Hongzhe Zhang1, Lingshuang Liu1, Chunmiao Jiang2, Keqing Pan1, Jing Deng1, Chunyan Wan1. 1. Department of Endodontics, The Affiliated Hospital and School of Stomatology of Qingdao University, China. 2. Department of Orthodontics, The Affiliated Hospital and School of Stomatology of Qingdao University, China.
Abstract
The matrix metalloproteinase (MMP) family is widely involved in the destruction of the pulp and apical tissues in the inflammatory process. MMP9 is closely related to oral inflammation. Nevertheless, the specific function of MMP9 during oral inflammation, as well as its mechanism, is not well understood. Our previous studies found that in experimentally induced apical periodontitis, more severe inflammation occurred in MMP9 knockout mice compared with the wild type mice. Moreover, the pathology phenomenon of alveolar bone destruction was even more evident in MMP9 knockout mice compared with the wild type mice. We proposed that MMP9 has "anti-inflammatory" properties. We aimed to study the effects of MMP9 on inflammatory response as well as on bone formation and bone destruction. We found a specific relationship between MMP9 and inflammation. qRT-PCR and Western blot revealed that the production of IL-1β, TNF-α, RANK, RANKL, TLR2, and TLR4 was reduced by MMP9 in LPS-stimulated MC3T3-E1 cells. Meanwhile, the expressions of OPG and OCN were increased by MMP9 in LPS-stimulated cells. MMP9 plays a protective role in LPS-induced inflammation, thereby providing new clues to the prevention and treatment of apical periodontitis.
The matrix metalloproteinase (MMP) family is widely involved in the destruction of the pulp and apical tissues in the inflammatory process. MMP9 is closely related to oral inflammation. Nevertheless, the specific function of MMP9 during oral inflammation, as well as its mechanism, is not well understood. Our previous studies found that in experimentally induced apical periodontitis, more severe inflammation occurred in MMP9 knockout mice compared with the wild type mice. Moreover, the pathology phenomenon of alveolar bone destruction was even more evident in MMP9 knockout mice compared with the wild type mice. We proposed that MMP9 has "anti-inflammatory" properties. We aimed to study the effects of MMP9 on inflammatory response as well as on bone formation and bone destruction. We found a specific relationship between MMP9 and inflammation. qRT-PCR and Western blot revealed that the production of IL-1β, TNF-α, RANK, RANKL, TLR2, and TLR4 was reduced by MMP9 in LPS-stimulated MC3T3-E1 cells. Meanwhile, the expressions of OPG and OCN were increased by MMP9 in LPS-stimulated cells. MMP9 plays a protective role in LPS-induced inflammation, thereby providing new clues to the prevention and treatment of apical periodontitis.
Chronic apical periodontal diseases lead to bone destruction in the apical region.
This is a complex physiological change mediated by multiple inflammatory factors.
Numerous data show that matrix metalloproteinases (MMPs) are widely involved and
play an important role in the destruction of the pulp and apical tissues in the
process of inflammation.[1-3]MMPs are a family of zinc enzymes responsible for degradation and remodeling of the
extracellular matrix proteins (ECMs) during normal developmental processes, such as
organ morphogenesis and angiogenesis in pathological processes, such as inflammation
and tumor invasion. They are synthesized and secreted in the cell surface or
extracellular matrix when a clear signal arrives, such as physical agents (heat
shock, UV irradiation) and cell cytokines (IL-1β, TNF-α). The synthesis stops or
falls to a low level when the signal ceases or negative signal arrives, such as
retinoic acid and TNF-β.[4,5]
MMPs start the osteoclast resorption by removing the collagen from the bone surface
before the initiation of demineralization.[6] They can degrade ECM and play subtle roles such as affecting cell activities
by modifying the extracellular environment.[7] Moreover, MMPs are reported to determine where and when bone resorption will
be initiated. They are required for the recruitment of osteoclast to a future
resorption site.[8] Amongst MMPs, MMP9 appears to be a main regulator involved in the invasive
activity of osteoclast.[6,9]MMP9 (92 kDa type IV collagenase; gelatinase B) was discovered by Wilhelm in 1989 and
