Literature DB >> 31724318

From a variant of unknown significance to pathogenic: Reclassification of a large novel duplication in BRCA2 by high-throughput sequencing.

Jana Lisa van Luttikhuizen1, Janin Bublitz1, Stephanie Schubert1, Gunnar Schmidt1, Winfried Hofmann1, Susanne Morlot1, Reena Buurman1, Bernd Auber1, Brigitte Schlegelberger1, Doris Steinemann1.   

Abstract

BACKGROUND: Germline mutations in BRCA1/2 significantly contribute to hereditary breast and/or ovarian cancer. Here, we report a novel BRCA2 duplication of exons 22-24 in a female patient with bilateral breast cancer at age 35 and 44. The duplicated region was initially detected by gene panel sequencing and multiplex ligation-dependent probe amplification. However, the location and orientation of the duplicated region was unknown. Therefore, it was initially classified as a variant of unknown significance.
METHODS: The spatial directional characterization of the BRCA2 duplication was achieved by targeted enrichment of the whole-genomic BRCA2 locus including exons and introns, and subsequent high-throughput sequencing. Subsequently, bioinformatics tools and a breakpoint-spanning PCR were used for identification of location and orientation of the duplication.
RESULTS: The duplicated region was arranged in tandem and direct orientation (Chr13(GRCh37):g.32951579_32960394dup; NM_000059.3 c.8754 + 651_9256+6112dup p.(Ala3088Phefs*3)). It is predicted to result in a frameshift and a premature stop codon likely triggering nonsense-mediated mRNA decay. Consequently, it is regarded as pathogenic.
CONCLUSION: This case study demonstrates that a comprehensive characterization of a structural variant by breakpoint assessment is crucial for its correct classification. Therefore, sequencing strategies including non-coding regions might be necessary to identify cancer predispositions in affected families.
© 2019 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Entities:  

Keywords:  BRCA2; copy number variation; hereditary breast and/or ovarian cancer; high-throughput sequencing; large genomic rearrangement

Mesh:

Substances:

Year:  2019        PMID: 31724318      PMCID: PMC7506983          DOI: 10.1002/mgg3.1045

Source DB:  PubMed          Journal:  Mol Genet Genomic Med        ISSN: 2324-9269            Impact factor:   2.183


The well‐known tumor suppressor genes BRCA1/2 (MIM #113705/#600185) are crucial to restore genomic stability after DNA double‐strand breaks via homologous recombination. Germline pathogenic variants (PVs) in one of the genes significantly increase the lifetime risk to develop hereditary breast and/or ovarian cancer (HBOC, MIM #604370). About 25% of HBOC can be explained by pathogenic BRCA1/2 variants (Nielsen, van Overeem Hansen, & Sorensen, 2016). Most BRCA1/2 PVs described in literature are single‐nucleotide variants. However, 12.42% of BRCA1 PVs and 4.17% of BRCA2 PVs are large genomic rearrangements (LGRs) (Lopez‐Urrutia et al., 2018). The increased occurrences of BRCA1 LGRs compared to BRCA2 is most likely due to its higher density of Alu repeat sequences, which are susceptible to homologous recombination (Woodward, Davis, Silva, Kirk, & Leary, 2005). As a consequence, the detection of LGRs performed in diagnostics is initially recommended to include only BRCA1 and has been extended to BRCA2 in recent years (Engert et al., 2008). A widely used method to detect LGRs is multiplex ligation‐dependent probe amplification (MLPA), which has been first introduced in 2003. MLPA is a semi‐quantitative PCR‐based technique that can determine the copy numbers of different target sequences, simultaneously (Hogervorst et al., 2003). Although the technique has been proven to be effective and sensitive in the detection of copy number variations (Belvini, Salviato, Radossi, & Tagariello, 2017; Scaglione et al., 2018), it cannot identify the position or orientation of duplications within the genome (Rost, Loffler, Pavlova, Muller, & Oldenburg, 2008). Therefore, conclusive characterization regarding the pathogenicity of duplications is impossible using solely MLPA. In these cases, additional methods are required for the classification of variants. Before high‐throughput sequencing was accessible, MLPA has often been combined with a breakpoint‐spanning PCR and a Sanger sequencing‐based primer walk for the identification of the exact breakpoint. Although the method is simple and inexpensive, it can be labor‐intensive, when the region that needs to be covered is large and the orientation is unknown. Nowadays, high‐throughput sequencing is a feasible option to detect genomic rearrangements (Nunziato et al., 2017). However, panel or whole‐exome sequencing does not cover intronic or intergenic regions of the genome, while whole‐genome sequencing is often not the most cost‐effective method. Here, we used a targeted enrichment strategy, which allowed the high‐throughput sequencing of selected regions, including exons and introns. We were able to identify a novel tandem duplication of exons 22–24 of BRCA2, which is most likely causative for HBOC. The patient (III:7) (Figure 1) was first diagnosed with an invasive ductal carcinoma of the right mammary gland at the age of 35 (pT1c (2), N1, G3, estrogen receptor (ER) positive, progesterone receptor (PR) negative, and human epidermal growth factor receptor 2 (HER2) negative). After performing right mastectomy, the patient received adjuvant chemotherapy (4 × epirubicin/cyclophosphamide, 4 × Taxol), and tamoxifen for 3 years. With 44 years of age, she was diagnosed with a moderately differentiated invasive mammary carcinoma in her left mammary gland (pTX, G2, ER positive, PR positive, and HER2 negative).
Figure 1

