Literature DB >> 31682719

The association between IL-17 gene variants and risk of colorectal cancer in a Chinese population: A case-control study.

Haiyang Feng1, Rongbiao Ying2, Tengjiao Chai3, Hailang Chen4, Haixing Ju1.   

Abstract

Interleukin (IL)-17 have been reported to be associated with the pathogenesis of colorectal cancer (CRC). Few studies investigated the association between IL-17 gene polymorphisms and risk of CRC with inconsistent findings. Thus, we recruited 352 CRC cases and 433 controls in a Chinese population and their genotyping was done using polymerase chain reaction-restriction fragment length polymorphism method. Our data showed that IL-17A rs2275913 polymorphism was associated with the increased risk of CRC, while no association was observed for IL-17F rs763780 polymorphism. Stratified analyses revealed that the significant association was also obtained in the females, smokers, drinkers and age ≥ 60 years groups for rs2275913 polymorphism. Moreover, the CC and/or GC genotype of rs2275913 polymorphism were correlated with TNM stage and lymph node metastasis. No association was shown between IL-17F rs763780 polymorphism and clinical characteristics of CRC. In conclusion, our data indicate that IL-17A rs2275913 polymorphism but not IL-17F rs763780 polymorphism contributes to increased risk for CRC patients in this Chinese population.
© 2019 The Author(s).

Entities:  

Keywords:  IL-17; SNPs; case-control study; colorectal cancer

Mesh:

Substances:

Year:  2019        PMID: 31682719      PMCID: PMC6881208          DOI: 10.1042/BSR20190013

Source DB:  PubMed          Journal:  Biosci Rep        ISSN: 0144-8463            Impact factor:   3.840


Introduction

Colorectal cancer (CRC) is the third most common cancer and the fourth most common cause of cancer death [1]. More than 1.2 million patients are diagnosed with CRC annually and more than 600,000 die from this disorder [2]. It is well known that environmental and inherited genetic factors made great contributions to susceptibility to CRC [3]. Genome-wide association studies (GWAS) and meta-analysis using 1000 Genomes for imputation have identified novel risk variants for CRC patients [4]. Two inflammatory cytokines, Interleukin (IL)-17A and IL-23, produced by myeloid cells and different lymphocyte subsets, have been implicated in the pathogenesis of inflammatory associated cancers such as CRC [5]. The up-regulation of IL-17 ad IL-23 was observed in a mouse model of colorectal tumorigenesis [6]. In CRC, elevated expression of IL-17A was associated with adverse prognostic outcome and rapid progression to metastatic disease [7]. Th17-type cytokines (IL-17A, IL-17F, IL-21, IL-22), IL-6 and tumor necrosis factor-α synergistically activate STAT3 and NF-κB to promote CRC growth [8]. Single-nucleotide polymorphism (SNP) in IL-17 gene may influence genomic stability and increase the production of IL-17, thereby conferring susceptibility to CRC [9]. Many studies have investigated the association between IL-17 gene polymorphisms and risk of CRC [9-15], mainly focusing on two polymorphisms (rs2275913, IL-17A; rs763780, IL-17F). However, their findings were conflicting. Furthermore, there is no study to investigate the association between IL-17A rs2275913 polymorphism and risk of CRC in a Chinese population. In addition, only one study [12] has thrown lights on the rs763780 polymorphism for Chinese population. Therefore, we conducted this hospital-based case–control study to evaluate the effects of IL-17A rs2275913 and IL-17F rs763780 polymorphisms on the risk of CRC.

Patients and methods

Subjects

In the present study, 352 CRC patients with newly histopathologically diagnosed CRC and 433 sex- and age-matched controls were recruited from Zhejiang Cancer Hospital, Taizhou Cancer Hospital, Quzhou Kecheng People’s Hospital and Lanxi People’s Hospital from May 2012 to May 2018. No patients had received radiotherapy or chemotherapy prior to surgery. Approximately 58.2% of CRC patients were rectal cancer and were classified according to the American Joint Committee on cancer (AJCC) classification system. The control groups were selected from individuals receiving health examinations at the same period. The individuals with family history of cancer or digestive diseases were excluded. Data on demographic and risk factor information for all subjects were obtained using a self-designed questionnaire, including body mass index (BMI), smoking status, alcohol consumption and family history of cancer. The individuals who smoked at least one cigarette per day at least one year was defined as “smoker”. Individuals were defined as drinkers if they drank alcohol at least once a week for more than 1 year. Subjects with at least one first-degree relative or two second-degree relatives having CRC were defined as having family history of cancer. We obtained clinical information about C-reactive protein (CRP); erythrocyte sedimentation rate (ESR); TNM stage, localization of tumor, tumor size, differentiation, lymph node metastasis and histopathological characteristics from the medical record. The study was approved by the Ethics Committee of the above four hospitals and met the standards of Declaration of Helsinki. Written informed consent was obtained from each subject.