is the largest MMP.[10] It reportedly binds to its substrates, namely, type IV collagen, gelatin, and laminin.[11] MMP9 is mainly secreted by neutrophils and macrophages,[12,13] and it
regulates inflammation in tissues and diseases.[12,14-19] MMP9 is also closely related
to periodontal inflammation. Significant elevation of MMP9 expression was observed
in chronically infected areas in apical periodontitis.[20-24] Overexpression of MMP9
attenuated osteoclast formation and inhibited pro-inflammatory cytokines secretion.[25] MMP9 initiates osteoclasts by removing collagen from the demineralized bone,
which is essential for resorption.[26] Therefore, its role is to mediate and promote bone destruction. However, MMPs
may have “anti-inflammatory properties.” When the expression of MMPs was inhibited
by chemical substances, the periapical lesions were significantly aggravated, and
the necrosis rate is increased.[27] Our previous work showed that MMP9 knockout mice developed larger periapical
lesions with greater inflammatory response compared with the wild type mice.[28] This finding suggests that the role of MMP9 in bone destruction is complex
and diverse. Therefore, the effects of MMP9 on inflammation require further
investigation.The aim of this investigation was to clarify the effects of MMP9 on inflammatory
response and on bone formation and destruction in apical periodontitis. We found a
specific relationship between MMP9 and inflammation. We analyzed the expression
levels of receptor activator of NF-κB (RANK), receptor activator of NF-κB ligand
(RANKL), osteoprotegerin (OPG), osteocalcin (OCN), TNF-α, and IL-1β by Western blot
and quantitative real time PCR (qRT-PCR).
Materials and methods
Cell culture
The mouse osteoblastic cell line MC3T3-E1 cells were obtained from HYcell
Biotechnology (Wuhan, China) and were cultured in α-MEM (Hyclone, USA)
containing 10% FBS (Hyclone, USA) plus penicillin (100 U/ml) and streptomycin
(100 mg/ml) (Hyclone, USA) at 37°C in a humidified atmosphere containing 5%
CO2 and 5% air. The medium was refreshed every 2 d.
Culture of Porphyromonas endodontalis and preparation of
LPS
P. endodontalis (ATCC35406) was obtained from
BIOBW (Beijing, China) and was cultured anaerobically at 37°C. LPS was extracted
by the hot phenol-water method as previously described.[29] The bioactivity of purified P. endodontalisLPS was
measured with the limulus amoebocyte lysate (LAL) endotoxin assay kit
(GenScript, USA).
Cell transfection
MC3T3-E1 cells were seeded onto 24-well plates and allowed to proliferate until
70–90% before DNA transfection. Cells were then transfected with pCMV3-SP-N-His
(pCMV3, control group) (Sino Biological, Beijing, China) or pCMV3-MMP9 (MMP9
overexpression group) (Sino Biological, Beijing, China) at a final concentration
of 0.8 μg/ml by Lipofectamine 2000 (Thermo, USA). After 48 h, cells were
stimulated with different concentrations of P. endodontalisLPS
for the indicated time. The total RNA and protein extracted from both groups
were used for qRT-PCR and Western blot assay.MC3T3-E1 cells were seeded onto 24-well plates and allowed to proliferate until
30–50% before siRNA transfection. Cells were transfected with si-MMP9-1
(Ribobio, Guangzhou, China), si-MMP9-2 (Ribobio, Guangzhou, China), si-MMP9-3
(Ribobio, Guangzhou, China), and a negative control siRNA (Ribobio, Guangzhou,
China) at a final concentration of 50 nmmol/l using Lipofectamine 2000 (Thermo,
USA) according to the manufacturer’s instructions. After 48 h, cells were
stimulated with different concentrations of P. endodontalisLPS
for the indicated time. Total RNA and protein extracted from both groups were
used for qRT-PCR and Western blot assay.
qRT-PCR analysis
Total RNA was extracted using TRIpure total RNA extraction reagent (ELK
Biotechnology, Wuhan, China). First-strand cDNA synthesis was performed using
the reverse transcription system (ELK Biotechnology) according to the
manufacturer’s instructions. qRT-PCR was performed with the StepOne™ real-time
PCR system (Life Technologies, USA). The following genes were quantified: MMP9,
IL-1β, TNF-α, RANK, RANKL, OPG, OCN, TLR2, and TLR4. GAPDH was used as the
internal normalization control. Primer sequences are shown in Table 1. The
expression of each gene was calculated using the 2−ΔΔCT methods. The
gene expression ratio was shown as mean ± SD from three independent
experiments.
