Xing Hua1, Zhen Liu2, Min Zhou3, Yan Tian4, Pei-Pei Zhao4, Wen-Hai Pan1, Chao-Xia Li1, Xiao-Xiao Huang1, Ze-Xiao Liao1, Qi Xian1, Bo Chen1, Yue Hu1, Lei Leng1, Xiao-Wei Fang1, Li-Na Yu5. 1. Departments of Pathology, Guangzhou Red Cross Hospital, Medical College, Jinan University, Guangzhou 510220, P.R. China. 2. Department of Pathology, School of Basic Medical Sciences, Guizhou Medical University, Guiyang 550025, P.R. China. 3. Department of Otolaryngology, The First Affiliated Hospital of Guangzhou University of Chinese Medicine, Guangzhou 510006, P.R. China. 4. Department of pathology, School of Basic Medical Sciences, Southern Medical University, Guanghou 510515, P.R.China; Department of pathology, Nanfang Hospital, Guanghou 510515, P.R. China; Guangdong Provincial Key Laboratory of Molecular Tumor Pathology, Guangzhou 510515, P.R. China. 5. Department of pathology, School of Basic Medical Sciences, Southern Medical University, Guanghou 510515, P.R.China; Department of pathology, Nanfang Hospital, Guanghou 510515, P.R. China; Guangdong Provincial Key Laboratory of Molecular Tumor Pathology, Guangzhou 510515, P.R. China. Electronic address: nana1800@smu.edu.cn.
Abstract
This article has been retracted: please see Elsevier Policy on Article Withdrawal (https://www.elsevier.com/about/our-business/policies/article-withdrawal). This article has been retracted at the request of the editor after publication concerns were raised with respect to data presented in Figure 2. The journal contacted Southern Medical University, Guangzhou, Guangdong Province, China, who formed an Academic Committee to investigate. According to the “Academic Ethics and Implementation Rules” of Southern Medical University, the Committee reported evidence of improper preservation of original data and incorrect use of pictures, and recommended immediate withdrawal of the paper. Specifically, in the PC-3 group of Fig. 2H, the ‘Control’ cell migration image had been partially duplicated in the ‘Empty vector’ image. As per journal policy, original files used to create the entire figure were requested. Raw western blot images were not available for Figure 2 C+F, and experimental repeats yielded protein level discrepancies with the original published data. The editors therefore no longer have confidence in the integrity of these data.
This article has been retracted: please see Elsevier Policy on Article Withdrawal (https://www.elsevier.com/about/our-business/policies/article-withdrawal). This article has been retracted at the request of the editor after publication concerns were raised with respect to data presented in Figure 2. The journal contacted Southern Medical University, Guangzhou, Guangdong Province, China, who formed an Academic Committee to investigate. According to the “Academic Ethics and Implementation Rules” of Southern Medical University, the Committee reported evidence of improper preservation of original data and incorrect use of pictures, and recommended immediate withdrawal of the paper. Specifically, in the PC-3 group of Fig. 2H, the ‘Control’ cell migration image had been partially duplicated in the ‘Empty vector’ image. As per journal policy, original files used to create the entire figure were requested. Raw western blot images were not available for Figure 2 C+F, and experimental repeats yielded protein level discrepancies with the original published data. The editors therefore no longer have confidence in the integrity of these data.
Prostate cancer (PCa) is one of the most common causes of cancer death in males across the world. The challenges involved in PCa treatment have led to higher demand for better biomarkers to aid the decision-making process during treatment. LSAMP-AS1, antisense to the mRNA of encoding limbic system-associated membrane protein, is associated with the cellular process of senescence. Notably, the recurrent deletion near the LSAMP locus on the chromosome 3 (3q13.31) is prevalent in PCa malignancies. Moreover, miR-183 has been highlighted as an oncogene in PCa and its knockdown could repress growth and motility in PCa cell lines along with reduced tumor growth in vivo. DCN, a small leucine-rich proteoglycan, is a tumor suppressor in PCa. Reduced expression of DCN has been considered as an indicator of poor prognosis in patients with PCa.
Added value of this study
In this study, LSAMP-AS1 was found to be poorly expressed in PCa tissues and cells. Low expression of LSAMP-AS1 was indicative of poor overall survival and disease-free survival, and related to Gleason score, TNM stage, and risk stratification. Over-expressed LSAMP-AS1 inhibited EMT, proliferation, migration and invasion of PCa cells, as well as tumor growth in nude mice. Notably, LSAMP-AS1 competitively bound to miR-183–5p which directly targets DCN. It was confirmed that the inhibitory effect of LSAMP-AS1 on PCa cells was achieved by binding to miR-183–5p, thus promoting the expression of DCN.
Implications of all the available evidence
Taken together, the available data indicate that LSAMP-AS1 binds to miR-183–5p to upregulate DCN expression, which may inhibit the development of PCa. The LSAMP-AS1/miR-183–5p/DCN may be a promising therapeutic strategy for PCa.
Introduction
Prostate cancer (PCa) is one of the most common causes of cancer death in males across the world [1]. The mortality in PCa patients has decreased due to advancements in prostate specific antigen screening along with improved histopathological scoring and imaging diagnostics [2]. Surgical resection and radiotherapy inflict multiple physical impairments such as erectile dysfunction, urinary incontinence, and bowel complications on PCa patients [3, 4]. Moreover, the 5-year survival rate in patients with localized PCa can reach up to 100%, but the rate drops to 28% for those with distant metastasis [5]. The challenges involved in PCa treatment have led to higher demand for better biomarkers to aid the decision-making process during treatment.Long noncoding RNAs (lncRNAs) are abnormally expressed in various human disease conditions, playing critical roles in promoting pathogenesis or maintaining progression [6]. Now, it is well established that lncRNAs could potentially act as both biomarkers for diagnosis as well as novel therapeutic targets of PCa [7]. Bioinformatics analysis of lncRNA- microRNA (miRNA)- mRNA regulatory network in PCa highlighted the potential genes and pathways implicated in the pathogenesis of PCa. [8]. More importantly, this study identified the involvement of the LSAMP-AS1 / miR-183–5p / decorin (DCN) axis in the progression of PCaLSAMP-AS1, antisense to the mRNA of encoding limbic system-associated membrane protein, is associated with the cellular process of senescence [9]. Notably, the recurrent deletion near the LSAMP locus on the chromosome 3 (3q13.31) is prevalent in PCa malignancies [10]. miR-183 has been highlighted as an oncogene in PCa. Moreover, knockdown of miR-183 was shown to repress growth and motility in PCa cell lines along with reduced tumor growth in vivo by targeting Dkk-3 and SMAD4 [11]. DCN, a small leucine-rich proteoglycan, is a tumor suppressor in PCa. Reduced expression of DCN has been considered as an indicator of poor prognosis in patients with PCa [12, 13]. Additionally, Merline et al. suggested that the DCN signaling can attenuate tumor growth by diminishing the abundance of oncogenic miR-21 in cancer [14]. Thus, DCN may interact with other miRNAs to control the behaviors of cancer cells. Although there is a lot of evidence demonstrating the role of lncRNAs in the development of PCa through regulation of miRNAs and mRNAs, the precise mechanism remains to be studied. In the present study, the effects of the LSAMP-AS1/miR-183–5p/DCN axis on the progression of PCa were explored.
Materials and methods
Ethics statement
The study was conducted under the approval of the Ethics Committee of Nanfang Hospital and in compliance with Helsinki Declaration. All participating subjects signed informed consent documentation. Nude mice were used for in vivo studies and were taken care in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals.
