Literature DB >> 31727696

Molecular Characterization of Parvovirus Strain GX-Tu-PV-1, Isolated from a Guangxi Turkey.

Yanfang Zhang1, Zhixun Xie2, Xianwen Deng1, Zhiqin Xie1, Liji Xie1, Minxiu Zhang1, Sisi Luo1, Qing Fan1, Jiaoling Huang1, Tingting Zeng1, Sheng Wang1.   

Abstract

The aim of the current study was to determine the genomic sequence of parvovirus strain GX-Tu-PV-1, which was isolated from a turkey in Guangxi Province, South China. The analysis showed that the genome sequence of GX-Tu-PV-1 was 81.3% to ∼99.3% similar to those of other turkey parvoviruses (TuPVs) and 79.8% to ∼92.1% related to chicken parvovirus (ChPV). This study will help in understanding the epidemiology and molecular characteristics of parvovirus in turkeys.
Copyright © 2019 Zhang et al.

Entities:  

Year:  2019        PMID: 31727696      PMCID: PMC6856262          DOI: 10.1128/MRA.00152-19

Source DB:  PubMed          Journal:  Microbiol Resour Announc        ISSN: 2576-098X


ANNOUNCEMENT

Parvovirus (family Parvoviridae) spp. that infect vertebrate hosts make up the subfamily Parvovirinae, while those that infect arthropods make up the subfamily Densovirinae (1–4). According to the latest classification by the International Committee on Taxonomy of Viruses (https://talk.ictvonline.org/taxonomy/), the Parvovirinae subfamily is divided into eight genera (5–8) (Amdoparvovirus, Aveparvovirus, Bocaparvovirus, Copiparvovirus, Dependoparvovirus, Erythroparvovirus, Protoparvovirus, and Tetraparvovirus). Chicken parvovirus (ChPV) and turkey parvovirus (TuPV) are classified as members of the new genus Aveparvovirus (Galliform aveparvovirus 1). In this study, viral DNA was extracted from tracheal and cloacal swabs from 12 turkeys using the EasyPure viral DNA/RNA kit (Transgen, Beijing, China). TuPV was identified by PCR, using primers designed to target the conserved region (nonstructural [NS] gene, 561 bp) first (1). The two positive samples were confirmed by partial sequencing of the nonstructural 1 (NS1) gene using primers NSF and NSR (Table 1). BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) analysis revealed 98.0% to ∼100% nucleotide (nt) sequence identity to the TuPV 1030 strain (GenBank accession number KM598418). Based on an alignment of the sequences of three TuPV isolates deposited in GenBank, the specific pairs of primers (Table 1) were then designed to amplify the genome of one positive TuPV sample named GX-Tu-PV-1. The gel-electrophoresed PCR products were purified by using the AxyPrep DNA gel extraction kit (Hangzhou, China), followed by cloning into the pMD-19T vector (TaKaRa, Japan). Sanger sequencing was performed on a DNA analyzer (Invitrogen, Guangzhou, China). The undetermined 5′ and 3′ terminal fragments were amplified using the 5′ rapid amplification of cDNA ends (RACE) system kit v.2 (TaKaRa) and reverse transcription-PCR with oligo(dT) primers, respectively. The amplified fragments were cloned into the pMD-19T vector (TaKaRa), and 4 and 8 clones of the 5′ and 3′ terminal regions, respectively, were sequenced. The sequences were obtained by assembling overlapping contigs, followed by editing using the EditSeq and MegAlign programs of DNAStar 7.0 green (DNAStar, Madison, WI).
TABLE 1

Primers used for PCR amplification of the turkey parvovirus genome

Primera Sequence (5′–3′)b Nucleotide positionsc
F1-1CTGCTGAGCTGGTAAGATGG395–414
R1-2TCTTCCCGACTGACTAGATT724–743
R1-3CCCCCATGATACATTTTGCT1751–1770
F2-1TTCTAATAACGATATCACTCAAGTTTC1841–1867
R1-4AACCAGTATAGGTGGGTTCC2192–2211
R1-1TTTGCGCTTGCGGTGAAGTCTGGCTCG2375–2401
F3-1CAAGCCGCCATTGTGTTTGT3575–3594
R2-2GTATTGKGTYTGGTTTTCAG3659–3678
R2-1AAGTCWAKRTAATTCCATGG3694–3713
R3-2GTCCCTGTCAAGTCATTAGAG3858–3878
R3-1TTAATTGGTYYKCGGYRCSCG5005–5025
NSFTTCTAATAACGATATCACTCAAGTTTC1841–1867
NSRTTTGCGCTTGCGGTGAAGTCTGGCTCG2375–2401

Primers F1-1/R1-1, F1-1/R1-2, F1-1/R1-3, and F1-1/R1-4 were used to amplify the first fragment, F2-1/R1-1 and F2-1/R2-2 were used to amplify the second fragment, and F3-1/R3-1 and F3-1/R3-2 were used to amplify the third fragment of the turkey parvovirus (GX-Tu-PV-1) genome. Primers NSF to NSR were used to amplify the partial NS sequence.

The sequences of the primers were designed according to the sequences of three other known ChPV/TuPV strains (GenBank accession numbers GU214704, GU214706, and NC_024454).

The positions of primers located in the genome are shown according to the U.S. TuPV isolate (TuPV 1030).