Table 1.
Oligonucleotide primer sequences used in qRT-PCR.
Gene
Sequence (5′-3′)
Size
GAPDH
Forward
TGAAGGGTGGAGCCAAAAG
227
Reverse
AGTCTTCTGGGTGGCAGTGAT
MMP9
Forward
AAGGGTACAGCCTGTTCCTGGT
149
Reverse
CTGGATGCCGTCTATGTCGTCT
IL-1β
Forward
TCATTGTGGCTGTGGAGAAGC
164
Reverse
AATGGGAACGTCACACACCAG
RANKL
Forward
CAGGACTCGACTCTGGAGAGTG
152
Reverse
AACCATGAGCCTTCCATCATAG
TNF-α
Forward
TCCCCAAAGGGATGAGAAGTT
298
Reverse
GAGGAGGTTGACTTTCTCCTGG
RANK
Forward
CTTGGACCAACTGCACCCTC
201
Reverse
CCTTCCTGTAGTAAACGCCGA
OPG
Forward
GGAGGAAGACATTGTGTGTCCC
157
Reverse
TCCTCACACTCACACACTCGGT
OCN
Forward
GCAGGAGGGCAATAAGGTAGTG
165
Reverse
CCATAGATGCGTTTGTAGGCG
TLR2
Forward
ACGTTTGCTATGATGCCTTTGT
109
Reverse
AGACACAGCTTAAAGGGCGG
TLR4
Forward
ACACTTTATTCAGAGCCGTTGGT
297
Reverse
CAGGTCCAAGTTGCCGTTTC
Oligonucleotide primer sequences used in qRT-PCR.
Western blot analysis
Cells were harvested, lysed with lysis buffer (ASPEN, Wuhan, China), and
centrifuged at 16,200 g for 10 min. Total proteins in the supernatant were
measured using a BCA protein assay kit (ASPEN, Wuhan, China). Total proteins
were extracted from MC3T3-E1 cells. The protein at 30 µg was resolved by 10%
SDS-PAGE gels (ASPEN, Wuhan, China). After electrophoresis, the proteins were
transferred onto nitrocellulose membrane (Millipore, USA). The membranes were
blocked with 5% nonfat milk (ASPEN, Wuhan, China) at room temperature for 1 h.
The samples were probed with anti-GAPDH (1:10,000; Abcam, UK), anti-IL-1β
(1:1000; Abcam, UK), anti-TNF-α (1:500; Abcam, UK), anti-RANK (1:1000; Abcam,
UK), anti-RANKL (1:500; Novusbio, Shanghai, China), anti-OPG (1:1000; Abcam,
UK), anti-OCN (1:500; Abcam, UK), anti-TLR2 (1:1000; Abcam, UK), and anti-TLR4
(1:500; Abcam, UK) Abs. HRP-conjugated goat anti-rabbit IgG (1:10000; ASPEN,
Wuhan, China) was used for detection.
Statistical analysis
The data are presented as the mean ± SD. Statistical analysis was performed with
SPSS15.0. Differences between individual groups were analyzed by Student’s
t-test (two-tailed) with subsequent Bonferroni correction. The statistical
significance was determined at P < 0.05 or
P < 0.01. All experiments in this study were
independently repeated at least thrice.
Results
MMP9 expression was increased by MMP9 DNA transfection
Plasmid DNA pCMV3 or pCMV3-MMP9 was transfected into MC3T3-E1 cells. After 48 h,
MMP9 expression was examined by Western blot and qRT-PCR. MMP9 production in the
MMP9 overexpression group was significantly higher than in the control group at
both mRNA and protein level (P < 0.01) (Figure 1a to c).
Figure 1.
Effect of MMP9 overexpression plasmid and MMP9 siRNAs on MMP9 expression.
