Literature DB >> 31700827

Screening of 10 DFNB Loci Causing Autosomal Recessive Non-Syndromic Hearing Loss in Two Iranian Populations Negative for GJB2 Mutations.

Mahbobeh Koohiyan1, Somayeh Reiisi2, Fatemeh Azadegan-Dehkordi3, Mansoor Salehi1, Hamidreza Abtahi4, Morteza Hashemzadeh-Chaleshtori3, Mohammad Reza Noori-Daloii5, Mohammad Amin Tabatabaiefar1,6.   

Abstract

BACKGROUND: Autosomal recessive non-syndromic hearing loss (ARNSHL), one of the global public health concerns, is marked by a high degree of genetic heterogeneity. The role of GJB2, as the most common cause of ARNSHL, is only <20% in the Iranian population. Here, we aimed to determine the relative contribution of several apparently most common loci in a cohort of ARNSHL Iranian families that were negative for the GJB2 mutations.
METHODS: Totally, 80 Iranian ARNSHL families with 3 or more affected individuals from Isfahan and Hamedan provinces, Iran were enrolled in 2017. After excluding mutations in the GJB2 gene via Sanger sequencing, 60 negative samples (30 families from each province) were analyzed using homozygosity mapping for 10 ARNSHL loci.
RESULTS: Fourteen families were found to be linked to five different known loci, including DFNB4 (5 families), DFNB2 (3 families), DFNB7/11 (1 family), DFNB9 (2 families) and DFNB3 (3 families).
CONCLUSION: Despite the high heterogeneity of ARNSHL, the genetic causes were determined in 23.5% of the studied families using homozygosity mapping. This data gives an overview of the ARNSHL etiology in the center and west of Iran, used to establish a diagnostic gene panel including most common loci for hearing loss diagnostics. Copyright© Iranian Public Health Association & Tehran University of Medical Sciences.

Entities:  

Keywords:  Autosomal recessive non-syndromic hearing loss (ARNSHL); DFNB loci; Homozygosity mapping; Iran

Year:  2019        PMID: 31700827      PMCID: PMC6825662     

Source DB:  PubMed          Journal:  Iran J Public Health        ISSN: 2251-6085            Impact factor:   1.429


Introduction

Hearing loss (HL) is the most frequent form of sensory impairment in humans, with approximately 1–2 in 1000 infants being born with a serious HL (https://www.gov.uk/guidance/newborn-hearing-screening-programme-overview). Over 70% of prelingual HL cases can be classified as non-syndromic HL (NSHL), where the hearing deficit is the only sign (1). HL can be inherited as autosomal recessive, autosomal dominant, mitochondrial, X- and Y-linked. Autosomal recessive mode of inheritance (ARNSHL) makes up 80% of the NSHL cases. ARNSHL is highly heterogeneous, for which over 100 mapped loci are known. The autosomal recessive loci are called DFNB followed by a number corresponding to the order that the locus was first explained; DFNB1 to DFNB105 have been reported so far (http://hereditaryhearingloss.org). However, more than seventy different DFNB loci have been mapped for ARNSHL by homozygosity mapping, an effective method to locate genes causing ARNSHL in large consanguineous families (2). The genetic etiology of ARNSHL in Iran has been studied by a number of independent studies with a special focus on the certain locus DFNB1 (GJB2), as the most common cause of HL all over the world (3). Variants in the GJB2 (NM_004004.5) could explain the etiology of ARNSHL in 4% to 35% of patients from different origin, suggesting that GJB2 gene mutations account for a part of ARNSHL in Iran. (4, 5). On the other hand, Iran is a large country with many ethnic groups and high rate of the consanguineous marriages (38.6% on average) (6). Thus, mutations in certain loci may be increased within some ethnic groups (7). Therefore, population-specific studies are necessary to identify other common loci and to determine the etiology of ARNSHL based on ethnicity. Until now, little data is available on the contribution of some frequent loci among the Iranian ARNSHL; and have mostly focused on mixed populations from different provinces (8). Mutations in at least 40 genes have been explained to cause ARNSHL in Iran. However, the contribution of their mutations does not appear to occur at the same frequencies across different ethnic groups (9). We applied the homozygosity mapping strategy to identify the relative contribution of 10 DFNB loci to ARNSHL in the studied cohort including 60 ARNSHL families, which were negative for GJB2 mutations, from Isfahan and Hamedan provinces for the first time. This data could be applied to design a cheap and accurate panel for common genes causing ARNSHL in certain regions of Iran and would lead to affordable testing and improved management of HL (10).