In silico prediction
The PCa microarray data GSE55945, GSE46602 and GSE38241 and the annotation probe files were retrieved and downloaded from the Gene Expression Omnibus database (https://www.ncbi.nlm.nih.gov/geo/). The Affy package of R software was used for background calibration and normalization for each microarray data. The differentially expressed genes (DEGs) in PCa were screened and selected based on the criteria of |logFoldChange| > 1 and p value < 0.05. The expression boxplots of DEGs were constructed by the "expression.R" package.
Study subjects
Totally, 88 PCa patients (age: 45 - 83 years, mean age = 64.81 ± 10.39 years old) who were admitted to Nanfang Hospital from January 2010 to January 2013 were enrolled in this study. The patients were included if: (1), they were diagnosed with PCa by prostate needle biopsy [15], [16], [17], and the clinical stage and risk stratification of PCa were determined by auxiliary examinations; (2), they did not receive any treatment for PCa in the past 3 months. The patients were excluded if: (1), they had other malignant tumors, coronary heart disease, or diabetes; (2), they failed to follow up or if the clinical diagnosis and the treatment information were incomplete [18]. Another 60 patients (age: 45 - 75 years, mean age = 61.03 ± 6.30 years old) with benign prostatic hyperplasia (BPH) were included as the control group. The tissue samples were collected from 88 patients with PCa and 60 patients with BPH and stored in liquid nitrogen.These patients were followed up for 60 months and the survival analysis was performed using the Kaplan-Meier method. During the follow-up period, tumor recurrence or death was regarded as the end of the follow-up. Otherwise, the final follow-up time was the end point. The overall survival (OS) was determined from the date of surgery to the date of death. Importantly, 18F-choline PET/CT was introduced for diagnosis of tumor recurrence. All imaging was performed on a Biograph mCT Flow scanner (Siemens, Munich, Germany). Images were acquired 63 6 6 min (1 h) and 180 6 5 min (3 h) after injection of 18F-PSMA-1007. Median injected activity was 251.5 MBq, ranging from 154 to 326 MBq. Tracer synthesis, examination protocol, and image reconstruction were conducted as previously reported [19]. Notably, the treatment modes against tumor were not taken into consideration on OS of patients; therefore, the results in our study were obtained independent of treatment choice [20].
Cell culture and transfection
The human PCa cell lines PC-3, LNCap, VCaP and DU145 and the normal prostate epithelial cell line RWPE-1 were purchased from the American Type Culture Collection (Manassas, VA, USA). After rapid recovery, the cells were cultured with Roswell Park Memorial Institute (RPMI) 1640 medium (Cat. No. 11,899,119, GIBCO, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS, Cat. No. 10,099,141, GIBCO, Grand Island, NY, USA), 100 U/mL penicillin and 100 U/mL streptomycin, followed by incubation at 37 °C with 5% CO2 (thromo3111, Jinan Beisheng Medical Devices Co., Ltd., Shandong, China). Once the cell confluence reached more than 80%, the cells were detached and sub-cultured.The PC-3 cells were classified into the following 7 groups: the blank group (without any treatment), the empty vector group (transfected with empty vector), the LSAMP-AS1 group (transfected with LSAMP-AS1 overexpression vector, forward: 5′-CGATCTTAATTAAGGGGTACCAAAGTCCACTCTG-3′ and reverse: 5′-TCAGTGGCGCGCCTTTTTCGTGAGTACACAATAGTCATC-3′), the LSAMP-AS1 + mimic-NC group (transfected with LSAMP-AS1 overexpression vector and mimic-NC), the LSAMP-AS1 + miR-183–5p mimic group (transfected with LSAMP-AS1 overexpression vector and miR-183–5p mimic), the LSAMP-AS1 + sh-NC group (transfected with LSAMP-AS1 overexpression vector and shRNA-NC, 5′-UUCUCCGAACGUGUCACGUTT-3′), and the LSAMP-AS1 + sh-DCN group (transfected with LSAMP-AS1 overexpression vector and shRNA-DCN, 5′-GGTCTGGACAAAGTGCCAAAG-3′). In addition, the DU145 cells were assigned into the following 3 groups: the blank group (without any treatment), the sh-NC group (transfected with shRNA-NC) and the sh-LSAMP-AS1 group (transfected with shRNA-LSAMP-AS1, 5′-GGCCAAACCCUCAAUGAAUTT-3′) [21, 22]. All the plasmids were purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, Guangdong, China). The cells were seeded into the wells of a 12-well plate, culturing with complete RPMI 1640 medium for 24 h before transfection. When the cell confluence reached 70%, the cells were transfected with lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). The medium was changed 6 h after transfection. The cells were collected for the subsequent experiments 48 h later [23].
Fluorescence in situ hybridization (FISH)
The subcellular localization of LSAMP-AS1 in PCa cells was examined by the FISH assay. The experiment was performed according to the instructions in the manual of Ribo™ lncRNA FISH Probe Mix (Red) (RiboBio, China). Briefly, the cells were seeded into the 24-well culture plate at the cell density of 6 × 104 cells/well and grew until the cell confluence reached 80%. The cells were then fixed with 1 mL of 4% paraformaldehyde at room temperature, followed by the treatments with proteinase K (2 μg/mL), glycine, and acetylation reagent respectively. Next, the cells were incubated with 250 μL of pre-hybridization solution at 42 °C for 1 h followed by overnight hybridization at 42 °C with 250 μL of pre-hybridization solution containing biotin-labeled antisense LSAMP-AS1 probe (300 ng/mL, Shanghai GeneChem Co., Ltd., Shanghai, China). After that, the cells were stained with 4′,6-diamidino-2-phenylindole (DAPI) (1: 800) diluted in phosphate buffered saline Tween-20 in a 24-well culture plate for 5 min. The cells were sealed with the anti-fade mounting medium. Five different visual fields were randomly selected for observation and imaging under the fluorescence microscope (Olympus, Tokyo, Japan) [24].
Quantification of gene expression
The total RNA in tissues or cells was extracted using the Trizol method (Cat. No. 16,096,020; Thermo Fisher Scientific, NY, USA). The RNA was reversely transcribed into cDNA according to the instructions in the manual of cDNA kit (K1622; Fermentas Inc., Ontario, CA, USA). The real time polymerase chain reaction (PCR) assay was performed using the SYBR® Premix Ex Taq™ kit (TaKaRa, Shiga, Japan) on the ABI 7500 quantitative PCR instrument (Applied Biosystems Inc., Foster City, CA, USA). The expression of miR-183–5p was determined using the TaqMan miRNA assay kit (Ambion, Austin, TX, USA) with U6 as the internal reference. The expression of LSAMP-AS1 and DCN was determined with β-actin as the internal reference. Table 1 contains the list of the primers used and their sequences. The fold changes were calculated by means of relative quantification (2−△△Ct method) [25].
Primer sequences for RT-qPCR.Note: RT-qPCR, reverse transcription quantitative polymerase chain reaction; miR, microRNA; DCN, Decorin.