MC3T3-E1 cells were stimulated with pCMV3-SP-His-mMMP9 plasmid for 48 h.
cDNA and protein were analyzed by RT-PCR (a) and Western blot (b),
respectively. The cells were treated with the three different MMP9
siRNAs for 48 h.MMP9 expression was detected by qRT-PCR (d) and Western
blot (e). Target sequences: si-m-Mmp9-1: GACTTGCCGCGAGACATGA,
si-m-Mmp9-2: GCGCTCTGCATTTCTTCAA, si-m-Mmp9-3: GGAACTCACACGACATCTT. (c, f)
Quantification of protein expression was normalized to GAPDH using a
densitometer (imaging system). The data are representative of three
independent experiments and expressed as the mean ± SD.
**P < 0.01.
Effect of MMP9 overexpression plasmid and MMP9 siRNAs on MMP9 expression.
MC3T3-E1 cells were stimulated with pCMV3-SP-His-mMMP9 plasmid for 48 h.
cDNA and protein were analyzed by RT-PCR (a) and Western blot (b),
respectively. The cells were treated with the three different MMP9
siRNAs for 48 h.MMP9 expression was detected by qRT-PCR (d) and Western
blot (e). Target sequences: si-m-Mmp9-1: GACTTGCCGCGAGACATGA,
si-m-Mmp9-2: GCGCTCTGCATTTCTTCAA, si-m-Mmp9-3: GGAACTCACACGACATCTT. (c, f)
Quantification of protein expression was normalized to GAPDH using a
densitometer (imaging system). The data are representative of three
independent experiments and expressed as the mean ± SD.
**P < 0.01.
MMP9 expression was inhibited by MMP9 siRNAs
MC3T3-E1 cells were transfected with si-MMP9-1, si-MMP9-2, si-MMP9-3, or control
siRNA for 48 h. MMP9 expression was detected by Western blot and qRT-PCR. MMP9
expression was inhibited by si-MMP9-1, si-MMP9-2, or si-MMP9-3 at mRNA and
protein levels. MMP9 expression in the si-MMP9-3 group was the lowest both at
mRNA and protein levels (P < 0.01) (Figure 1d to f).
LPS regulated IL-1β expression
MC3T3-E1 cells were treated without or with different concentrations of LPS (1,
5, 10, 20, and 50 µg/ml) for 24 h. qRT-PCR and Western blot were conducted to
determine if LPS regulated IL-1β expression. qRT-PCR and Western blot results
showed that IL-1β expression slightly decreased after the cells were treated
with LPS at 1 and 5 µg/ml compared with the control group
(P > 0.05). IL-1β expression increased significantly after
treatment with LPS at 10 μg/ml (P < 0.01) and peaked at
20 μg/ml (P < 0.01), followed by a slight decrease at
50 μg/ml (P < 0.01) (Figure 2a to c).
Figure 2.
Effect of different concentrations and different time points of LPS
stimulation on IL-1β expression. MC3T3-E1 cells were treated with or
without LPS at different concentrations (1, 5, 10, 20, and 50 μg/ml) for
24 h. DNA samples were analyzed by qRT-PCR (a), and protein samples were
analyzed by Western blot (b). The cells were then treated with 20 μg/ml
of LPS at different time points (0, 6, 12, 24, and 48 h). The expression
of IL-1β was detected by qRT-PCR (d) and Western blot (e). (c, f)
Quantification of protein expression was normalized to GAPDH using a
densitometer (imaging system). The data are representative of three
independent experiments and expressed as the mean ± SD.
*P < 0.05 vs. LPS;
**P < 0.01 vs. LPS.
Effect of different concentrations and different time points of LPS
stimulation on IL-1β expression. MC3T3-E1 cells were treated with or
without LPS at different concentrations (1, 5, 10, 20, and 50 μg/ml) for
24 h. DNA samples were analyzed by qRT-PCR (a), and protein samples were
analyzed by Western blot (b). The cells were then treated with 20 μg/ml
of LPS at different time points (0, 6, 12, 24, and 48 h). The expression
of IL-1β was detected by qRT-PCR (d) and Western blot (e). (c, f)
Quantification of protein expression was normalized to GAPDH using a
densitometer (imaging system). The data are representative of three
independent experiments and expressed as the mean ± SD.