Blood sampling and genotyping

Peripheral blood (2 ml) was taken from all subjects and genomic DNA was extracted from peripheral blood using the TIANamp Blood DNA kit (Tiangen Biotech, Beijing, China) according to manufacturer’s instructions. The quality and concentration of extracted DNA was measured in two OD wavelength 260 and 280 nm using NanoDrop (Thermo Scientific, U.S.A.). SNP genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism method. The primers used for the nucleotide extension reaction were AACAAGTAAGAATGAAAAGAGGACATGGT (forward) and CCCCCAATGAGGTCATAGAAGAATC (reverse) for rs2275913 and ACCAAGGCTGCTCTGTTTCT (forward) and GGTAAGGAGTGGCATTTCTA (reverse) for rs763780 polymorphism. For PCR, 25 μl reaction mixture contained as follows: 2.5 μl of 10× reaction buffer (with 1.5 mM MgCl2), 2 μl of deoxynucleotide triphosphate (dNTP; 2.5 mM), 2 μl of each pair primer, 50 ng DNA template, 1 μl of 0.4U Taq polymerase (Applied Biosystems, Evry, France) and 14.5 μl ddH2O. The cycling program involved preliminary denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 30 s with a final extension at 72°C for 8 min. The digested PCR products were with XagI (Fermentas, Lithuania) for IL-17A rs2275913 polymorphism and NlaIII (BioLabs, England) for IL-17F rs763780 polymorphism overnight at 37°C. The PCR products were analyzed by horizontal electrophoresis on an ethidium bromide-stained agarose gel (2% w/v) and then photographed. About 4% of selected samples were reconfirmed with direct sequencing to ensure the genotyping accuracy.

Statistical analysis

The demographic variables were expressed as means ± standard deviation (continuous variables) and frequencies and percentages (categorical variables) respectively. Differences between means were compared by Student’s t-test or Mann–Whitney U test (where the data were not distributed normally). The chi-square test was used to evaluate the differences in frequency distributions of categorical between cases and controls. The Hardy–Weinberg equilibrium (HWE) was applied to test for deviation between observed and expected frequencies among controls using a goodness-of-fit chi-square test. The SNP-associated disease risk was assessed with logistic regression analysis adjusted for age and sex. P < 0.05 were considered statistically significant. All statistical analyses were conducted using SPSS 22.0 software (SPSS Inc., Chicago, U.S.A.).

Results

Characteristics of the study population

The demographic and medical data of participants are shown in Table 1. The mean age of CRC patients was 62.27 years compared with 62.38 years of control groups, which revealed no statistically difference (P = 0.848). The distribution of sex, smoking, BMI and drinking did not differ significantly. Among the 352 cases, 215 (61.1%) were adenocarcinoma; 123 (34.9%) were squamous cell carcinoma; and 14 (4.0%) were other types of CRC. We have also investigated other clinical information of CRC patients, including histological grade, TNM stage, tumor size and lymph node metastasis.
Table 1

Patient demographics and risk factors in colorectal cancer.

CharacteristicsCase (N = 352)Control (N = 433)P
Age, years62.27 ± 8.1062.38 ± 7.780.848
Sex0.629
  Male69 (19.6%)79 (18.2%)
  Female283 (80.4%)354 (81.8%)
BMI, kg/m225.12 ± 4.0024.84 ± 3.800.306
Smoking0.361
  Yes192 (54.5%)222 (51.3%)
  No160 (45.5%)211 (48.7%)
Alcohol0.774
  Yes206 (58.5%)249 (57.5%)
  No146 (41.5%)184 (42.5%)
CRP, mg/l7.73 ± 17.38
ESR, mm/h10.85 ± 12.00
Family history
  Yes47 (13.4%)
  No305 (86.6%)
Histological grade
  Well differentiated34 (9.7%)
  Moderately differentiated275 (78.1%)
  Poorly differentiated43 (12.2%)
TNM stage
  I+II192 (54.5%)
  III+IV160 (45.5%)
Tumor size
  >5 cm202 (57.4%)
  ≤5 cm150 (42.6%)
Lymph node metastasis
  No230 (65.3%)
  Yes122 (34.7%)
Histology
  Adenocarcinoma338 (96.0%)
  Squamous cell carcinoma10 (2.8%)
Others4 (1.2%)

BMI, body mass index; CRP, C-reactive protein; ESR, erythrocyte sedimentation rate; TNM, tumor node metastasis.