Western blot assay
The total protein in tissues or cells was extracted using the Radio Immunoprecipitation Assay lysis buffer containing phenylmethylsulfonyl fluoride (R0010, Solarbio, Shanghai, China). After incubation on ice for 30 min, the samples were centrifuged at 12,000 r/min for 10 min at 4 °C to collect the supernatant. The bicinchoninic acid kit (23,225, Pierce, Rockford, IL, USA) was used to determine the protein concentration, which was adjusted with deionized water. The proteins were separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (P0012A, Beyotime Institute of Biotechnology, Nanjing, Jiangsu, China) on a 10% gel at 80 V for 2 h, with 50 μg of protein sample uploaded onto each well. The separated proteins were transferred onto the polyvinylidene fluoride membrane (ISEQ00010, Millipore, Billerica, MA, USA) at 110 V for 2 h. The membrane was blocked with Tris-Buffered Saline Tween-20 buffer containing 5% skim milk powder for 2 h. Then, the blots were probed overnight at 4 °C with primary antibodies (Abcam Inc., Cambridge, MA, USA): rabbit anti-E-cadherin (1: 500, ab15148), rabbit anti-vimentin (1: 2000, ab137321), rabbit anti-N-cadherin (1: 1000, ab18203), rabbit anti-Ki67 (1: 1000, ab15580), rabbit anti-proliferating cell nuclear antigen (PCNA) (1: 1000, ab18197), rabbit anti-matrix metalloproteinase-2 (MMP-2) (1: 10,000, ab37150), rabbit anti-MMP-9 (1: 1000, ab38898), rabbit anti-Ezrin (1: 2000, ab231907), rabbit anti-Fascin (1: 1000), ab183891) and rabbit anti-β-actin antibody (1: 100, ab8224). After washing, the membrane was incubated with horseradish peroxidase-labeled goat anti-rabbit immunoglobulin G (IgG) secondary antibody (1: 5000, ab:205,718, Abcam, USA) for 1 h. The protein bands were developed by enhanced chemiluminescence Fluorescence Detection kit (Cat. No. BB-3501, Amersham, Little Chalfont, Buckinghamshire, UK). The images were taken using the Bio-Rad Image Analysis System (BIO-RAD, Hercules, CA, USA), and quantified by Quantity One v4.6.2 software. The relative protein expression was presented as the ratio of the gray value of the corresponding protein to the gray value of β-actin.
Immunofluorescence staining
The transfected cells were seeded into the 24-well plate pre-coated with polylysine and allowed to grow for 24 h before being fixed with 4% paraformaldehyde at room temperature for 30 min, followed by sealing in the blocking solution (Beyotime Institute of Biotechnology, China) at 37 °C for 60 min. After removal of the blocking solution, the cells were incubated with rabbit anti-E-cadherin (1: 500, ab40772, Abcam, USA), mouse anti-Vimentin (1: 1000, ab8978, Abcam, USA) and mouse anti-N-cadherin (1: 200, ab98952, Abcam, USA) at 4 °C overnight. Then, the cells were incubated with Alexa Fluor® 647 donkey anti-rabbit IgG antibody (1: 400, ab150075)/Alexa Fluor 488 donkey anti-mouse (1: 400, ab150117) for 1 h in the dark. DAPI (Beyotime Institute of Biotechnology, China) was used to stain the cells at room temperature for 5 min. Subsequently the cells were sealed with anti-fade mounting medium (Beyotime Institute of Biotechnology, China) for observation and imaging by Molecular Devices high-content screening imaging system. Quantification was performed using Molecular Devices MetaXpress Image Acquisition and Analysis Software [26].
When the cell confluence reached 80%, 0.25% trypsin was used to detach them from plates to prepare the single-cell suspension. This was further used to seed a 96-well plate with 3 × 103 cells/well in 0.2 mL medium. For each sample 6 wells were set as duplicates. The proliferation of cells was measured via MTT assay at 24 h, 48 h, 72 h and 96 h. For this, the medium was replaced by the medium containing 10% MTT solution (5 g/L) (GD-Y1317, Guduo Biotech Co., Ltd., Shanghai, China) and cells were incubated for 4 h. The supernatant was removed and 100 μL of dimethyl sulfoxide (D5879-100ML, Sigma, St. Louis, MO, USA) was added per well to fully dissolve the formazan crystals produced by the living cells. The optical density at 490 nm was measured on a microplate reader (Nanjing Detie Experimental Equipment Co., Ltd., Nanjing, Jiangsu, China).
Transwell assays
The cell migration and invasion assays were performed using 24-well Transwell chambers (Sigma, USA). In the migration assay, 500 μL of RPMI 1640 medium containing 10% FBS was pre-added to the lower chamber. In the invasion assay, 50 μL of Matrigel (Sigma, USA) was pre-added into the upper chamber, which was air-dried for 4 h at room temperature. Besides, 500 μL of RPMI 1640 medium containing 10% FBS was added in the lower chamber. The transfected cells in the logarithmic growth phase were harvested to make a cell suspension with a density of 3 × 105 cells/mL. Next, 100 μL of this cell suspension was added to the upper chamber (Sigma, USA) and incubated at 37 °C, in a 5% CO2 incubator. After 24 h, the Transwell chambers were taken out, fixed for 10 min with methanol, and stained with crystal violet for 10 min. The cells in upper layer of the chamber were carefully removed with a cotton swab. The fibrous membrane was taken out and sealed with a neutral resin in a glass slide. The cells were counted and photographed under the inverted microscope, and each sample was counted for 5 to 10 fields of view. The Image-pro Plus software was adopted for cell counting. The experiment was independently conducted 3 times and the mean value was calculated.
Tumor formation in nude mice
For mice experiments, 3 - 5-week-old nude mice with the approximate body weight of 16 g (Animal Center of the Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, China) were randomly divided into 6 groups (8 mice per group): the blank group, the empty vector group, the LSAMP-AS1 group, the sh-NC group and the sh-LSAMP-AS1 group. The transfected cells growing in the logarithmic phase were harvested to make a cell suspension and its density was adjusted to 4 × 105 cells/mL. Next, 0.5 mL of this cell suspension was subcutaneously injected into the back of each nude mice according to the experimental groups to establish tumor formation mice models. Post tumor formation, the tumor volume of nude mice was measured every 3 days for 1 week. The longest diameter (a) and the shortest diameter (b) of the tumor were measured with a vernier caliper, and the tumor volume (TV) was calculated: TV = 0.5 × a × b2
[27]. After the experimental period was 21 days, all nude mice were euthanized. The tumors were excised and weighed, and the mean tumor weight of nude mice in each group was calculated [28].
Dual-luciferase reporter gene assay
Potential target genes of miR-183–5p were predicted using an online prediction tool microRNA.org and the dual-luciferase reporter gene assay was performed to verify whether DCN was a direct target of miR-183–5p. The artificially synthesized DCN 3′untranslated region (3′UTR) gene fragment were inserted into the pMIR-reporter plasmid (Beijing Huayueyang Biotechnology Co., Ltd., Beijing, China) using the restriction endonuclease cleavage sites SpeI and Hind III. The complementary sequence mutant (MUT) sites of the seed sequence were designed on the DCN wild type (WT). After digestion with the restriction endonucleases, the target fragments were then inserted into the pMIR-reporter plasmid using the T4 DNA ligase. The correctly sequenced luciferase reporter plasmids WT and MUT were respectively co-transfected with miR-183–5p mimic and pRL-TK into the HEK-293T cells (Shanghai Beinuo Biotechnology Co., Ltd., Shanghai, China). Sequences for DCN-WT were AAGAAATTTTGCCTGCCATT and sequences for DCN-MUT were AAGAAATTTTGCCTGCCATT. The cells were harvested and lysed 48 h after transfection. The luciferase activity was examined using the luciferase assay kit (K801-200, Biovision, Mountain View, CA, USA) on the Glomax 20/20 luminometer (Promega, Madison, WI, USA). The experiment was conducted 3 times independently. The binding sites between LSAMP-AS1 and miR-183–5p were verified with the same method.
RNA immunoprecipitation (RIP)
PC-3 cells were collected after trypsin detachment and lysed in lysis buffer (25 mM Tris–HCl pH 7.4, 150 mM NaCl, 0.5% Nonidet P-40, 2 mM ethylenediaminetetraacetic acid, 1 mM NaF and 0.5 mM dithiothreitol) containing RNase (Life Technologies, Gaithersburg, MD, USA) and protease inhibitor cocktail (Roche, Basel, Switzerland). The lysate was centrifuged at 12,000 × g for 30 min to collect the supernatant. The cell lysate was incubated overnight at 4 °C with protein G Sepharose beads pre-coated (for 2 h, at 4 °C) with Argonaute2 (AGO2) antibody (P10502500, Otwo Biotech Inc. Shenzhen, Guangdong, China) or IgG (Sigma, USA). Subsequently, the beads were washed 3 times in wash buffer (50 mM Tris–HCl, 300 mM NaCl pH 7.4, 1 mM MgCl2, 0.1% Nonidet P-40) followed by RNA extraction using the Trizol reagent (Invitrogen, USA). The expression of LSAMP-AS1 and miR-183–5p was determined by reverse transcription quantitative PCR (RT-qPCR) [29].