*P < 0.05 vs. LPS;
**P < 0.01 vs. LPS.MC3T3-E1 cells were then treated with 20 μg/ml LPS at different time points (0,
6, 12, 24, and 48 h). The IL-1β expression was detected by qRT-PCR and Western
blot. IL-1β expression peaked at 12 h (P < 0.01), afterwards
it decreased at 24 h and 48 h (Figure 2d to f). LPS regulated IL-1β expression in a time- and
dose-dependent manner.
MMP9 inhibited LPS-induced IL-1β and TNF-α expression
After the MC3T3-E1 cells were pretreated with MMP9 DNA or si-MMP9-3 for 48 h,
20 μg/ml LPS was added to the culture medium for another 12 h. qRT-PCR and
Western blot were performed to detect IL-1β and TNF-α expressions. At mRNA
level, MMP9 suppressed LPS-induced IL-1β (P < 0.05) and
TNF-α (P < 0.05) expressions. Moreover, pre-treatment with
MMP9 siRNA-3 increased the LPS-induced IL-1β (P < 0.01) and
TNF-α (P < 0.05) expressions. Similarly, at protein level,
MMP9 suppressed LPS-induced IL-1β (P < 0.01) and TNF-α
(P < 0.01) expressions. Pre-treatment with MMP9 siRNA-3
increased the LPS-induced IL-1β (P < 0.01) and TNF-α
(P < 0.05) expressions (Figure 3).
Figure 3.
Effect of MMP9 on LPS-induced expression of IL-1β and TNF-α. MC3T3-E1
cells were pre-treated with MMP9 overexpression plasmid or si-MMP9-3
(target sequences: GGAACTCACACGACATCTT) for 24 h. The 20 μg/ml LPS was
added to the culture medium for another 12 h. qRT-PCR and Western blot
were performed to detect IL-1β (a–c) and TNF-α (d–f) expressions.
Quantification of protein expression was normalized to GAPDH using a
densitometer (imaging system). The data are representative of three
independent experiments and expressed as the mean ± SD.
*P < 0.05 vs. LPS;
**P < 0.01 vs. LPS.
Effect of MMP9 on LPS-induced expression of IL-1β and TNF-α. MC3T3-E1
cells were pre-treated with MMP9 overexpression plasmid or si-MMP9-3
(target sequences: GGAACTCACACGACATCTT) for 24 h. The 20 μg/ml LPS was
added to the culture medium for another 12 h. qRT-PCR and Western blot
were performed to detect IL-1β (a–c) and TNF-α (d–f) expressions.
Quantification of protein expression was normalized to GAPDH using a
densitometer (imaging system). The data are representative of three
independent experiments and expressed as the mean ± SD.
*P < 0.05 vs. LPS;
**P < 0.01 vs. LPS.
MMP9 inhibited LPS-stimulated RANKL and RANK expression while increased OPG
and OCN expression
After pretreating MC3T3-E1 cells with MMP9 DNA or si-MMP9-3 for 48 h, 20 μg/ml
LPS was added to the culture medium for another 12 h. qRT-PCR and Western blot
were conducted to detect RANKL, RANK, OPG, and OCN expression. Treatment with
LPS (20 μg/ml) increased RANKL expression. MMP9 suppressed the LPS-induced RANKL
expression at both mRNA level (P < 0.05) and protein level
(P < 0.05). Moreover, pre-treatment with MMP9 siRNA-3
increased the LPS-induced RANKL expression at both mRNA level
(P < 0.05) and protein level
(P < 0.01) (Figure 4a to c).
Figure 4.
Effect of MMP9 on LPS-induced expression of RANKL, RANK, OPG, and OCN.
MC3T3-E1 cells were pre-treated with MMP9 overexpression plasmid or
si-MMP9-3 (target sequences: GGAACTCACACGACATCTT) for 24 h. The 20 μg/ml
of LPS was added to the culture medium for another 12 h. qRT-PCR and
Western blot were performed to detect RANKL (a–c), RANK (d–f), OPG
(g–i), and OCN (j–l) expressions. Quantification of protein expression
was normalized to GAPDH using a densitometer (imaging system). The data
are representative of three independent experiments and expressed as the
mean ± SD. *P < 0.05 vs. LPS;
**P < 0.01 vs. LPS.
Effect of MMP9 on LPS-induced expression of RANKL, RANK, OPG, and OCN.