BMI, body mass index; CRP, C-reactive protein; ESR, erythrocyte sedimentation rate; TNM, tumor node metastasis.

IL-17 gene polymorphisms analysis

The product lengths (bp) of different genotypes were as following: AA: 102bp, AG: 102 bp + 68bp + 34bp, GG: 68bp + 34bp (IL-17A rs2275913 polymorphism); TT: 63bp + 80bp, CT: 143bp + 80bp + 63bp, CC: 143bp (IL-17F rs763780 polymorphism). Table 2 shows the genotype and allele distributions for IL-17 gene polymorphisms in the CRC patients and controls. The observed genotype frequencies for the two polymorphisms (rs2275913 and rs763780) in the controls did not departure from HWE. For rs2275913 polymorphism, A allele was related to increased risk for CRC (AA vs GG: OR, 1.31; 95% CI, 1.06–1.64; P = 0.014); the AA genotype (not GA genotype) had a significantly elevated risk for CRC compared to GG genotype (AA vs GG: OR, 1.72; 95% CI, 1.02–2.88; P = 0.041). Similarly, AA+GA genotype or A allele was associated with the increased risk for CRC. Further, rs2275913 polymorphism was significant in homozygous, dominant and allelic models after adjusting for sex and age. However, no significant associations with the CRC risk was demonstrated for rs763780 polymorphism before and after adjusting for sex and age.
Table 2

Genotype frequencies of IL-17 gene polymorphisms in cases and controls

ModelsGenotypeCase (n, %)Control (n, %)OR (95% CI)P-value*OR (95% CI)*P-value
rs2275913
GG160 (45.6%)231 (53.6%)1.00 (reference)
HeterozygousGA154 (43.9%)169 (39.2%)1.31 (0.98–1.76)0.0751.32 (0.98–1.77)0.071
HomozygousAA37 (10.5%)31 (7.2%)1.72 (1.02–2.88)0.0411.73 (1.03–2.91)0.039
DominantGG160 (45.6%)231 (53.6%)1.00 (reference)
AA+GA191 (54.4%)200 (46.4%)1.37 (1.04–1.82)0.0281.38 (1.04–1.83)0.026
RecessiveGA+GG314 (89.5%)400 (92.8%)1.00 (reference)
AA37 (10.5%)31 (7.2%)1.52 (0.92–2.50)0.1021.53 (0.93–2.52)0.098
AlleleG474 (67.5%)631 (73.2%)1.00 (reference)
A228 (32.5%)231 (26.8%)1.31 (1.06–1.64)0.014
rs763780
TT241 (68.7%)284 (65.7%)1.00 (reference)
HeterozygousTC100 (28.5%)132 (30.6%)0.89 (0.65–1.22)0.4620.89 (0.65–1.21)0.459
HomozygousCC10 (2.8%)16 (3.7%)0.73 (0.33–1.65)0.4530.72 (0.32–1.63)0.434
DominantTT241 (68.7%)284 (65.7%)1.00 (reference)
CC+TC110 (31.3%)148 (34.3%)0.87 (0.65–1.18)0.3750.87 (0.65–1.18)0.369
RecessiveTC+TT341 (97.2%)416 (96.3%)1.00 (reference)
CC10 (2.8%)16 (3.7%)0.76 (0.34–1.70)0.5040.75 (0.34–1.58)0.485
AlleleT582 (82.9%)700 (81.0%)1.00 (reference)
C120 (17.1%)164 (19.0%)0.88 (0.68–1.14)0.335

The genotyping was successful in 351 cases and 431 controls for rs2275913; The genotyping was successful in 351 cases and 432 controls for rs763780; Bold values are statistically significant (P < 0.05).

Adjust for age and sex.