RNA pull down
PC-3 cells transfected with 50 nM biotinylated bio-miR-183–5p, bio-miR-183–5p-mut or the corresponding NC-bio were harvested after 48 h. Cells were lysed in specific lysis buffer (Ambion, Austin, Texas, USA) for 10 min, followed by centrifugation at 14,000 × g to collect the protein lysate supernatant. This lysate was incubated with M-280 streptavidin magnetic beads (S3762, Sigma, USA) pre-coated with RNase-free bovine serum albumin and yeast tRNA (TRNABAK-RO, Sigma, USA) for 3 h at 4 °C, washed sequentially twice with pre-chilled lysis buffer, thrice with low salt buffer, and once with high salt buffer. The bound RNA was purified using Trizol method and the expression of LSAMP-AS1 and miR-183–5p was determined by RT-qPCR.
Statistical analysis
Statistical analysis was performed using SPSS 21.0 software (IBM Corp., Armonk, NY, USA). The experiments were repeated 3 times independently. The measurement data were expressed by mean ± standard deviation. The t-test was used for comparison between two groups, and one-way analysis of variance (ANOVA) was performed for comparison among multiple groups, followed by Tukey's post hoc test. Data comparison among groups at each time point was analyzed by repeated-measures ANOVA with Tukey's post hoc test. Kaplan-Meier method was employed for the survival analysis, and Pearson correlation analysis for the correlation analysis. The Cox proportional hazard regression model was utilized to predict the significance of the clinicopathological variables for PCa. All statistical tests were two-sided with p < 0.05 indicating statistically significant. Only variables determined to be statistically significant by univariate analysis (p < 0.2) were included in the multivariate analysis [30].
Results
LSAMP-AS1 is poorly expressed in PCa tissue
Data analysis of the microarray datasets of GSE55945 and GSE46602 revealed that LSAMP-AS1 was down-regulated in PCa (Fig. 1A - 1B). Moreover, the expression of LSAMP-AS1 was significantly lower in PCa tissues in comparison to that in BPH tissues (p < 0.05), verifying the microarray data analysis (Fig. 1C). Based on the median relative expression of LSAMP-AS1 in PCa tissues (0.406), 88 patients were classified into the high-expression and low-expression groups for Kaplan-Meier analysis. Notably, it was observed that low expression of LSAMP-AS1 led to poor OS and disease-free survival (DFS) in PCa patients (p < 0.05) (Fig. 1D - 1E).
Fig. 1
LSAMP-AS1 is poorly expressed in PCa and correlated with clinicopathological characteristics of patients with PCa. A, Analysis of LSAMP-AS1 expression in PCa tissues of GSE55945 microarray data. B, Analysis of LSAMP-AS1 expression in PCa tissues of GSE46602 microarray data. C, The relative expression of LSAMP-AS1 in PCa tissues (n = 88) and BPH tissues (n = 60) determined by RT-qPCR. d-E, Kaplan-Meier analysis for OS and DFS of PCa patients with low and high LSAMP-AS1 expression. The data were measurement data and presented by mean ± standard deviation. Data in Panel C were analyzed by independent-sample t-test. * p < 0.05 versus the BPH group.
LSAMP-AS1 is poorly expressed in PCa and correlated with clinicopathological characteristics of patients with PCa. A, Analysis of LSAMP-AS1 expression in PCa tissues of GSE55945 microarray data. B, Analysis of LSAMP-AS1 expression in PCa tissues of GSE46602 microarray data. C, The relative expression of LSAMP-AS1 in PCa tissues (n = 88) and BPH tissues (n = 60) determined by RT-qPCR. d-E, Kaplan-Meier analysis for OS and DFS of PCa patients with low and high LSAMP-AS1 expression. The data were measurement data and presented by mean ± standard deviation. Data in Panel C were analyzed by independent-sample t-test. * p < 0.05 versus the BPH group.The correlation between the expression of LSAMP-AS1 and the clinicopathological characteristics of PCa patients was evaluated. It was found that the expression level of LSAMP-AS1 was significantly lower in the patients with Gleason score ≤ 6 points, tumor node metastasis (TNM) III - IV stage, and high-risk PCa (p < 0.05) (Table 2). The results of univariate and multivariate analyses of the association of clinicopathological variables with PCs are summarized in Table 3. According to multivariate Cox regression analysis, Gleason score, TNM staging, risk stratification and expression of LSAMP-AS1 and DCN were found to be significant predictors of PCa. In summary, the reduced expression of LSAMP-AS1 in PCa is closely associated with its clinicopathological characteristics.
Table 2
Correlation analysis between the LSAMP-AS1 expression and the clinicopathological characteristics of PCa patients.
Characteristics
N (%)
LSAMP-AS1 expression
p value
Age (year)
0.6253
≤ 65
41 (46.59)
0.41 ± 0.09
> 65
47 (53.41)
0.40 ± 0.10
Gleason grade
0.0104
≤ 6
47 (53.41)
0.43 ± 0.08
3 + 4
6 (6.82)
0.39 ± 0.07
4 + 3
8 (9.09)
0.41 ± 0.11
8
11 (12.50)
0.38 ± 0.08
9 - 10
16 (18.18)
0.34 ± 0.10
PSA (ng/mL)
0.6082
≤ 10
37 (42.05)
0.41 ± 0.09
> 10
51 (57.95)
0.40 ± 0.10
TNM staging
0.0026
I – II stage
49 (55.68)
0.43 ± 0.09
III – IV stage
39 (44.32)
0.37 ± 0.09
Risk stratification
0.0080
Low risk
38 (43.18)
0.44 ± 0.08
Intermediate risk
10 (11.36)
0.39 ± 0.08
High risk
40 (45.45)
0.38 ± 0.09
Note: PSA, prostate specific antigen; TNM, tumor node metastasis; Data were measurement data, expressed by means ± standard deviation. Comparison between two groups was analyzed by independent-sample t-test. Comparison among multiple groups was analyzed by one-way ANOVA, followed by a Tukey's post hoc test.
Table 3
Univariate and multivariate analyses of biochemical recurrence in the study cohort.
Correlation analysis between the LSAMP-AS1 expression and the clinicopathological characteristics of PCa patients.Note: PSA, prostate specific antigen; TNM, tumor node metastasis; Data were measurement data, expressed by means ± standard deviation. Comparison between two groups was analyzed by independent-sample t-test. Comparison among multiple groups was analyzed by one-way ANOVA, followed by a Tukey's post hoc test.Univariate and multivariate analyses of biochemical recurrence in the study cohort.Note: PSA, prostate specific antigen; TNM, tumor node metastasis; DCN, Decorin; HR, hazard ratio; CI, confidence interval.
Over-expression of LSAMP-AS1 inhibits epithelial-mesenchymal transition (EMT), proliferation, migration and invasion of PCa cells
As a next step to verify the link between reduced LSAMP-AS1 expression and PCa progression, the effects of LSAMP-AS1 on the biological activities in PCa cell lines were evaluated. Initial assessment of the LSAMP-AS1 expression revealed lower levels of LSAMP-AS1 in PCa cell lines in comparison to those in normal prostate epithelial cell line RWPE-1 (p < 0.05) (Fig. 2A). Among the PCa cell lines, PC-3 cells presented the lowest expression of androgen receptor-negative LSAMP-AS1 while DU145 cells exhibited the highest (cell lines in order of expression: DU145 > LNCap > VCap > PC-3). The VCaP cells with lower expression of androgen receptor-positive LSAMP-AS1, PC-3 and DU145 cells were selected for the subsequent experiments.