MC3T3-E1 cells were pre-treated with MMP9 overexpression plasmid or
si-MMP9-3 (target sequences: GGAACTCACACGACATCTT) for 24 h. The 20 μg/ml
of LPS was added to the culture medium for another 12 h. qRT-PCR and
Western blot were performed to detect RANKL (a–c), RANK (d–f), OPG
(g–i), and OCN (j–l) expressions. Quantification of protein expression
was normalized to GAPDH using a densitometer (imaging system). The data
are representative of three independent experiments and expressed as the
mean ± SD. *P < 0.05 vs. LPS;
**P < 0.01 vs. LPS.Similarly, treatment with LPS (20 μg/ml) increased RANK expression. MMP9
suppressed the LPS-induced RANK expression at both mRNA level
(P < 0.05) and protein level
(P < 0.01). Pre-treatment with MMP9 siRNA-3 increased the
LPS-induced RANK expression at both mRNA level (P < 0.05)
and protein level (P < 0.05) (Figure 4d to f).Conversely, treatment with LPS (20 μg/ml) decreased OPG expression. OPG
expression increased after MMP9 overexpression compared with the LPS-stimulated
group (P < 0.05). OPG expression decreased after MMP9 was
inhibited by MMP9 siRNA-3 (P < 0.01). qRT-PCR and Western
blot analysis showed the same results (Figure 4g to i).Treatment with LPS (20 μg/ml) inhibited OCN expression. OCN expression increased
after MMP9 over-expression compared with the LPS-stimulated group
(P < 0.01). OCN expression decreased after MMP9 was
inhibited by MMP9 siRNA-3 (P < 0.01). qRT-PCR and Western
blot analysis showed the same results (Figure 4j to l).
MMP9 inhibited LPS-induced TLR2 and TLR4 expression
After the MC3T3-E1 cells were pre-treated with MMP9 DNA or si-MMP9-3 for 48 h,
20 μg/ml LPS was added to the culture medium for another 12 h. qRT-PCR and
Western blot were performed to detect TLR2 and TLR4 expressions. At mRNA level,
MMP9 suppressed LPS-induced TLR2 (P < 0.05) and TLR4
(P < 0.05) expressions. Moreover, pre-treatment with
MMP9 siRNA-3 increased the LPS-induced TLR2 (P < 0.05) and
TLR4 (P < 0.05) expressions. At protein level, MMP9
suppressed LPS-induced TLR2 (P < 0.01) and TLR4
(P < 0.01) expressions. Pre-treatment with MMP9 siRNA-3
increased the LPS-induced TLR2 (P < 0.01) and TLR4
(P < 0.01) expressions (Figure 5).
Figure 5.
Effect of MMP9 on LPS-induced expression of TLR2 and TLR4. MC3T3-E1 cells
were pre-treated with MMP9 overexpression plasmid or si-MMP9-3 (target
sequences: GGAACTCACACGACATCTT) for 24 h. The 20 μg/ml LPS was added to
the culture medium for another 12 h. qRT-PCR and Western blot were
performed to detect TLR2 (a–c) and TLR4 (d–f) expressions.
Quantification of protein expression was normalized to GAPDH using a
densitometer (imaging system). The data are representative of three
independent experiments and expressed as the mean ± SD.
*P < 0.05 vs. LPS;
**P < 0.01 vs. LPS.
Effect of MMP9 on LPS-induced expression of TLR2 and TLR4. MC3T3-E1 cells
were pre-treated with MMP9 overexpression plasmid or si-MMP9-3 (target
sequences: GGAACTCACACGACATCTT) for 24 h. The 20 μg/ml LPS was added to
the culture medium for another 12 h. qRT-PCR and Western blot were
performed to detect TLR2 (a–c) and TLR4 (d–f) expressions.
Quantification of protein expression was normalized to GAPDH using a
densitometer (imaging system). The data are representative of three
independent experiments and expressed as the mean ± SD.