Family pedigree. Circles: female; squares: male; filled solid: breast cancer; striped: other type of cancer; unfilled: unaffected; red outline: BRCA2 duplication carrier; green outline: non‐carrier; black outline: not examined. BC, breast cancer; BBC, bilateral breast cancer; BLC, bladder cancer; TC, testicular cancer; M, Melanoma; SAR, sarcoma. The numbers below the symbols represent the age of the individual, followed by type of cancer and age at cancer onset. The index patient is marked by an arrow

Family pedigree. Circles: female; squares: male; filled solid: breast cancer; striped: other type of cancer; unfilled: unaffected; red outline: BRCA2 duplication carrier; green outline: non‐carrier; black outline: not examined. BC, breast cancer; BBC, bilateral breast cancer; BLC, bladder cancer; TC, testicular cancer; M, Melanoma; SAR, sarcoma. The numbers below the symbols represent the age of the individual, followed by type of cancer and age at cancer onset. The index patient is marked by an arrow Within the patient's family, multiple incidences of different cancer types appeared, including one other incidence of breast cancer (Figure 1). Her maternal first cousin (III:11) developed a tubular and papillary mammary gland carcinoma at the age of 51. Her maternal uncle (II:5) was diagnosed with testicular cancer at the age of 65. The patient's father (II:3) was diagnosed with bladder cancer at the age of 74. His brother had an unidentified primary tumor, most likely a melanoma, which metastasized into the brain and the neck, where it formed a clearly visible lymph node tumor. He died at the age of 63. His son (III:2) died at the age of 28 as a result of a fibrosarcoma in his thigh diagnosed 3 years earlier. The proband's young age at the initial breast cancer diagnosis and the development of bilateral breast cancer before the age of 50, suggested a genetic predisposition for the disease. In 2010, after the second incidence of breast cancer, she was first examined in our clinic. Genomic DNA was isolated from EDTA blood samples using the QIAamp DNA blood Midi kit (Qiagen) and was tested for single‐nucleotide variants in BRCA1/2 via high‐resolution melt (HRM) analysis and denaturing high‐performance liquid chromatography (DHPLC). Additionally, she was tested for CNVs in BRCA1 via MLPA (SALSA® MLPA® P002 BRCA1 Kit, MRC‐Holland). No PV was identified. Since other types of cancer occurred in the family, including sarcoma, the patient was tested for Li‐Fraumeni syndrome (MIM #151623). In approximately 70% of families fulfilling the criteria for classical Li‐Fraumeni syndrome, a PV in TP53 can be identified (Evans et al., 2002). In 2018, screening of TP53 was performed via the TruSight Cancer Panel (Illumina). On this occasion, MLPA testing for BRCA2 (SALSA® MLPA® P045 BRCA2/CHEK2 Kit, MRC‐Holland) was also performed, which was implemented as a routine screening in our clinic in 2012. Both techniques detected a duplication of exons 22–24 of BRCA2, but its location and orientation within the genome of the duplicated region remained unknown. Due to the large introns surrounding exon 22 and exon 24, determining the duplication's orientation and breakpoints using PCR‐based sequencing techniques would have been labor‐intensive and inefficient. Therefore, the duplication has initially been classified as a variant of unknown significance (VUS), according to the ENIGMA classification criteria for BRCA1/2 variants (Version 2.5.1 29 June 2017). To further characterize