. It has been reported that in Hep3B cells cultured in hypoxic conditions, HIF‐1α is ubiquitinylated and the blockade of Ub‐activating enzyme (E1 enzyme) by a specific inhibitor, UBE1‐41, resulted in an accumulation of HIF‐1α protein. These findings indicate that HIF‐1α is also degraded via the Ub‐proteasome pathway under hypoxia.34 While the pVHL E3 ligase‐dependent degradation pathway is recognized as a dominant regulator of HIF‐1α under normoxia, hypoxia‐associated factor,35 receptor of activated protein kinase C 1 (RACK1)36 and parkin37 were identified as E3 ligases catalyzing the oxygen‐independent ubiquitination of HIF‐1α. UCHL1 contributes to the escape of a variety of proteins from their turnover in a hydrolase activity‐dependent manner, including HIF‐1α, by forming a UCHL1‐HIF‐1α complex, which is more abundantly detected in the nuclei of hypoxia‐exposed HeLa cells.27 Given that UCHL1 disassembles Lys48‐linked poly‐Ub chains conjugated to β‐catenin5, epidermal growth factor receptor38 and NOXA,39 it is possible that UCHL1 stabilizes HIF‐1α protein levels in hypoxic conditions through the removal of poly‐Ub chains attached via an oxygen‐independent mechanism or interference with Ub modification of HIF‐1α by E3 ligases such as parkin. Furthermore, in Figure 5G, gene expression of GLUT1 and CA9 were both downregulated in spheroids to a much greater degree. Because spheroids have a mixture of oxygen conditions, it is plausible that LDN57444 showed a much severer impact on HIF‐1‐dependent tumor malignancy in our 3D spheroid model. Therefore, blockade of the UCHL1‐HIF‐1α axis through UCHL1 inhibition can be a promising therapeutic strategy for the treatment of HIF‐1‐dependent tumors. Ubiquitin carboxyl‐terminal hydrolase L1 has been shown to promote tumor metastasis and cell proliferation via multiple signal transduction pathways. One is the stimulation of AKT through the inhibition of PH domain and leucine rich repeat protein phosphatase (PHLPP1), a negative regulator of AKT.40 Moreover, following the stabilization of both β‐catenin (oxygen‐independent) and HIF‐1 (oxygen‐independent), subsequent activation of c‐Jun N‐terminal kinase (JNK) and p38 mitogen‐activated protein (MAP) kinases41 promotes the expression of several genes controlling the metastasis, invasion and proliferation of cancer cells, such as matrix metalloproteinases (MMP), cyclin D1 and c‐Myc.42 Because overexpression of UCHL1 failed to increase the malignancy‐related factors in HIF‐1α deficient spheroid cells, we consider that UCHL1‐HIF‐1α axis is the dominant pathway rather than the other two in UCHL1‐mediated tumors. In fact, as both AKT43 and Wnt/β‐catenin44 signaling have been reported to have crosstalk with HIF‐1α, the central role of HIF‐1α in UCHL1‐mediated tumor malignancy is further confirmed. Although the vital catalytic role of UCHL1 in the metastasis and aggravation of malignant tumors was confirmed in our research, the development of efficient UCHL1 inhibitors is still required, as only LDN57444 has been reported thus far.45 However, LDN57444 is not suitable for clinical application due to its side‐effects, which include induction of endoplasmic reticulum stress and abnormal expression of synapse proteins.1, 46, 47 Therefore, the development of more effective and selective UCHL1 inhibitors remains a major challenge for the treatment of malignant tumors. The experiments we applied herein can be considered as an approach for the screening of potent UCHL1 inhibitors. In particular, the 3D spheroid system using UCHL1‐expressing tumor cells provides valuable information for the validation of UCHL1 inhibitor screening. We are now applying our in‐house chemical library, which includes synthetic molecules as well as natural products, to identify novel UCHL1 inhibitors.

CONFLICTS OF INTEREST

The authors have no conflicts of interest. Click here for additional data file.
  48 in total

1.  Hypoxia-inducible factor 1alpha (HIF-1alpha) protein is rapidly degraded by the ubiquitin-proteasome system under normoxic conditions. Its stabilization by hypoxia depends on redox-induced changes.

Authors:  S Salceda; J Caro
Journal:  J Biol Chem       Date:  1997-09-05       Impact factor: 5.157

2.  The co-crystal structure of ubiquitin carboxy-terminal hydrolase L1 (UCHL1) with a tripeptide fluoromethyl ketone (Z-VAE(OMe)-FMK).

Authors:  Christopher W Davies; Joseph Chaney; Gregory Korbel; Dagmar Ringe; Gregory A Petsko; Hidde Ploegh; Chittaranjan Das
Journal:  Bioorg Med Chem Lett       Date:  2012-05-04       Impact factor: 2.823

Review 3.  UCHL1 (PGP 9.5): neuronal biomarker and ubiquitin system protein.