Fig. 2
Over-expression of LSAMP-AS1 inhibits EMT, proliferation, migration and invasion of PCa cells. A, The quantitation of LSAMP-AS1 expression in human PCa cell lines and the normal prostate epithelial cells. B, The immunofluorescence staining to detect the distribution and expression of EMT-related proteins (400 ×). C-D, The protein bands and levels of EMT-related proteins normalized to β-actin measured by Western blot analysis. E, The cell proliferation assessed by MTT assay. F-G, The protein bands and levels of proliferation-related proteins normalized to β-actin measured by Western blot analysis. H-I, The cell migration and corresponding quantitation measured by Transwell assay (200 ×). J-K, The cell invasion and corresponding quantitation measured by Transwell assay (200 ×). l-M, The protein bands and levels of invasion and migration-related proteins normalized to β-actin measured by Western blot analysis. The data were measurement data and presented by mean ± standard deviation. Data in Panel E were analyzed by repeated measures ANOVA, followed by Bonferroni post hoc test. Data in Panel A, D, G, H, I, K, and M were analyzed by one-way ANOVA, followed by Tukey's post hoc test. Cell experiment was independently conducted 3 times. * p < 0.05 versus the RWPE-1 cell line or the empty vector group. # p < 0.05 versus the sh-NC group.
Over-expression of LSAMP-AS1 inhibits EMT, proliferation, migration and invasion of PCa cells. A, The quantitation of LSAMP-AS1 expression in human PCa cell lines and the normal prostate epithelial cells. B, The immunofluorescence staining to detect the distribution and expression of EMT-related proteins (400 ×). C-D, The protein bands and levels of EMT-related proteins normalized to β-actin measured by Western blot analysis. E, The cell proliferation assessed by MTT assay. F-G, The protein bands and levels of proliferation-related proteins normalized to β-actin measured by Western blot analysis. H-I, The cell migration and corresponding quantitation measured by Transwell assay (200 ×). J-K, The cell invasion and corresponding quantitation measured by Transwell assay (200 ×). l-M, The protein bands and levels of invasion and migration-related proteins normalized to β-actin measured by Western blot analysis. The data were measurement data and presented by mean ± standard deviation. Data in Panel E were analyzed by repeated measures ANOVA, followed by Bonferroni post hoc test. Data in Panel A, D, G, H, I, K, and M were analyzed by one-way ANOVA, followed by Tukey's post hoc test. Cell experiment was independently conducted 3 times. * p < 0.05 versus the RWPE-1 cell line or the empty vector group. # p < 0.05 versus the sh-NC group.To evaluate the effect of LSAMP-AS1 on EMT in PCa cell lines, the expression of EMT-related proteins in response to different treatments was determined by immunofluorescence staining and Western blot assay (Fig. 2B - 2D). In the PC-3 and VCaP cell lines, no significant difference in the expression of E-cadherin, vimentin and N-cadherin was observed between cells without treatment and those treated with empty vector (p > 0.05). Besides, the expression of E-cadherin increased in response to over-expression of LSAMP-AS1, accompanied by decreased expression of vimentin and N-cadherin (p < 0.05). Moreover, in the DU145 cell line, the expression of E-cadherin, vimentin and N-cadherin in cells without treatment was not different from that treated with sh-NC (p > 0.05). However, the treatment of sh-LSAMP-AS1 caused decreased expression of E-cadherin and increased expression of vimentin and N-cadherin (p < 0.05).The MTT assay and Western analysis were performed to assess the proliferation rate in PCa cell lines in response to different treatments (Fig. 2E - 2I). In the PC-3 and VCaP cell lines, no significant difference was detected in the proliferation rate and the expression of proliferation-related factors (Ki67 and PCNA) between cells without treatment and those treated with empty vector (p > 0.05). Notably, overexpression of LSAMP-AS1 impeded the cell proliferation rate corresponding to the reduced expression of Ki67 and PCNA (p < 0.05). Additionally, in the DU145 cell line, an enhanced cell proliferation rate and the corresponding increase in expression of Ki67 and PCNA were observed in cells treated with sh-LSAMP-AS1 (p < 0.05). The expression of Ki67 and PCNA in cells without treatment was not significantly different from that treated with sh-NC (p > 0.05).The migration and invasion of PCa cells were characterized by the Transwell assay and Western blot analysis (Fig. 2J - 2O). The migration and invasion of PC-3 and VCaP cells treated with empty vector from those without any treatment were not different from those treated with empty vector (p > 0.05). Besides, the migration and invasion of DU145 cells without any treatment showed no difference from those treated with sh-NC (p > 0.05). In response to the overexpressed LSAMP-AS1, PC-3 cells displayed decreased abilities of migration and invasion, accompanied by inhibited expression of MMP-2, MMP-9, Ezrin and Fascin (p < 0.05). Furthermore, the treatment of sh-LSAMP-AS1 led to increased migration and invasion of cells, accompanied by enhanced expression of MMP-2, MMP-9, Ezrin and Fascin (p < 0.05). The above results indicated that over-expression of LSAMP-AS1 could inhibit EMT, proliferation, migration and invasion of PCa cells.
Over-expression of LSAMP-AS1 inhibits tumor growth of PCa in vivo
After identifying the inhibitory role of LSAMP-AS1 in PC-3 and DU145 cell lines, we further observed its effect on the tumor growth in nude mice (Fig. 3A - 3C). It was found that the volume of xenograft tumors in nude mice increased with time. No significant difference was observed in the volume and weight between xenograft tumors of un-treated PC-3 cells and PC-3 cells treated with empty vector (p > 0.05). The size and weight of tumors xenografts from PC-3 cells with over-expressed LSAMP-AS1 reduced (p < 0.05). In the xenograft tumors of DU145 cells, the tumor size and weight increased in response to the sh-LSAMP-AS1 treatment (p < 0.05). There was no difference observed between tumors formed due to un-treated cells and those treated with sh-NC (p > 0.05). Thus, over-expression of LSAMP-AS1 could suppress the tumorigenicity of PCa cells in nude mice.
Fig. 3
Over-expression of LSAMP-AS1 represses the tumorigenicity of PCa cells in nude mice. A, The quantitation of the volume change of xenograft tumors in nude mice. B, The representative images of xenograft tumors in nude mice. C, The quantitation of the weight of xenograft tumors in nude mice. The data were measurement data and presented by mean ± standard deviation. Data in Panel A were analyzed by repeated measures ANOVA, followed by Bonferroni post hoc test. Data in Panel C were analyzed by one-way ANOVA, followed by Tukey's post hoc test. The experiment was independently conducted 3 times. * p < 0.05 versus the empty vector group. # p < 0.05 versus the sh-NC group. N = 8.
Over-expression of LSAMP-AS1 represses the tumorigenicity of PCa cells in nude mice. A, The quantitation of the volume change of xenograft tumors in nude mice. B, The representative images of xenograft tumors in nude mice. C, The quantitation of the weight of xenograft tumors in nude mice. The data were measurement data and presented by mean ± standard deviation. Data in Panel A were analyzed by repeated measures ANOVA, followed by Bonferroni post hoc test. Data in Panel C were analyzed by one-way ANOVA, followed by Tukey's post hoc test. The experiment was independently conducted 3 times. * p < 0.05 versus the empty vector group. # p < 0.05 versus the sh-NC group. N = 8.