Materials and Methods

Families and clinical evaluations

Totally, 60 unrelated consanguineous families with 3 or more hearing impaired patients and negative for GJB2 mutations were recruited from Isfahan and Hamedan provinces in the center and west of Iran in 2017. The Ethics Committee of the Isfahan University of Medical Sciences approved this project. All family members signed informed written consent prior to recruitment. They met the following criteria: 1) confirmation of HL by Pure tone audiometry (PTA) from 250–8000 Hz 2) the autosomal recessive inheritance deduced through pedigree analysis 3) existence of three or more affected members within the pedigree. A complete clinical investigation was performed to exclude environmental exposures and to determine the presence of syndromic findings in each family.

DNA extraction

Genomic DNA was extracted using Prime Prep Genomic DNA Extraction kit from blood (GeNet Bio, Korea) according to the manufacturer’s instruction. Qualitative and quantitative assessment of genomic DNA was checked using 1.2% agarose gel and Nanospec cube biophotometer (Nanolytik®, Dusseldorf, Germany).

SLINK analysis and selection of DFNB loci

Power of the pedigrees for linkage analysis was simulated by calculating SLINK, using FastSLink (ver.2.51) option of Easy linkage plus version 5.05 software to predict the potential LOD score in a given family (11). Based on the literature review of the most frequent loci, both globally and regionally, 10 loci were selected for screening. Screening sort tandem repeat (STR) markers were selected based on their physical distance found at NCBI UniSTS and NCBI Map Viewer (http://www.ncbi.nlm.nih.gov). Primers for STR markers of each locus were mostly obtained through the Probe database (https://www.ncbi.nlm.nih.gov/probe). STR markers of each locus and their primer sequences are listed in Table 1.
Table 1:

The list of 10 DFNB loci screened in this study. The corresponding genes and characteristic of screening markers are shown