the duplication, the complete BRCA2 locus of the patient was amplified via a custom‐designed targeted enrichment strategy (Agilent SureSelectQXT) and sequenced on a NextSeq 500 (Illumina) according to the manufacturer's instructions. Briefly, 50 ng of the patient's genomic DNA was enzymatically fragmented and adaptor‐tagged. The DNA fragments of interest hybridized to biotin‐labeled cRNA baits targeting the genomic loci of BRCA1 (Chr17(GRCh37):g.40600254_41756008) and BRCA2 (Chr13(GRCh37):g.32414335_33482189), including exonic, intronic, and surrounding intergenic regions. The cRNA‐DNA hybrids were captured using streptavidin‐coated magnetic beads. After washing and amplification, the enriched DNA fragments were submitted to paired‐end sequencing using a NextSeq 500 Mid Output V2 kit for 2 × 150 bp paired‐end reads (Illumina). A mean coverage of 422 reads with 99.61% of bases covered by at least 20 reads was achieved. The in silico copy number variation detection tool CnvHunter (https://github.com/imgag/ngs-bits) confirmed the duplication covering exons 22–24 of BRCA2 (Figure 2). The tool detects duplications and deletions by comparing the coverage profiles of samples (n = 80) sequenced with the same targeted enrichment method. By analyzing the reads, we were able to determine the breakpoint and its direct tandem orientation. Additionally, a breakpoint‐spanning PCR was performed, using the following primers for validation, 5′‐CTCTAGAGTACTGTGAGTGG‐3′ (Chr13(GRCh37):g.32960177–32960196) and 5′‐GAGACGGAGTTTTGCTCTTG‐3′ (Chr13(GRCh37):g.32951708–32951727). The breakpoints of the duplication were located within the homologous region TAAAAATACAAAA: Chr13(GRCh37):g.32951579_32960394dup (Figure 2). This tandem duplication of exon 22–24 (about 8,815 bp; HGVS: NM_000059.3 c.8754 + 651_9256+6112dup p.(Ala3088Phefs*3)) is predicted to cause a frameshift and a premature termination codon, which is located more than 50 nucleotides upstream of the last exon–exon junction. This is known to be critical to trigger nonsense‐mediated mRNA decay (Lindeboom, Supek, & Lehner, 2016). Therefore, we regard this variant to be pathogenic.
Figure 2

Schematic overview of the duplicated region of BRCA2 exons 22–24. (a) MLPA analysis showing BRCA2 dosage of the proband. Upper histogram: mean relative peak area (RPA) of three references (blue bars) and the proband (green bars) with standard deviations. The amplicon size (bp) of each probe is indicated below. Bottom histogram: differences of RPA between the proband and the references in percentage. The mean RPA of the references was normalized to 100%. Differences higher than 125% are demonstrated by dark blue bars. The location of each probe is marked below. (b) The duplication and its genomic location detected by CnvHunter are depicted in the upper panel. Below the CnvHunter results, the normal exon‐intron structure of BRCA2 (NM_000059.3) and the exon‐intron structure including the tandem duplication (blue) are shown. The Sanger sequencing chromatogram of the breakpoint amplified by the breakpoint‐spanning PCR demonstrates the last nucleotides of intron 24 (gray), a homologous region, where the genomic break occurred (white) and the first nucleotides of intron 21 (blue). Binding sites of forward (5′‐CTCTAGAGTACTGTGAGTGG‐3′ (Chr13(GRCh37):g.32960177–32960196)) and reverse (5′‐GAGACGGAGTTTTGCTCTTG‐3′ (Chr13(GRCh37):g.32951708–32951727)) primer as used for the breakpoint‐spanning PCR are represented by red and green arrows, respectively