LSAMP-AS1 competitively binds to miR-183–5p
FISH revealed that LSAMP-AS1 was mainly expressed in the cytoplasm (Fig. 4A) [31]. It was identified that LSAMP-AS1 might bind to miR-218–5p and miR-183–5p through in silico analysis using the DIANA Tools (http://diana.imis.athena-innovation.gr/DianaTools/index.php?r=site/page&view=software) and online website RegRNA2.0 (http://regrna2.mbc.nctu. Edu.tw/index.html) (Fig. 4B - 4C). Since the role of miR-218–5p as a tumor suppressor has been studied previously [32], miR-183–5p was selected for further study.
Fig. 4
LSAMP-AS1 competitively binds to miR-183–5p. A, The subcellular localization of LSAMP-AS1 detected by the FISH assay (200 ×). The green part represents LSAMP-AS1 expression, and blue part represents nucleus. B, miRNAs binding to LSAMP-AS1 screened by DIANA. C, The binding sites of LSAMP-AS1 and miR-183–5p identified by online website RegRNA2.0. D, RT-qPCR to detect the relative expression of miR-183–5p in PCa tissues and BPH tissues. E, Kaplan-Meier analysis on OS and DFS of PCa patients with high and low miR-183–5p expression. F, Pearson correlation analysis of LSAMP-AS1 expression and miR-183–5p expression in PCa tissues. G, The binding of LSAMP-AS1 and miR-183–5p was verified by dual-luciferase reporter gene assay. * p < 0.05 versus the mimic-NC group. H, RIP assay to evaluate the binding relationship between LSAMP-AS1 and miR-183–5p. * p <0.05 versus the IgG group. I, RNA-pull down assay of LSAMP-AS1 binding to miR-183–5p. * p <0.05 versus the miR-183–5p-bio-mut group. J, The expression of miR-183–5p in PC-3 cells examined by RT-qPCR. Data in Panel D were analyzed by independent-sample t-test. Data in Panel G, H, I, and J were analyzed by one-way ANOVA, followed by Tukey's post hoc test. The data were measurement data and presented by mean ± standard deviation. * p < 0.05 versus the BPH tissues or the empty vector group. Cell experiment was repeated 3 times independently.
LSAMP-AS1 competitively binds to miR-183–5p. A, The subcellular localization of LSAMP-AS1 detected by the FISH assay (200 ×). The green part represents LSAMP-AS1 expression, and blue part represents nucleus. B, miRNAs binding to LSAMP-AS1 screened by DIANA. C, The binding sites of LSAMP-AS1 and miR-183–5p identified by online website RegRNA2.0. D, RT-qPCR to detect the relative expression of miR-183–5p in PCa tissues and BPH tissues. E, Kaplan-Meier analysis on OS and DFS of PCa patients with high and low miR-183–5p expression. F, Pearson correlation analysis of LSAMP-AS1 expression and miR-183–5p expression in PCa tissues. G, The binding of LSAMP-AS1 and miR-183–5p was verified by dual-luciferase reporter gene assay. * p < 0.05 versus the mimic-NC group. H, RIP assay to evaluate the binding relationship between LSAMP-AS1 and miR-183–5p. * p <0.05 versus the IgG group. I, RNA-pull down assay of LSAMP-AS1 binding to miR-183–5p. * p <0.05 versus the miR-183–5p-bio-mut group. J, The expression of miR-183–5p in PC-3 cells examined by RT-qPCR. Data in Panel D were analyzed by independent-sample t-test. Data in Panel G, H, I, and J were analyzed by one-way ANOVA, followed by Tukey's post hoc test. The data were measurement data and presented by mean ± standard deviation. * p < 0.05 versus the BPH tissues or the empty vector group. Cell experiment was repeated 3 times independently.The expression of miR-183–5p was found to be higher in PCa tissues than that in BPH tissues (p < 0.05) (Fig. 4D). The 88 patients were divided into the high and low expression groups, based on the median relative expression of miR-183–5p in PCa tissues (1.823). In total, 44 cases showed low expression of miR-183–5p. Kaplan-Meier analysis showed that PCa patients with higher expression of miR-183–5p manifested poor OS and DFS (p < 0.05) (Fig. 4E). Moreover, a negative correlation was observed between the expression levels of LSAMP-AS1 and miR-183–5p in PCa tissues (r = −0.548, p < 0.05) (Fig. 4F).The binding of miR-183–5p and LSAMP-AS1 was verified by performing dual-luciferase reporter gene assay. The luciferase activity of cells co-transfected with miR-183–5p mimic and LSAMP-AS1-WT was significantly decreased compared with that transfected with mimic-NC (p <0.05). The luciferase activity of cells co-transfected with miR-183–5p mimic and LSAMP-AS1-Mut did not change significantly (p > 0.05), indicating that LSAMP-AS1 could bind to miR-183–5p (Fig. 4G). In addition, in the RIP assay, a higher recruitment of LSAMP-AS1 and miR-183–5p was detected in the AGO2 group, when compared to IgG (Fig. 4H). In the RNA-pull down assay, miR-183–5p-bio was able to pull down more of LSAMP-AS1 (Fig. 4I). Moreover, in agreement with these results, the expression of miR-183–5p was reduced in PC-3 cells in the presence of over-expressed LSAMP-AS1, relative to that in un-treated PC-3 cells and those treated with empty vector (p < 0.05) (Fig. 4J). These results demonstrate that LSAMP-AS1 binds to miR-183–5p.
miR-183–5p targets dcn gene
Furthermore, 177 intersected genes were screened from the down-regulated genes in the miRWalk database (http://mirwalk.umm.uni-heidelberg.de/) and the GSE38241 microarray data (Fig. 5A). The core gene DCN was identified from the String database (https://string-db. The org/cgi/input.pl?sessionId=vqj6YpSn1fuT&input_page_show_search=on) (Fig. 5B). The putative binding sites of miR-183–5p and the DCN-3′UTR were predicted by microRNA.org (http://www.microrna.org/) (Fig. 5C).
Fig. 5
miR-183–5p targets and negatively regulates DCN gene. A, The genes in the intersection of down-regulated genes in the miRWalk database and GSE38241 microarray data. B, The core gene DCN was screened out by the String database. C, microRNA.org (http://www.microrna.org/) was used to predict the binding sites between miR-183–5p and DCN. D, The relative expression of DCN in PCa tissues and BPH tissues determined by RT-qPCR. E, Kaplan-Meier analysis for OS and DFS of PCa patients with high and low expression of DCN. F, Pearson correlation analysis of miR-183–5p expression and DCN expression in PCa tissues. G, The dual-luciferase reporter gene assay was applied to verify the binding of miR-183–5p to DCN. H, RNA-pull down assay was performed to confirm the binding of miR-183–5p to DCN. I-K, RIP assay was conducted to detect the binding of miR-183–5p to LSAMP-AS1 and DCN (* p < 0.05 versus the IgG group in Panel I, * p < 0.05 versus the empty vector group in Panel J and * p < 0.05 versus the sh-NC group in Panel K). * p < 0.05 versus the miR-183–5p-bio-mut group. Data in Panel D were analyzed by independent-sample t-test. Data in Panel G and H were analyzed by one-way ANOVA, followed by Bonferroni post hoc test. The cell experiment was repeated 3 times independently. The data were measurement data and presented by mean ± standard deviation. * p < 0.05 versus the BPH group or the mimic-NC group.