locus (gene)STRHeterozygosity (%)Size(bp)Forward primerReverse primer
DFNB7–11 (TMC1)D9S187681132–152GATGTACCCAGAGAAGTCTCGAGTGGTTACCATTTACCCAAG
D9S112476252–276GGTGCCCACCATACACTACTTCTAATCCTTCCTTCCCTCG
D9S30178205–251CATGATGGTGGTCTCTGGGGTGGGGCTCAAAGAGTAG
D9S179991139–178TTGCCAACTATTTTAGCCCTGCAGTTTCAATCCACATC
DFNB3 (MYO15A)D17S95381119–131ACTATCCGCCCAATACAAAGGGCTTGCTTTGAC
D17S184370177–187TGCACAGGCCAATTCCTTACTGCCTAAACTGCTTTCAGGTGAG
D17S62050103–151CTCTTTGTGCTTGGCAGGGTTACATTTAATGCAGGATGCC
D17S219681139–163CCAACATCTAGAATTAATCAGAATCATATTTCAATATTGTAACCAGTCCC
DFNB2 (MYO7A)D11S417972200–256GGATGTAAGAGTAACTGG CTCCGGAAAATGTTCTGCCTGAGGG
D11S418679154–175ATTCTCCCAATCTATCGCTCGGGCAGTAATGATGATGTG
D11S407975217–265CAGCAAGATCCTGTCTCAACTCCTTAAAGTGGGGGAGTT
D11S91185159–203CTTCTCATGCTTGACCATTTCTTCTGAACAATTGCCACAT
DFNB4 (SLC26A4)D7S242081240–290CCTGTATGGAGGGCAAACTAAAATAATGACTGAGGCTCAAAACA
D7S49663129–141AACAACAGTCAACCCACAATGCTATAACCTCATAANAAACCAAAA
D7S245977140–152AAGAAGTGCATTGAGACTCCCCGCCTTAGTAAAACCC
D7S245678238–252CTGGAAATTGACCTGAAACCTTACAGGGGTCTCTCACACATATTA
DFNB9 (OTOF)D2S36585164–204ATGATTTGTGTACCTTATGTATGTTTCAATGGAGGAATCCTACTT
D2S224778130–160TCCATCTTTTGCGTGCCCGTGCTCTATGCCAG
D2S17465203–221AGGCTGAATCCCACCTCCTTAGAGCACACATGGTCACTCC
D2S222363182–200CACTGCGCCTAGCCTCGGCGATTTATGAATAATCCTGC
DFNB21 (TECTA)D11S177460206–226CAAAAAGGCTTGGCGGTTGGGCATTCCCATGCTCA
D11S92585173–195AGAACCAAGGTCGTAAGTCCTGTTAGACCATTATGGGGGCAA
D11S408975199–213TAATCAAAGGCTGTAGTGAATTGGATTCCTAGTTCCCTCATAAACACTG
D11S410770172–212TCATTCTACAAGACTAGCATTACCGCTTGATCATGGTGTATTATCTT
DFNB53 (CO11A2l)D13S123670108–132GCACTTGGCCTGGGTAAAAGGGGCTGGCTCTTCA
D13S17575101–113TATTGGATACTTGAATCTGCTGTGCATCACCTCACATAGGTTA
DFNB59 (PJVK)D2S217370201–243GGAGACAGAGAGTTTACATTTGAGGCCACACTTTCCTGAATC
D2S32485264–275TTACCCACCGGGACAGTCAGCAAATGCTTCTAGGTCA
D11S131478209–227TTGCTACGCACTCCTCTACTGTGAAGGCAGGAAATGTGAC
DFNB63 (LRTOMT)D11S416275263–269GTTCTCCAGAGAGACAGCACGAGAGCAACACTATTGCCC
D11S414072189–199TGCAACAAGGTTCCACACTCTTATGGGTGAGGGCACAG
D11S418460263–277CCCAGCCTTACATATTCCGCTGATGAGCAGAGGTAG
DFNB24 (RDX)11S179385124–140AGTCATGCATCCTCCCTGTAATCCTGAACACATTCCTCAA
D11S139175158–178TGCATGCATACATACATACATACACATCCATCCCTCTGTCTCTG
D11S201770109–133TTTGAATAGGAAATTAGATGGTAGGTTTGAATAGGAAATTAGATGGTAGG
D11S189358206–258TCCCTGGAACCTGGATTGATGTGGGCTTTTTCAA
The list of 10 DFNB loci screened in this study. The corresponding genes and characteristic of screening markers are shown

Genotyping STR markers and Linkage Analysis

PCR of STR markers was conducted according to the standard procedure. The touchdown program was used for markers amplification. Thermal cycling conditions for amplifying markers were in accordance with previous protocols (4). PCR conditions were as follows: 2 μl MgCl2 (4 mM), 2.5 μl Taq PCR buffer (10X), 0.12 μl of each of the primers (10 PM), 0.15 μl Taq DNA polymerase (5U/ul), 0.9 μl dNTP mix (10 mM) and 1.2 μl DNA (about 70 ng). The reaction was adjusted to the volume of 25 ul by ddH2O. Standard cycling was done in a thermocycler (ASTEC PC-818; ASTEC, Fukouka, Japan). STR markers were selected based on their physical distance found at NCBI UniSTS. The criteria for selecting these markers are as follows: greater heterogeneity values, and lying near or at the known loci. At least 4 STR markers were selected for linkage analysis. Table 1 summarizes the general characteristics of the markers used in the study. PCR products were loaded on 12% polyacrylamide gel, followed by silver nitrate staining. Two-point and multipoint parametric LOD scores were calculated using Superlink (ver. 1.6) and GeneHunter (ver. 2.91), respectively. Haplopainter version 029.5 software package was used for reconstruction of haplotypes (12).