*P < 0.05 vs. LPS;
**P < 0.01 vs. LPS.
Discussion
We previously found that the loss of MMP9 induced a great inflammation response in
experimentally induced mouseapical periodontitis.[28] This finding suggested the important role of MMP9 in the host’s immune and
inflammatory response to pulp and periapical infection.P. endodontalis is considered an important member of the
Gram-negative anaerobic microorganisms involved in infected root canals and apical
periodontitis.[30,31] A primary virulence factor of P. endodontalis
is LPS. Certain studies have reported that P. endodontalisLPS play
a critical role in initiating inflammation, thereby resulting in the synthesis and
release of cytokines and inflammatory mediators.[32,33] IL-1β is an important
pro-inflammatory cytokine which is mainly expressed in macrophages and neutrophils.
It is a critical cytokine associated with the initiation and the persistence of
inflammation.[34,35] We first confirmed LPS’ regulatory function on pro-inflammatory
factor IL-1β by stimulating MC3T3-E1 cells with different concentrations at
different time points. LPS induced the IL-1β mRNA and protein expressions in a time-
and dose-dependent manner. IL-1β expression peaked after stimulation with LPS at
20 μg/ml for 12 h. MMPs can mediate neutrophil response to inflammation.[12,36] MMP9 is
closely related to inflammation development and can mediate the recruitment of
pro-inflammatory cells to the inflammatory zone.[37,38] We found that MMP9 inhibited
the LPS-induced IL-1β up-regulation in MC3T3-E1 cells in the subsequent detection.
TNF-α is also a potent pro-inflammatory cytokine that plays an important role in
immunity and inflammation.[39,40] TNF-α expression decreased following MMP9 over-expression,
thereby indicating that MMP9 can protect against LPS-induced inflammation.LPS administration induces inflammation and osteoclastic bone resorption.[41,42] We next
examined the RANKL-OPG bi-molecular system. By activating the cognate RANK receptor
on the surface of pre-osteoclasts, it triggers their differentiation into mature
osteoclasts, thereby activating bone resorption.[43] The action of RANKL can be blocked by OPG, which has structural homology to
RANK. By binding to RANKL, OPG prevents further interaction with RANK and indirectly
protects bone from resorption.[44] In this study, RANKL and RANK expressions were decreased by MMP9. Conversely,
OPG expression was increased after MMP9 over-expression. Thus, MMP9 might inhibit
bone resorption by down-regulating RANKL and RANK and by up-regulating OPG.We then examined a marker gene for osteogenesis, OCN, which can regulate bone
mineralization and bone turnover.[45,46] OCN is synthesized by
osteoblastic cells and is the most abundant non-collagenous protein.[47] LPS down-regulated osteogenic differentiation by inhibiting OCN expression in
MC3T3-E1 cells.[48] OCN expression increased in MMP9 over-expressed cells, which indicated that
MMP9 might stimulate bone formation in LPS-induced inflammation.Our study showed that under the stimulation of P. endodontalisLPS,
MMP9 inhibited IL-1β, TNF-α, RANKL, and RANK expressions and increased OPG and OCN
expressions. In order to explore the mechanism of MMP9’s regulation of the cells’
responses to LPS, we examined the expressions of TLR2 and TLR4. Previous studies
reported that LPS triggered inflammation response through its binding with the cell
membrane receptor, TLR4.[49-51] There is also
work indicating TLR2 being involved in mediating responses to LPS.[52,53] We found that
MMP9 inhibited the LPS-induced TLR2 and TLR4 expression.In summary, the findings of this study showed that MMP9 is a potent inhibitor of
LPS-induced IL-1β and TNF-α production. It regulates osteogenesis/osteolysis by
inhibiting bone resorption and promoting bone formation. This “anti-inflammation”
effect of MMP9 is consistent with the hypothesis we proposed in our previous study.[28] Furthermore, the regulatory effects of MMP9 are found to be associated with
TLR2 and TLR4. However, more researches are needed to explore the regulatory
mechanism of MMP9.
Authors: Francisco Montagner; Rogério C Jacinto; Fernanda G C Signoretti; Paula F Sanches; Brenda P F A Gomes Journal: J Endod Date: 2011-12-16 Impact factor: 4.171