Authors:  Ian N M Day; Rod J Thompson
Journal:  Prog Neurobiol       Date:  2009-10-30       Impact factor: 11.685

4.  The UCH-L1 gene encodes two opposing enzymatic activities that affect alpha-synuclein degradation and Parkinson's disease susceptibility.

Authors:  Yichin Liu; Lara Fallon; Hilal A Lashuel; Zhihua Liu; Peter T Lansbury
Journal:  Cell       Date:  2002-10-18       Impact factor: 41.582

5.  UCH-L1 involved in regulating the degradation of EGFR and promoting malignant properties in drug-resistant breast cancer.

Authors:  Yiting Jin; Wei Zhang; Jiawen Xu; Hongying Wang; Zijing Zhang; Chengyu Chu; Xiuping Liu; Qiang Zou
Journal:  Int J Clin Exp Pathol       Date:  2015-10-01

6.  Hepatocyte growth factor signalling stimulates hypoxia inducible factor-1 (HIF-1) activity in HepG2 hepatoma cells.

Authors:  L Tacchini; P Dansi; E Matteucci; M A Desiderio
Journal:  Carcinogenesis       Date:  2001-09       Impact factor: 4.944

7.  Design, synthesis, and structure-activity relationships of 1-ethylpyrazole-3-carboxamide compounds as novel hypoxia-inducible factor (HIF)-1 inhibitors.

Authors:  Yorinobu Yasuda; Takeaki Arakawa; Yumi Nawata; Sayaka Shimada; Shinya Oishi; Nobutaka Fujii; Shinichi Nishimura; Akira Hattori; Hideaki Kakeya
Journal:  Bioorg Med Chem       Date:  2015-02-25       Impact factor: 3.641

Review 8.  HAF : the new player in oxygen-independent HIF-1alpha degradation.

Authors:  Mei Yee Koh; Garth Powis
Journal:  Cell Cycle       Date:  2009-05-01       Impact factor: 4.534

9.  Identification of the Ah receptor nuclear translocator protein (Arnt) as a component of the DNA binding form of the Ah receptor.

Authors:  H Reyes; S Reisz-Porszasz; O Hankinson
Journal:  Science       Date:  1992-05-22       Impact factor: 47.728

10.  3D tumor spheroid models for in vitro therapeutic screening: a systematic approach to enhance the biological relevance of data obtained.

Authors:  Michele Zanoni; Filippo Piccinini; Chiara Arienti; Alice Zamagni; Spartaco Santi; Rolando Polico; Alessandro Bevilacqua; Anna Tesei
Journal:  Sci Rep       Date:  2016-01-11       Impact factor: 4.379

View more
  6 in total

1.  Ubiquitin carboxyl-terminal hydrolase L1 promotes hypoxia-inducible factor 1-dependent tumor cell malignancy in spheroid models.

Authors:  Xuebing Li; Akira Hattori; Senye Takahashi; Yoko Goto; Hiroshi Harada; Hideaki Kakeya
Journal:  Cancer Sci       Date:  2019-12-10       Impact factor: 6.716

Review 2.  Ubiquitin Carboxyl-Terminal Hydrolases and Human Malignancies: The Novel Prognostic and Therapeutic Implications for Head and Neck Cancer.

Authors:  Chao Rong; Ran Zhou; Shan Wan; Dan Su; Shou-Li Wang; Jochen Hess
Journal:  Front Oncol       Date:  2021-01-29       Impact factor: 6.244

Review 3.  Role of hypoxia in the tumor microenvironment and targeted therapy.

Authors:  Gaoqi Chen; Kaiwen Wu; Hao Li; Demeng Xia; Tianlin He
Journal:  Front Oncol       Date:  2022-09-23       Impact factor: 5.738

Review 4.  Targeting hypoxia-inducible factor 1 (HIF-1) signaling with natural products toward cancer chemotherapy.

Authors:  Hiroaki Ikeda; Hideaki Kakeya
Journal:  J Antibiot (Tokyo)       Date:  2021-07-30       Impact factor: 2.649

Review 5.  Regulation of Cancer Metabolism by Deubiquitinating Enzymes: The Warburg Effect.

Authors:  So-Hee Kim; Kwang-Hyun Baek
Journal:  Int J Mol Sci       Date:  2021-06-08       Impact factor: 5.923

6.  Loss of Ubiquitin Carboxy-Terminal Hydrolase L1 Impairs Long-Term Differentiation Competence and Metabolic Regulation in Murine Spermatogonial Stem Cells.

Authors:  Whitney F Alpaugh; Anna L Voigt; Rkia Dardari; Lin Su; Iman Al Khatib; Wisoo Shin; Taylor M Goldsmith; Krysta M Coyle; Lin A Tang; Timothy E Shutt; Claudia Klein; Jeff Biernaskie; Ina Dobrinski
Journal:  Cells       Date:  2021-08-31       Impact factor: 6.600

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.