Results

Families and clinical data

After excluding mutations in the GJB2 gene, 60 Iranian families segregating (ARNSHL), from Isfahan and Hamedan provinces (30 families from each province) in the center and west of Iran, were screened for 10 ARNSHL loci. Totally, 634 individuals were studied 245 of whom were patients, with ages ranging from 6 months to 52 yr. For 45 families, PTA was consistent with profound HL (≥80 dB), 12 families showed severe HL (61–80 dB), whereas the 3 remaining families showed moderate HL (41–60 dB).

SLINK calculation, genotyping and linkage analysis

Totally, 9 families were of SLINK values ≥3.2, 24 families had SLINK values of 2.5–3.2. The rest of the families presented values 1.8–2.5. Screening loci for homozygosity mapping in this study were composed of: DFNB2 (MYO7A), DFNB3 (MYO15A), DFNB4 (SLC26A4), DFNB7/11(TMC1), DFNB9 (OTOF), DFNB21 (TECTA), DFNB24 (RDX), DFNB59 (PJVK), DFNB63 (LRTOMT) and DFNB53 (COL11A2). The family members were individually genotyped for these markers. After genotyping of STR markers and linkage analysis, 14 out of the 60 families, negative for GJB2 mutations, showed linkage to five different loci (Table 2). DFNB4 was the most frequent locus in the studied ARNSHL series in both provinces (36.9% of the etiology). Three out of 30 (10%) and 2 of 30 (6.6%) families were linked to DFNB4 in Isfahan and Hamedan provinces, respectively. DFNB2, DFNB3, and DFNB9 were ranked next after DFNB4. Table 3 shows the linked families and the maximum values for SLINK, two-point and multipoint LOD scores. One family (3.3%) from every single province was linked to DFNB9. One family from Hamedan Province was linked to DFNB7/11 (7.7% of the etiology). The haplotypes of 3 selected linked families are shown in Fig. 1(a–c).
Table 2:

Genetic etiology of ARNSHL in 60 families negative for GJB2 mutations from Isfahan and Hamedan provinces

NumberLocusGeneNumber of diagnoses% of diagnoses% of cohort
IsfahanHamedanIsfahanHamedanIsfahanHamedan
1DFNB2MYO7A127.215.43.36.6
2DFNB3MYO15A127.215.43.36.6
3DFNB4SLC26A43221.515.4106.6
4DFNB7-11TMC10107.703.3
5DFNB9OTOF117.27.23.33.3
Total6819.926.4
Table 3:

Maximum SLINK and LOD score (two-point and multi-point) values for the linked families

NumberFamily IDSLINK valueLinked locusTwo-point LOD scoreMulti-point LOD scoreSeverity HL
ISF-52.82DFNB41.72.2Severe-profound
2ISF-152.9DFNB42.62.8Moderate-profound
3ISF-63.8DFNB43.13.2Moderate-severe
4IR-143.28DFNB42.42.6Profound
5IR-91.8DFNB42.22.3Severe-profound
6IR-132.53DFNB21.92.3Severe-profound
7IR-302.8DFNB22.32.6Moderate-profound
8ISF-171.9DFNB222.2Profound
9IR-193.4DFNB92.83.9Severe-profound
10ISF-142.8DFNB91.92.3Profound
11IR-32.3DFNB32.12.4Profound
12IR-273.1DFNB32.93.1Profound
13ISF-232.4DFNB32.12.3Severe-profound
14IR-72.1DFNB7-1122.2Severe-profound
Fig. 1:

Pedigree and haplotypes of the 3 Iranian families with ARNSHL, negative for GJB2 mutations, linked to 2 known loci. a) ISF-5 is linked to DFNB4: b) IR-3 is linked to DFNB3 c) IR-14 is linked to DFNB4. Hearing impaired patients show homozygosity for markers. The order of markers is based on the Marshfield map

Pedigree and haplotypes of the 3 Iranian families with ARNSHL, negative for GJB2 mutations, linked to 2 known loci. a) ISF-5 is linked to DFNB4: b) IR-3 is linked to DFNB3 c) IR-14 is linked to DFNB4. Hearing impaired patients show homozygosity for markers. The order of markers is based on the Marshfield map Genetic etiology of ARNSHL in 60 families negative for GJB2 mutations from Isfahan and Hamedan provinces Maximum SLINK and LOD score (two-point and multi-point) values for the linked families We did not find linkage to the other loci (DFNB21, DFNB24, DFNB59, DFNB63 and FNB53) among the studied families.