The genotyping was successful in 351 cases and 431 controls for rs2275913; The genotyping was successful in 351 cases and 432 controls for rs763780; Bold values are statistically significant (P < 0.05). Adjust for age and sex. Stratified analyses were conducted according to sex, age, smoking, alcohol and BMI (Table 3). For rs2275913, a significantly increased CRC risk with the AA genotype was found among smokers (AA vs. GG, OR 2.38; 95% CI, 1.19–4.76; P = 0.014) and non-drinkers (AA vs. GG, OR 4.22; 95% CI, 1.72–9.82; P < 0.001). The increased effect also appeared stronger in the subgroup of age ≥ 60 years (AA vs. GG, OR 2.44; 95% CI, 1.29–4.60; P = 0.006) and females (GA vs. GG, OR 1.42; 95% CI, 1.02–1.98; P = 0.037). No significant findings were obtained in the analysis of rs2275913 polymorphism and BMI. However, stratified analyses by sex, age, smoking and drinking indicated that the allele or genotype frequencies of rs763780 polymorphism did not differ significantly between the cases and controls. Next, we investigated the association between these two SNPs and clinicopathologic features of CRC patients (Table 4). The AA genotype of rs2275913 polymorphism is more frequent in patients with TNM stage III+IV and in patients with lymph node metastasis. This indicated that IL-17 rs2275913 polymorphism was correlated with TNM stage and lymph node metastasis (P = 0.043 and 0.026, respectively). We observed no evidence of association between rs763780 polymorphism and other clinical characteristics such as CRP, ESR, histological grade, TNM stage, tumor size, lymph node metastasis, family history and histology.
Table 3

Stratified analyses between rs2275913 polymorphisms and the risk of colorectal cancer

Variable(Case/Control)Heterozygous modelHomozygous modelRecessive modelDominant model
rs2275913GGGAAAGA vs GGAA vs GGAA vs GG+GAAA+GA vs GG
Sex
  Male38/4623/308/30.93 (0.46–1.86); 0.8333.23 (0.80–13.02); 0.1003.32 (0.85–13.06); 0.0861.14 (0.59–2.18); 0.699
  Female122/185131/13929/281.42 (1.02–1.98); 0.0371.56 (0.89–2.76); 0.1241.32 (0.77–2.28); 0.3151.45 (1.05–1.98); 0.022
Smoking
  Yes86/11879/8826/151.23 (0.82–1.86); 0.3212.38 (1.19–4.76); 0.0142.16 (1.11–4.22); 0.0231.40 (0.95–2.06); 0.091
  No74/11375/8111/161.40 (0.91–2.15); 0.1241.04 (0.46–2.37); 0.9250.89 (0.40–1.98); 0.7761.34 (0.89–2.03); 0.163
Alcohol
  Yes102/12687/10016/221.07 (0.72–1.57); 0.7470.89 (0.45–1.79); 0.7460.87 (0.44–1.70); 0.6751.04 (0.71–1.50); 0.857
  No58/10567/6921/91.76 (1.11–2.80); 0.0174.22 (1.72–9.82); <0.0013.24 (1.44–7.33); 0.0052.04 (1.31–3.18); 0.002
Age (years)
  <6058/8166/647/131.44 (0.89–2.33); 0.1380.75 (0.28–2.00); 0.5680.63 (0.24–1.63); 0.3401.32 (0.83–2.11); 0.237
  ≥60102/15088/10530/181.23 (0.84–1.79); 0.2952.44 (1.29–4.60); 0.0062.23 (1.21–4.12); 0.0111.40 (0.98–2.00); 0.064
BMI
  <2578/12675/8817/161.37 (0.90–2.08); 0.1441.70 (0.81–3.57); 0.1581.48 (0.73–3.02); 0.2821.42 (0.95–2.11); 0.086
  ≥2582/10579/8120/151.25 (0.82–1.91); 0.3041.71 (0.82–3.54); 0.1501.54 (0.76–3.11); 0.2281.32 (0.88–1.98); 0.176

BMI, body mass index.

Bold values are statistically significant (P <0.05).

Table 4

The stratified analysis between rs2275913/rs763780 polymorphisms and clinical characteristics of CRC patients