Schematic overview of the duplicated region of BRCA2 exons 22–24. (a) MLPA analysis showing BRCA2 dosage of the proband. Upper histogram: mean relative peak area (RPA) of three references (blue bars) and the proband (green bars) with standard deviations. The amplicon size (bp) of each probe is indicated below. Bottom histogram: differences of RPA between the proband and the references in percentage. The mean RPA of the references was normalized to 100%. Differences higher than 125% are demonstrated by dark blue bars. The location of each probe is marked below. (b) The duplication and its genomic location detected by CnvHunter are depicted in the upper panel. Below the CnvHunter results, the normal exon‐intron structure of BRCA2 (NM_000059.3) and the exon‐intron structure including the tandem duplication (blue) are shown. The Sanger sequencing chromatogram of the breakpoint amplified by the breakpoint‐spanning PCR demonstrates the last nucleotides of intron 24 (gray), a homologous region, where the genomic break occurred (white) and the first nucleotides of intron 21 (blue). Binding sites of forward (5′‐CTCTAGAGTACTGTGAGTGG‐3′ (Chr13(GRCh37):g.32960177–32960196)) and reverse (5′‐GAGACGGAGTTTTGCTCTTG‐3′ (Chr13(GRCh37):g.32951708–32951727)) primer as used for the breakpoint‐spanning PCR are represented by red and green arrows, respectively Considering this classification, the patient's sisters (Figure 2; III:3, 5 and 9) were tested for the genomic duplication via Sanger sequencing. All of them were negative for the BRCA2 duplication. Unfortunately, additional family members including the proband's parents did not consent to genetic testing for the duplication. Therefore, it is unknown whether this duplication emerged de novo in the patient. The patient was advised to undergo a risk‐reducing salpingo‐oophorectomy. An earlier discovery of the BRCA2 duplication might have ultimately resulted in the same therapy, but a bilateral mastectomy would have been offered. Here, we demonstrate the rapid and accurate identification of a large genomic rearrangement via a targeted high‐throughput sequencing approach. With this method, we were able to reclassify a variant of unknown significance to a pathogenic variant. This highlights the importance of thorough characterization of LGRs, such as duplications, by the identification of their location and orientation to determine their pathogenicity. This might also require targeting intronic regions, which are mostly excluded in high‐throughput sequencing panels. In this context, targeted enrichment is a powerful and cost‐effective tool for complete coverage of target regions and the characterization of large genomic rearrangements.

CONFLICT OF INTEREST

The authors declare that they have no competing interests.

AUTHOR CONTRIBUTIONS

J.L.v.L., J.B., and S.S. performed the high‐throughput sequencing, analyzed the data, wrote, and revised the manuscript; G.S. analyzed the data and provided scientific advice; W.H. performed the bioinformatics analysis; S.M. contacted the patients; R.B. analyzed the MLPA results; B.A., B.S., and D.S. revised the manuscript; D.S. supervised the work.
  12 in total

1.  Large genomic deletions and duplications in the BRCA1 gene identified by a novel quantitative method.

Authors:  Frans B L Hogervorst; Petra M Nederlof; Johan J P Gille; Cathal J McElgunn; Maartje Grippeling; Roelof Pruntel; Rein Regnerus; Tibor van Welsem; Resie van Spaendonk; Fred H Menko; Irma Kluijt; Charlotte Dommering; Senno Verhoef; Jan P Schouten; Laura J van't Veer; Gerard Pals
Journal:  Cancer Res       Date:  2003-04-01       Impact factor: 12.701

2.  Low rate of TP53 germline mutations in breast cancer/sarcoma families not fulfilling classical criteria for Li-Fraumeni syndrome.