Discussion

We determined the contribution of 10 DFNB loci to HL in 60 Iranian families affected with ARNSHL and negative for the GJB2 mutations. We have obtained 20% and 26% involvement of GJB2 mutations in ARNSHL in Hamedan and Isfahan provinces, respectively (unpublished data). For the first time, we investigated the role of 10 other loci in the etiology of HL in GJB2 negative families in the west and center of Iran. DFNB4 was found to be the mostly linked locus among the studied families, with 3 out of 30 (10%) and 2 of 30 (6.6%) showing linkage to it in Isfahan and Hamedan provinces, respectively. Mutations in its corresponding gene (i.e. SLC26A4) are the second most common cause of ARNSHL, after GJB2, all over the world (13). About 5% of ARNSHL cases in South Asia have been related to SLC26A4 mutations (14). Variants in this gene can cause both ARNSHL at the DFNB4 locus and Pendred Syndrome (PS), known as one of the most common forms of syndromic HL. PS is correlated to hypothyroidism (goiter) later in life. Present data show no sign of PS in the studied families. Several reports have revealed SLC26A4 mutations in ARNSHL in Iranian populations. In a study, 12 families out of 80 (15%) Iranian families with 2 or more ARNSHL patients were linked to DFNB4 locus (15). In a recent study 12 out of 121 (9.9%) families were linked to DFNB4 (16). Thus, our result shows that DFNB4 contributes mainly to ARNSHL in the west and center of Iran and is ranked second after DFNB1, which is in agreement with previous studies reported from Iran (Table 4). The next most frequently linked locus in our cohort was DFNB2, which accounts for about 6.6% of HL etiology in Hamedan and 3.3% in Isfahan. The related gene MYO7A, encoding myosin VIIA, is an action-based molecular motor converting energy from ATP hydrolysis into mechanical force. It also interacts with actin to participate in the formation of the mechanotransduction complex, which is critical for detecting sound (17).
Table 4:

The overview of DFNB loci frequencies obtained from in the studies on the Iranian ARNSHL patients