miR-183–5p targets and negatively regulates DCN gene. A, The genes in the intersection of down-regulated genes in the miRWalk database and GSE38241 microarray data. B, The core gene DCN was screened out by the String database. C, microRNA.org (http://www.microrna.org/) was used to predict the binding sites between miR-183–5p and DCN. D, The relative expression of DCN in PCa tissues and BPH tissues determined by RT-qPCR. E, Kaplan-Meier analysis for OS and DFS of PCa patients with high and low expression of DCN. F, Pearson correlation analysis of miR-183–5p expression and DCN expression in PCa tissues. G, The dual-luciferase reporter gene assay was applied to verify the binding of miR-183–5p to DCN. H, RNA-pull down assay was performed to confirm the binding of miR-183–5p to DCN. I-K, RIP assay was conducted to detect the binding of miR-183–5p to LSAMP-AS1 and DCN (* p < 0.05 versus the IgG group in Panel I, * p < 0.05 versus the empty vector group in Panel J and * p < 0.05 versus the sh-NC group in Panel K). * p < 0.05 versus the miR-183–5p-bio-mut group. Data in Panel D were analyzed by independent-sample t-test. Data in Panel G and H were analyzed by one-way ANOVA, followed by Bonferroni post hoc test. The cell experiment was repeated 3 times independently. The data were measurement data and presented by mean ± standard deviation. * p < 0.05 versus the BPH group or the mimic-NC group.In vivo analysis revealed that the mRNA expression of DCN in PCa tissues was significantly lower than that in BPH tissues (p < 0.05) (Fig. 5D). Subsequently, 88 PCa patients were classified into the high and low expression groups based on the median relative expression of DCN in PCa tissues (0.646). Kaplan-Meier analysis showed that patients with low-expression DCN had poor OS and DFS (p < 0.05) (Fig. 5E). Besides, a negative correlation was also determined between the expression levels of miR-183–5p and DCN in PCa tissues (r = −0.355, p < 0.05) (Fig. 5F). Furthermore, the dual-luciferase reporter gene assay showed that the luciferase activity of cells co-transfected with miR-183–5p mimic and DCN-wt was significantly reduced, as compared to that co-transfected with the mimic-NC with DCN-wt (p < 0.05). There was no significant difference in the luciferase activity of cells co-transfected with miR-183–5p mimic and DCN-mut (p > 0.05) (Fig. 5G). Moreover, RNA-pull downs (Fig. 5H) as well as RIP analysis (Fig. 5I) indicated that miR-183–5p could bind to DCN. Notably, when LSAMP-AS1 was overexpressed, AGO2-miR-183–5p could pull down much more LSAMP-AS1 and less DCN (Fig. 5J) while silencing LSAMP-AS1 induced opposite results (Fig. 5K), suggesting that LSAMP-AS1 and DCN could competitively bind to miR-183–5p. Taken together, these results confirm that DCN is a target gene of miR-183–5p.
Over-expression of LSAMP-AS1 up-regulates dcn gene by sponging miR-183–5p to inhibit PCa cell EMT, proliferation, migration and invasion
The aforementioned findings show that LSAMP-AS1 competitively binds to miR-183–5p, which in turn targets and negatively regulates DCN. Hence, further experiments were performed to evaluate the involvement of miR-183–5p and DCN in the inhibitory role of LSAMP-AS1 in the development of PCa.In terms of EMT in PC-3 cells, the treatment of over-expressed LSAMP-AS1 plus miR-183–5p mimic resulted in significant decreased expression of E-cadherin and increased expression of vimentin and N-cadherin versus the treatment of over-expressed LSAMP-AS1 plus mimic-NC (p < 0.05). Furthermore, treatment with LSAMP-AS1 mut plus miR-183–5p mimic showed more pronounced results (p < 0.05). Relative to the treatment of over-expressed LSAMP-AS1 plus sh-NC, decreased expression of E-cadherin and increased expression of vimentin and N-cadherin were observed in response to over-expressed LSAMP-AS1 plus sh-DCN (p < 0.05) (Fig. 6A - 6C).
Fig. 6
Over-expression of LSAMP-AS1 up-regulates DCN gene by sponging miR-183–5p to inhibit PCa cell EMT, proliferation, migration and invasion. A, Immunofluorescence staining to detect the distribution and expression of EMT-related proteins (400 ×). B-C, The protein bands and levels of EMT-related proteins normalized to β-actin measured by Western blot analysis. D, The cell proliferation assessed by MTT assay. E-F, The protein bands and levels of proliferation-related proteins normalized to β-actin measured by Western blot analysis. G-H, The cell migration and corresponding quantitation measured by Transwell assay (200 ×). I-J, The cell invasion and corresponding quantitation measured by Transwell assay (200 ×). K-L, The protein bands and levels of invasion and migration-related proteins normalized to β-actin measured by Western blot analysis. Data in Panel D were analyzed by repeated measures ANOVA, followed by Bonferroni post hoc test. Data in Panel C, F, H, J, and L were analyzed by one-way ANOVA, followed by Tukey's post hoc test. The data were measurement data and presented by mean ± standard deviation. * p < 0.05 versus the LSAMP-AS1 + mimic-NC group. # p < 0.05 versus the LSAMP-AS1 + sh-NC group. & p < 0.05 versus the LSAMP-AS1 + miR-183–5p mimic.
Over-expression of LSAMP-AS1 up-regulates DCN gene by sponging miR-183–5p to inhibit PCa cell EMT, proliferation, migration and invasion. A, Immunofluorescence staining to detect the distribution and expression of EMT-related proteins (400 ×). B-C, The protein bands and levels of EMT-related proteins normalized to β-actin measured by Western blot analysis. D, The cell proliferation assessed by MTT assay. E-F, The protein bands and levels of proliferation-related proteins normalized to β-actin measured by Western blot analysis. G-H, The cell migration and corresponding quantitation measured by Transwell assay (200 ×). I-J, The cell invasion and corresponding quantitation measured by Transwell assay (200 ×). K-L, The protein bands and levels of invasion and migration-related proteins normalized to β-actin measured by Western blot analysis. Data in Panel D were analyzed by repeated measures ANOVA, followed by Bonferroni post hoc test. Data in Panel C, F, H, J, and L were analyzed by one-way ANOVA, followed by Tukey's post hoc test. The data were measurement data and presented by mean ± standard deviation. * p < 0.05 versus the LSAMP-AS1 + mimic-NC group. # p < 0.05 versus the LSAMP-AS1 + sh-NC group. & p < 0.05 versus the LSAMP-AS1 + miR-183–5p mimic.Moreover, the treatment of over-expressed LSAMP-AS1 plus miR-183–5p mimic was shown to accelerate PC-3 cell proliferation, accompanied by elevated levels of proliferation-related factors (Ki67 and PCNA), when compared with the treatment of over-expressed LSAMP-AS1 plus mimic-NC (p < 0.05). As expected, the delivery of LSAMP-AS1 mut resulted in much more pronounced effect with miR-183–5p mimic than LSAMP-AS1 (p < 0.05). Also, the PC-3 cell proliferation and the expression of Ki67 and PCNA were facilitated in response to over-expressed LSAMP-AS1 plus sh-DCN, relative to the treatment of over-expressed LSAMP-AS1 plus sh-NC (p < 0.05) (Fig. 6D - 6F).Notably, the numbers of migrated and invasive cells were increased, corresponding to promoted expression of migration and invasion-related factors (MMP-2, MMP-9, Ezrin and Fascin) in PC-3 cells treated with over-expressed LSAMP-AS1 plus miR-183–5p mimic, when compared with PC-3 cells treated with over-expressed LSAMP-AS1 plus mimic-NC (p < 0.05). Compared with treatment of LSAMP-AS1 + miR-183–5p mimic, LSAMP-AS1 mut + miR-183–5p mimic showed stronger effects on migration and invasion (p < 0.05). Relative to the treatment of LSAMP-AS1 + sh-NC, the numbers of migrated and invasive cells increased and the expression of migration and invasion-related factors was accordingly elevated in the presence of over-expressed LSAMP-AS1 plus sh-DCN (p < 0.05) (Fig. 6G). These results indicated that LSAMP-AS1 suppressed the EMT, proliferation, migration and invasion of PCa cells by up-regulating the DCN expression by sponging miR-183–5p.