Authors:  D G R Evans; J M Birch; M Thorneycroft; G McGown; F Lalloo; J M Varley
Journal:  J Med Genet       Date:  2002-12       Impact factor: 6.318

3.  Detection of large duplications within the factor VIII gene by MLPA.

Authors:  S Rost; S Löffler; A Pavlova; C R Müller; J Oldenburg
Journal:  J Thromb Haemost       Date:  2008-08-22       Impact factor: 5.824

4.  Large genomic rearrangements of both BRCA2 and BRCA1 are a feature of the inherited breast/ovarian cancer phenotype in selected families.

Authors:  A M Woodward; T A Davis; A G S Silva; J A Kirk; J A Leary
Journal:  J Med Genet       Date:  2005-05       Impact factor: 6.318

5.  Multiplex ligation-dependent probe amplification as first mutation screening for large deletions and duplications in haemophilia.

Authors:  D Belvini; R Salviato; P Radossi; G Tagariello
Journal:  Haemophilia       Date:  2017-02-15       Impact factor: 4.287

Review 6.  Hereditary breast and ovarian cancer: new genes in confined pathways.

Authors:  Finn Cilius Nielsen; Thomas van Overeem Hansen; Claus Storgaard Sørensen
Journal:  Nat Rev Cancer       Date:  2016-08-12       Impact factor: 60.716

7.  Fast Detection of a BRCA2 Large Genomic Duplication by Next Generation Sequencing as a Single Procedure: A Case Report.

Authors:  Marcella Nunziato; Flavio Starnone; Barbara Lombardo; Matilde Pensabene; Caterina Condello; Francesco Verdesca; Chiara Carlomagno; Sabino De Placido; Lucio Pastore; Francesco Salvatore; Valeria D'Argenio
Journal:  Int J Mol Sci       Date:  2017-11-22       Impact factor: 5.923

8.  A Whole Germline BRCA2 Gene Deletion: How to Learn from CNV In Silico Analysis.

Authors:  Giovanni Luca Scaglione; Paola Concolino; Maria De Bonis; Elisa De Paolis; Angelo Minucci; Gabriella Ferrandina; Giovanni Scambia; Ettore Capoluongo
Journal:  Int J Mol Sci       Date:  2018-03-23       Impact factor: 5.923

9.  From a variant of unknown significance to pathogenic: Reclassification of a large novel duplication in BRCA2 by high-throughput sequencing.

Authors:  Jana Lisa van Luttikhuizen; Janin Bublitz; Stephanie Schubert; Gunnar Schmidt; Winfried Hofmann; Susanne Morlot; Reena Buurman; Bernd Auber; Brigitte Schlegelberger; Doris Steinemann
Journal:  Mol Genet Genomic Med       Date:  2019-11-13       Impact factor: 2.183

10.  The rules and impact of nonsense-mediated mRNA decay in human cancers.

Authors:  Rik G H Lindeboom; Fran Supek; Ben Lehner
Journal:  Nat Genet       Date:  2016-09-12       Impact factor: 38.330

View more
  3 in total

1.  From a variant of unknown significance to pathogenic: Reclassification of a large novel duplication in BRCA2 by high-throughput sequencing.

Authors:  Jana Lisa van Luttikhuizen; Janin Bublitz; Stephanie Schubert; Gunnar Schmidt; Winfried Hofmann; Susanne Morlot; Reena Buurman; Bernd Auber; Brigitte Schlegelberger; Doris Steinemann
Journal:  Mol Genet Genomic Med       Date:  2019-11-13       Impact factor: 2.183

2.  Genomic Breakpoints' Characterization of a Large CHEK2 Duplication in an Italian Family with Hereditary Breast Cancer.

Authors:  Aldo Germani; Daniele Guadagnolo; Valentina Salvati; Caterina Micolonghi; Rita Mancini; Gioia Mastromoro; Soha Sadeghi; Simona Petrucci; Antonio Pizzuti; Maria Piane
Journal:  Diagnostics (Basel)       Date:  2022-06-22

Review 3.  Germline Structural Variations in Cancer Predisposition Genes.

Authors:  Tímea Pócza; Vince Kornél Grolmusz; János Papp; Henriett Butz; Attila Patócs; Anikó Bozsik
Journal:  Front Genet       Date:  2021-04-14       Impact factor: 4.599

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.