CharacteristicsGenotype distributions
rs2275913GGGAAAGA+AA
Histological grade
  MD/WD130/16117/1527/3144/18
  OR (95%CI); P-value1.0 (reference)0.96 (0.46–2.03); 0.9151.11 (0.30–4.07); 0.8770.99 (0.48–2.01); 0.966
Histological grade
  PD/WD14/1622/157/329/18
  OR (95%CI); P-value1.0 (reference)1.68 (0.63–4.43); 0.2962.67 (0.58–12.33); 0.2011.84 (0.73–4.66); 0.195
TNM stage
  III+IV/I+II70/9086/6823/14109/82
  OR (95%CI); P-value1.0 (reference)1.63 (1.04–2.54); 0.0322.11 (1.01–4.40); 0.0431.71 (1.12–2.61); 0.013
Tumor size
  >5 cm/≤5 cm99/6182/7221/16103/88
  OR (95%CI); P-value1.0 (reference)0.70 (0.45–1.10); 0.1220.81 (0.39–1.67); 0.5650.72 (0.47–1.11); 0.133
Lymph node metastasis
  Yes/No63/9780/7422/15102/89
  OR (95%CI); P-value1.0 (reference)1.67 (1.06–2.61); 0.0252.26 (1.09–4.68); 0.0261.77 (1.15–2.70); 0.009
Family history
  Yes/No24/13617/1376/3123/168
  OR (95%CI); P-value1.0 (reference)0.70 (0.36–1.37); 0.2981.10 (0.41–2.91); 0.8530.78 (0.42–1.44); 0.418
Histology
  Adenocarcinoma/Not155/5149/533/4182/9
  OR (95%CI); P-value1.0 (reference)0.96 (0.27–3.39); 0.9510.27 (0.07–1.05); 0.0580.65 (0.21–1.99); 0.452
ESR
  ≥10/<1063/9768/8617/2085/106
  OR (95%CI); P-value1.0 (reference)1.22 (0.78–1.91); 0.3911.31 (0.64–2.69); 0.4641.24 (0.81–1.89); 0.333
CRP
  ≥25/<2513/1479/1457/3016/175
  OR (95%CI); P-value1.0 (reference)0.70 (0.29–1.69); 0.4312.64 (0.97–7.17); 0.0571.03 (0.48–2.22); 0.932

Bold values are statistically significant (P < 0.05). PD, poorly differentiation, MD, moderately differentiation, WD, well differentiation; TNM, tumor node metastasis.

BMI, body mass index. Bold values are statistically significant (P <0.05). Bold values are statistically significant (P < 0.05). PD, poorly differentiation, MD, moderately differentiation, WD, well differentiation; TNM, tumor node metastasis.

Discussion

In the present study, we found that IL-17A rs2275913 polymorphism was associated with the increased risk for CRC in a Chinese population. However, no association was observed for the IL-17F rs763780 polymorphism. Additionally, rs2275913 polymorphism showed significant correlation with TNM stage and lymph node metastasis in CRC patients. Recently, several studies investigated the association between IL-17A rs2275913 polymorphism and risk of CRC [9,11,13-15]. Omrane et al. firstly conducted a population-based study to explore the association of rs2275913 polymorphism with CRC risk in a Tunisian population involving 102 CRC patients and 139 controls [11]. They found that IL-17A rs2275913 polymorphism conferred susceptibility to CRC and was associated with tumor location and tumor differentiation [11]. However, no significant association with CRC risk was observed for rs2275913 polymorphism in another Tunisian study conducted by Bedoui et al. [15]. Additionally, two Caucasian studies also investigated the effect of this SNP on the risk of CRC [9,13]. Nemati et al. revealed that AG genotype showed a significantly elevated risk for CRC compared to GG genotype in the Iranian population [13]. This significant association was also observed in the Saudi population [9]. However, no study has explored this SNP in the Chinese population. In this study, we observed that IL-17A rs2275913 polymorphism increased the risk of CRC under the additive, dominant and allelic models. The significant association observed in the whole population was also shown in the female, smoker, drinker and individuals with age ≥ 60 years groups. According to the dbSNP database, rs2275913 polymorphism was located in the promoter region of IL-17A gene. We hypothesized that IL-17A rs2275913 polymorphism conferred susceptibility to CRC by altering the IL-17 expression. In addition, IL-17A rs2275913 polymorphism was related to TNM stage III+IV and lymph node metastasis. IL-17F rs763780 polymorphism was also investigated in several studies [9,10,12-14]. Three studies failed to find allele or genotype association with CRC susceptibility [9,10,14]. However, Ma et al. found that CC genotype or C allele was associated with the increased risk of CRC in a Chinese population [12]. Significant associations with the CRC risk were also demonstrated in an Iranian population [13]. In the present study, there was no significant association for this SNP in the overall analysis and in the stratified analyses of sex, age and smoking. Obviously, the findings of this study were consistent with most previous studies [9,10,14]. The rs763780 polymorphism is a missense mutation (His > Arg) when the nucleotide changes from T to C. Key amino acid changes may affect the three-dimensional structure of the protein, which in turn leads to changes in protein function. DbSNP database indicated that this mutation was benign. This may be the reason why we failed to obtain the positive results. Several limitations of the present study need to be addressed. First, the sample size was not large, thus we could not rule out the possibility of false-positive results. Second, environmental factors might have affected the final results, including occupation and educational level. Third, we did not follow up on CRC patients, limiting our further analysis. Fourth, the controls from the hospital may not fully represent the entire population. In conclusion, IL-17A rs2275913 polymorphism is associated with increased risk for CRC in a Chinese population. Furthermore, this SNP was associated with higher TNM stage and regional lymph node metastasis. However, no positive findings were obtained for IL-17F rs763780 polymorphism. Further studies in other studies with larger sample sizes, as well as functional evaluation of studied SNPs, are warranted to further validate these findings.
  14 in total