Discussion
The prostatectomy, radiation therapy and hormone treatment for patients with PCa commonly cause adverse events such as urinary and sexual complications, bone diseases and even cardiovascular diseases [33]. Consequently, further research is needed to develop novel target therapies to provide favorable treatment outcomes with less adverse effects. Aberrantly expressed lncRNAs exert tumor suppressive and oncogenic functions by regulating tumor-related miRNAs or mRNAs and could be used as targets for anti-cancer therapy [6]. In the current study, we found that LSAMP-AS1 up-regulated the DCN expression by competitively binding to miR-183–5p, thus impeding the EMT, proliferation, migration and invasion of PCa cells (Fig. 7).
Fig. 7
Schematic representation of the role of LSAMP-AS1 in activities of PCa cells. LSAMP-AS1 competitively binds to miR-183–5p to promote the expression of DCN, thereby inhibiting EMT, proliferation, migration and invasion of PCa cells.
Schematic representation of the role of LSAMP-AS1 in activities of PCa cells. LSAMP-AS1 competitively binds to miR-183–5p to promote the expression of DCN, thereby inhibiting EMT, proliferation, migration and invasion of PCa cells.LncRNAs have been known to potentially have diagnostic, prognostic and predictive functions in PCa [34], [35], [36]. The microarray data analysis implicated the role of LSAMP-AS1, one of the LncRNAs that is poorly expressed in PCa. The low expression of LSAMP-AS1 was subsequently validated in both PCa tissues and cell lines. Importantly, it was also revealed that low expression of LSAMP-AS1 was indicative of poor OS and DFS, and was also associated with clinicopathological characteristics of patients with PCa. These findings corroborate the results of a previous study by Petrovics et al., which demonstrates that the deletion of LSAMP in PCa is associated with aggressive progression in African American males [10]. Therefore, increased expression of LSAMP may curtail the progression of PCa. Moerover, Barøy et al. have reported that over-expression of LSAMP represses the tumor growth in a preclinical osteosarcoma model [37]. Meanwhile, Kresse et al. have identified LSAMP as a possible tumor suppressor gene in osteosarcomas by array comparative genomic hybridization [38]. However, these results were not confirmed by altering the expression of LSAMP-AS1 via in vitro and in vivo experiments. In the current study we present both gain- and loss-of-function experiments strongly supporting the hypothesis that over-expression of LSAMP-AS1 causes significant decline in EMT, proliferation, migration and invasion of PCa cells, as well as the tumorigenicity of PCa cells in nude mice.LSAMP-AS1 was shown to competitively bind to miR-183–5p which in turn targeted and negatively regulated the DCN gene. It has been demonstrated that miR-183 inhibitor impedes PCa growth by up-regulating Dkk-3 and SMAD4 via WNT/β-catenin signaling [11]. Additionally, the oncogenic role of miR-183–5p has been indicated in lung adenocarcinoma [39] and bladder cancer [40]. DCN, an endogenous inhibitor of transforming growth factor-β1 (TGF-β1) [41], can suppress the growth and metastatic of primary tumors by reversing TGF-β induced immunosuppression [14, 42]. Specifically, systemic delivery of oncolytic adenovirus expressing DCN has proven to be effective in attenuating bone metastases in mouse models of PCa [43]. Based on these findings, the inhibitory role of LSAMP-AS1 involving miR-183–5p and DCN in PCa development could be proposed.Subsequently, our results confirm that over-expression of LSAMP-AS1 up-regulated DCN levels via competitively binding to miR-183–5p and thus inhibiting PCa cell EMT, proliferation, migration and invasion. Down-regulated miR-183 has been found to inhibit EMT in pancreatic cancer cells, as reflected by increased E-cadherin expression and decreased N-cadherin expression, along with suppressed cells proliferation, migration, and invasion [44]. The loss of E-cadherin, a protein regulating cell-cell adhesion, is implicated in EMT that commonly occurs during the process of tumor metastasis [45]. Up-regulation of DCN curtails cancer malignancies by suppression of cell proliferation, migration and resistance to apoptosis in colorectal cancer [46]. Ki67 and PCNA are recognized as proliferation markers to predict survival in patients suffering from cancers, such as anorectal malignant melanoma [47]. MMP-2 and MMP-9 have been identified as prognostic markers predicting malignancy in PCa [48]. Consequently, when LSAMP-AS1 reduced the expression of these pertinent factors related to proliferation and metastasis, the cell activities could be mediated accordingly.Taken together, this study provides evidence that over-expressed LSAMP-AS1 up-regulated the DCN expression by affecting miR-183–5p, whereby attenuating the EMT, proliferation, migration and invasion of PCa cells. Identification of the molecular mechanisms contributing to metastasis of PCa would enable physicians to determine more effective treatment regimens at the time of diagnosis. These sponge-lncRNAs might harbor oncogenic or anticarcinogenic properties, and disturbance of sponge regulation mediated by lncRNAs can be applied for therapeutic strategies against cancer. The present study highlights the knowledge gap in how lncRNAs function and affect miRNAs regulating the origin and development of cancers and the potential applicable value of lncRNAs with regard to various functions [49]. Further research will aid in developing therapeutic targets to assist in preventing disease progression, therapy resistance, and inhibiting metastatic spread.
Funding
The funds for the above study were provided by Guangzhou Science and Technology Plan Projects (No. 201,707,010,465), National Natural Science Foundation of China (No. 81,272,849, 81,472,319), the Natural Science Foundation of Guangdong Province (No. 2014A03031-3680, 2014A030313325), Guangdong Medical Scientific Research Fund (No. A2015309) and Medical and Health Science and Technology Project of Guangzhou (No. 20151A011012).
Authors' contributions
Zhen Liu, Min Zhou, Yan Tian, Pei-Pei Zhao and Wen-Hai Pan designed the study. Chao-Xia Li, Xiao-Xiao Huang, Ze-Xiao Liao, Qi Xian, Bo Chen, Yue Hu, Lei Leng and Xiao-Wei Fang collated the data, carried out data analyses and produced the initial draft of the manuscript. Xing Hua and Li-Na Yu contributed to drafting and polishing the manuscript. All authors have read and approved the final submitted manuscript.
Authors: O Ben-Izhak; M Bar-Chana; L Sussman; V Dobiner; J Sandbank; M Cagnano; H Cohen; E Sabo Journal: Histopathology Date: 2002-12 Impact factor: 5.087
Authors: Kotb Abdelmohsen; Amaresh Panda; Min-Ju Kang; Jason Xu; Roza Selimyan; Je-Hyun Yoon; Jennifer L Martindale; Supriyo De; William H Wood; Kevin G Becker; Myriam Gorospe Journal: Aging Cell Date: 2013-07-14 Impact factor: 9.304
Authors: Zhou Du; Tong Sun; Ezgi Hacisuleyman; Teng Fei; Xiaodong Wang; Myles Brown; John L Rinn; Mary Gwo-Shu Lee; Yiwen Chen; Philip W Kantoff; X Shirley Liu Journal: Nat Commun Date: 2016-03-15 Impact factor: 14.919
Authors: Carolina Oliveira-Rizzo; María Carolina Ottati; Rafael Sebastián Fort; Santiago Chavez; Juan Manuel Trinidad; Andrés DiPaolo; Beatriz Garat; José Roberto Sotelo-Silveira; María Ana Duhagon Journal: Noncoding RNA Date: 2022-01-18
Authors: Eliana Benincore-Flórez; Jorge El-Azaz; Gabriela Alejandra Solarte; Alexander Rodríguez; Luis H Reyes; Carlos Javier Alméciga-Díaz; Carolina Cardona-Ramírez Journal: Heliyon Date: 2022-03-01