LociNumber of casesNumber of affectedFrequency (%)References
DFNB214442.77Babanejad et al.
302154.96Heggen et al.
6035This study
DFNB314485.5Babanejad et al.
302299.6Heggen et al.
6035This study
DFNB4801215Kahrizi et al.
3023712.25Heggen et al.
6058.3This study
DFNB7-1114442.7Babanejad et al.
5412.2Dahaghani et al.
6011.66This study
DFNB914410.69Babanejad et al.
3812.38Mahdieh et al.
6023.3This study
The overview of DFNB loci frequencies obtained from in the studies on the Iranian ARNSHL patients DFNB2-linked families have been reported from Iran (18). 2.8% of DFNB2 involvement in ARNSHL etiology were reported in the studied Iranian cohort (19). Similarly, Sloan-Heggen et al. (20) using a custom targeted genomic enrichment method in a cohort of 302 GJB2-negative Iranian families, found the DFNB2 contribution to be 5%, which is in accordance with our results (Table 4). Our data show that one out of 30 families (3.3%) from Isfahan province and two out of 30 families (6.6%) from Hamedan were linked to DFNB3. The DFNB3 locus was first identified in the village of Indonesia, Bengkala, with a frequency of 9.4% among the inbred population (21). Since then, many mutations have been reported from different countries such as India, Iran, Turkey, and Brazil (22, 23). In Pakistan, DFNB3 is the third locus for ARNSHL accounting for 5% of ARNSHL (24). In a previous study on 40 Iranian ARNSHL families from Qom and Markazi provinces, from center of Iran, 2 families were linked to DFNB3 (5.8%) (25). Therefore, the locus could be one common cause of ARNSHL both in the west and center of Iran. In the present study, one family (3.3%) from every single province was linked to DFNB9 (OTOF). Mutations in the OTOF gene (named as homology to Ferlin (Fer-1)) encoding otoferlin at DFNB9 results in ARNSHL which is sometimes associated with auditory neuropathy. Otoferlin is a member of the ferlin protein family; its role is in vesicle recycling and efficient and linear encoding of low-intensity stimulate the synapse between inner hair cells and auditory nerve fibers (26). OTOF mutations have been reported from many countries such as Pakistan, Spain, Italy, and Japan with different mutation spectrum (26, 27). The frequency of the OTOF gene mutations has been reported to be 2.7% in Iran (28). It was screened 37 Iranian ARNSHL families from 7 different provinces for 15 loci using linkage analysis and found 1 family (2.7%) to be linked to the DFNB9 locus. Similarly, in our present study, one family (3.3%) from each of the two provinces was linked to DFNB9 (OTOF). Our study involves 3 families with moderate to severe HL highlighted by a “U” shaped audiogram. DFNB21 and DFNB93 are related to this audio profile (18, 29). Interestingly, none of the 3 families was linked to DFNB21. Thus, the next step for these families involves investigating the DFNB93 contribution (30). The contribution of DFNB7/11 in Hamedan Province was found to be 3.3% (1/30), in line with the prevalence figures of 4% in Pakistan, and 3.4% in Turkey. The related gene TMC1 (Transmembrane channel-like gene I) is required for postnatal hair cell development. TMC1 might be an ion channel or transporter which mediates K+ homeostasis in the inner ear (31). The TMC1 gene was initially mapped to chromosome 9q13–q21 in two consanguineous Indian families with prelingual, severe-to-profound defining the DFNB7/11 locus (NM_138691.2). In the study on 144 GJB2-negative subjects, using linkage analysis and direct sequencing, 4 out of 144 families (2.7%) were linked to DFNB7-11(19). Moreover, Dehaghani et al. (32), using homozygosity mapping on 45 ARNSHL families, detected 1family (2.2%) to be linked to DFNB7/11. Therefore, the locus could be one common causes of ARNSHL in the west of Iran. The next step of the study involves DNA sequencing of the corresponding genes of the DFNB loci in the linked families to identify the pathogenic mutations. Until now, 4 homozygous mutations have been identified in the related families, including 3 missense and 1 splice site mutations (7, 33). The identified mutations and their characteristics are listed in Table 5. The large size of some of the related genes hinders detection of their related mutations (34). However, the remaining families have been considered for sequencing of the related genes.
Table 5:

The mutations detected in the linked families in this study

NumberFamily IDGeneType of mutationNucleotide changeAmino acid change
1IR-14SLC26A4missensec.416 G>Tp.Gly139Val
2ISF-5SLC26A4Splice sitec.919-2 A>G-
3IR-27MYO15Amissensec.6442 T>Ap.Trp2148Arg
4IR-13MYO7Amissensec.6487 G>Ap.Gly2163Ser
The mutations detected in the linked families in this study In the present study, despite the high heterogeneity of ARNSHL, we could detect the genetic etiology in 6 out of 30 (20%) and 8 out of 30 (26.6%) ARNSHL families, negative for GJB2 mutations, from Isfahan and Hamedan provinces, respectively. Thus, nearly 23.5% of ARNSHL families negative for GJB2 mutations are linked to 5 loci including DFNB4, DFNB2, DFNB3, DFNB9 and DFNB7/11. The remaining genes and loci could be either rare or yet to be identified (2, 28). The study is in progress by subjecting some of the remaining families to the next-generation sequencing, which is a rapid and cost-effect method.

Conclusion

Using homozygosity mapping, we detected 23.5% of the genetic etiology of GJB2- mutation negative ARNSHL in Isfahan and Hamedan provinces. This finding is interesting in view of the extreme genetic heterogeneity of ARNSHL (with over 50 genes discovered so far). Investigation of a limited number of genes could lead to an acceptable level of diagnostic yield.