Primers used for PCR amplification of the turkey parvovirus genome Primers F1-1/R1-1, F1-1/R1-2, F1-1/R1-3, and F1-1/R1-4 were used to amplify the first fragment, F2-1/R1-1 and F2-1/R2-2 were used to amplify the second fragment, and F3-1/R3-1 and F3-1/R3-2 were used to amplify the third fragment of the turkey parvovirus (GX-Tu-PV-1) genome. Primers NSF to NSR were used to amplify the partial NS sequence. The sequences of the primers were designed according to the sequences of three other known ChPV/TuPV strains (GenBank accession numbers GU214704, GU214706, and NC_024454). The positions of primers located in the genome are shown according to the U.S. TuPV isolate (TuPV 1030). The DNA sequence of the obtained isolate was 4,642 bp long, with an A+T content of 57.1% and G+C content of 42.9%. The entire genome of GX-Tu-PV-1 consists of three open reading frames (ORFs). ORF1 and ORF2 encode a nonstructural (NS) protein, which is involved in viral replication, and the major capsid proteins (VP1 and VP2), respectively. ORF3 encodes a putative protein, NP1, of which the function is unclear (9–13). The genetic diversity of GX-Tu-PV-1 was explored using phylogenetic analyses using ClustalW (http://www.clustal.org/clustal2/) and MEGA 7.0 (14). It showed that the genome sequence of GX-Tu-PV-1 was 81.3% to ∼99.3% related to TuPVs (GenBank accession numbers NC_038534, EU304809, KM598418, KM598419, and KX084398) and 79.8% to ∼92.1% related to ChPV strains (GenBank accession numbers KM598417, GU214704, KM598416, KY069111, KU569162, KJ486489, KX133418, and KM254173) (Fig. 1).
FIG 1

Neighbor-joining (NJ) tree of the genomic sequences of GX-Tu-PV-1 and 13 other ChPV/TuPV isolates. GenBank accession numbers follow the names of the ChPV/TuPV strains. The numbers near the branches indicate the confidence level calculated by bootstrapping (n = 1,000). The length of each pair of branches represents the distance between sequence pairs. The scale bar represents 0.01-nt substitutions per site. ▲, GX-Tu-PV-1.

Neighbor-joining (NJ) tree of the genomic sequences of GX-Tu-PV-1 and 13 other ChPV/TuPV isolates. GenBank accession numbers follow the names of the ChPV/TuPV strains. The numbers near the branches indicate the confidence level calculated by bootstrapping (n = 1,000). The length of each pair of branches represents the distance between sequence pairs. The scale bar represents 0.01-nt substitutions per site. ▲, GX-Tu-PV-1. The sequence data of the GX-Tu-PV-1 strain will facilitate research on the epidemiology and evolutionary biology of parvoviruses in China.

Data availability.

The genome sequence of GX-Tu-PV-1 was deposited in GenBank under the accession number KX084396.
  13 in total

1.  Identification and phylogenetic diversity of parvovirus circulating in commercial chicken and turkey flocks in Croatia.

Authors:  M Bidin; I Lojkić; Z Bidin; M Tiljar; D Majnarić
Journal:  Avian Dis       Date:  2011-12       Impact factor: 1.577

Review 2.  Recent progress in the characterization of avian enteric viruses.

Authors:  J Michael Day; Laszlo Zsak
Journal:  Avian Dis       Date:  2013-09       Impact factor: 1.577

3.  Host Specificity and Phylogenetic Relationships of Chicken and Turkey Parvoviruses.

Authors:  Laszlo Zsak; Ra Mi Cha; Fenglan Li; J Michael Day
Journal:  Avian Dis       Date:  2015-03       Impact factor: 1.577

4.  Parvoviruses: Small Does Not Mean Simple.

Authors:  Susan F Cotmore; Peter Tattersall
Journal:  Annu Rev Virol       Date:  2014-07-09       Impact factor: 10.431

5.  Genetic variation of viral protein 1 genes of field strains of waterfowl parvoviruses and their attenuated derivatives.

Authors:  Hsiang-Jung Tsai; Chun-hsien Tseng; Poa-chun Chang; Kai Mei; Shih-Chi Wang
Journal:  Avian Dis       Date:  2004-09       Impact factor: 1.577

6.  Genetic and phylogenetic analysis of a novel parvovirus isolated from chickens in Guangxi, China.

Authors:  Bin Feng; Zhixun Xie; Xianwen Deng; Liji Xie; Zhiqin Xie; Li Huang; Qin Fan; Sisi Luo; Jiaoling Huang; Yanfang Zhang; Tingting Zeng; Sheng Wang; Leyi Wang
Journal:  Arch Virol       Date:  2016-08-08       Impact factor: 2.574

7.  Prevalence of parvoviruses in commercial turkey flocks.

Authors:  M V Murgia; A Rauf; Y Tang; E Gingerich; C-W Lee; Y M Saif
Journal:  Avian Dis       Date:  2012-12       Impact factor: 1.577

Review 8.  Avian parvovirus: classification, phylogeny, pathogenesis and diagnosis.

Authors:  Sunil S Kapgate; K Kumanan; K Vijayarani; Sukhadeo B Barbuddhe
Journal:  Avian Pathol       Date:  2018-09-24       Impact factor: 3.378

9.  The family Parvoviridae.

Authors:  Susan F Cotmore; Mavis Agbandje-McKenna; John A Chiorini; Dmitry V Mukha; David J Pintel; Jianming Qiu; Maria Soderlund-Venermo; Peter Tattersall; Peter Tijssen; Derek Gatherer; Andrew J Davison
Journal:  Arch Virol       Date:  2013-11-09       Impact factor: 2.574

10.  Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV).

Authors:  Luis F Nuñez; Silvana H Santander-Parra; Lucas Chaible; David I De la Torre; Marcos R Buim; Alexandre Murakami; Maria Lucia Zaidan Dagli; Claudete S Astolfi-Ferreira; Antonio J Piantino Ferreira
Journal:  Vet Sci       Date:  2018-07-25
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.