Ethical considerations

Ethical issues (Including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.
  31 in total

1.  Recurrent and private MYO15A mutations are associated with deafness in the Turkish population.

Authors:  F Basak Cengiz; Duygu Duman; Asli Sirmaci; Suna Tokgöz-Yilmaz; Seyra Erbek; Hatice Oztürkmen-Akay; Armagan Incesulu; Yvonne J K Edwards; Hilal Ozdag; Xue Z Liu; Mustafa Tekin
Journal:  Genet Test Mol Biomarkers       Date:  2010-08

2.  DFNB93, a novel locus for autosomal recessive moderate-to-severe hearing impairment.

Authors:  M A Tabatabaiefar; F Alasti; L Shariati; E Farrokhi; E Fransen; M R Nooridaloii; M H Chaleshtori; G Van Camp
Journal:  Clin Genet       Date:  2011-06       Impact factor: 4.438

3.  Mutations in the OTOF gene in Taiwanese patients with auditory neuropathy.

Authors:  Yu-Hsun Chiu; Chen-Chi Wu; Ying-Chang Lu; Pei-Jer Chen; Wen-Yuan Lee; Alyssa Yan-Zhen Liu; Chuan-Jen Hsu
Journal:  Audiol Neurootol       Date:  2010-03-11       Impact factor: 1.854

Review 4.  Heterogeneity of Hereditary Hearing Loss in Iran: a Comprehensive Review.

Authors:  Maryam Beheshtian; Mojgan Babanejad; Hela Azaiez; Niloofar Bazazzadegan; Diana Kolbe; Christina Sloan-Heggen; Sanaz Arzhangi; Kevin Booth; Marzieh Mohseni; Kathy Frees; Mohammad Hossein Azizi; Ahmad Daneshi; Mohammad Farhadi; Kimia Kahrizi; Richard Jh Smith; Hossein Najmabadi
Journal:  Arch Iran Med       Date:  2016-10-01       Impact factor: 1.354

5.  Epidemiology and mortality of hospitalized burn patients in Kohkiluye va Boyerahmad province (Iran): 2002-2004.

Authors:  Mostafa Saadat
Journal:  Burns       Date:  2005-01-21       Impact factor: 2.744

6.  Mechanotransduction in mouse inner ear hair cells requires transmembrane channel-like genes.

Authors:  Yoshiyuki Kawashima; Gwenaëlle S G Géléoc; Kiyoto Kurima; Valentina Labay; Andrea Lelli; Yukako Asai; Tomoko Makishima; Doris K Wu; Charles C Della Santina; Jeffrey R Holt; Andrew J Griffith
Journal:  J Clin Invest       Date:  2011-11-21       Impact factor: 14.808

7.  Did the GJB2 35delG mutation originate in Iran?

Authors:  Vahideh Norouzi; Hiva Azizi; Zohreh Fattahi; Fatemehsadat Esteghamat; Niloofar Bazazzadegan; Carla Nishimura; Nooshin Nikzat; Khadijeh Jalalvand; Kimia Kahrizi; Richard J H Smith; Hossein Najmabadi
Journal:  Am J Med Genet A       Date:  2011-09-09       Impact factor: 2.802

8.  A large deletion in GPR98 causes type IIC Usher syndrome in male and female members of an Iranian family.

Authors:  N Hilgert; K Kahrizi; N Dieltjens; N Bazazzadegan; H Najmabadi; R J H Smith; G Van Camp
Journal:  J Med Genet       Date:  2009-04       Impact factor: 6.318

9.  Genetic Linkage Analysis of DFNB3, DFNB9 and DFNB21 Loci in GJB2 Negative Families with Autosomal Recessive Non-syndromic Hearing Loss.

Authors:  Marjan Masoudi; Najmeh Ahangari; Ali Akbar Poursadegh Zonouzi; Ahmad Poursadegh Zonouzi; Azim Nejatizadeh
Journal:  Iran J Public Health       Date:  2016-05       Impact factor: 1.429

10.  Mutations in GJB2 as Major Causes of Autosomal Recessive Non-Syndromic Hearing Loss: First Report of c.299-300delAT Mutation in Kurdish Population of Iran.

Authors:  Fatemeh Azadegan-Dehkordi; Tayyebe Bahrami; Maryam Shirzad; Gelareh Karbasi; Nasrin Yazdanpanahi; Effat Farrokhi; Mahbobeh Koohiyan; Mohammad Amin Tabatabaiefar; Morteza Hashemzadeh-Chaleshtori
Journal:  J Audiol Otol       Date:  2018-12-07
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.