Review 1.  Role of IL-17 and IL-22 in autoimmunity and cancer.

Authors:  S J Blake; M W L Teng
Journal:  Actas Dermosifiliogr       Date:  2014-10

2.  Significant association between IL23R and IL17F polymorphisms and clinical features of colorectal cancer.

Authors:  Inés Omrane; Olfa Baroudi; Karim Bougatef; Amel Mezlini; Ahmed Abidi; Imen Medimegh; Nejla Stambouli; Hager Ayari; Nadia Kourda; Nancy Uhrhammer; Yves Jean Bignon; Amel Benammar Elgaaied; Raja Marrakchi
Journal:  Immunol Lett       Date:  2014-01-14       Impact factor: 3.685

3.  Correlation of IL-1F genetic polymorphisms with the risk of colorectal cancer among Chinese populations.

Authors:  Ming Ma; Guo-Jiang Jin; Ke Yun; Run-Qing Mu; Min Zhao; Xiao-Ou Yu; Shuo Wang; Hong Shang
Journal:  Tumour Biol       Date:  2014-10-09

4.  Environmental and heritable factors in the causation of cancer--analyses of cohorts of twins from Sweden, Denmark, and Finland.

Authors:  P Lichtenstein; N V Holm; P K Verkasalo; A Iliadou; J Kaprio; M Koskenvuo; E Pukkala; A Skytthe; K Hemminki
Journal:  N Engl J Med       Date:  2000-07-13       Impact factor: 91.245

5.  Adenoma-linked barrier defects and microbial products drive IL-23/IL-17-mediated tumour growth.

Authors:  Sergei I Grivennikov; Kepeng Wang; Daniel Mucida; C Andrew Stewart; Bernd Schnabl; Dominik Jauch; Koji Taniguchi; Guann-Yi Yu; Christoph H Osterreicher; Kenneth E Hung; Christian Datz; Ying Feng; Eric R Fearon; Mohamed Oukka; Lino Tessarollo; Vincenzo Coppola; Felix Yarovinsky; Hilde Cheroutre; Lars Eckmann; Giorgio Trinchieri; Michael Karin
Journal:  Nature       Date:  2012-11-08       Impact factor: 49.962

Review 6.  The IL-23 to IL-17 cascade inflammation-related cancers.

Authors:  Kepeng Wang; Michael Karin
Journal:  Clin Exp Rheumatol       Date:  2015-10-12       Impact factor: 4.473

Review 7.  Colorectal cancer.

Authors:  Hermann Brenner; Matthias Kloor; Christian Peter Pox
Journal:  Lancet       Date:  2013-11-11       Impact factor: 79.321

8.  Involvement of IL17A, IL17F and IL23R Polymorphisms in Colorectal Cancer Therapy.

Authors:  Inés Omrane; Imen Medimegh; Olfa Baroudi; Hager Ayari; Walid Bedhiafi; Nejla Stambouli; Marwa Ferchichi; Nadia Kourda; Yves-Jean Bignon; Nancy Uhrhammer; Amel Mezlini; Karim Bougatef; Amel Benammar-Elgaaied
Journal:  PLoS One       Date:  2015-06-17       Impact factor: 3.240

9.  IL-17 and colorectal cancer risk in the Middle East: gene polymorphisms and expression.

Authors:  Omar A Al Obeed; Mansoor-Ali Vaali-Mohamed; Khayal A Alkhayal; Thamer A Bin Traiki; Ahmad M Zubaidi; Maha Arafah; Robert A Harris; Zahid Khan; Maha-Hamadien Abdulla
Journal:  Cancer Manag Res       Date:  2018-09-05       Impact factor: 3.989

10.  Th17-type cytokines, IL-6 and TNF-α synergistically activate STAT3 and NF-kB to promote colorectal cancer cell growth.

Authors:  V De Simone; E Franzè; G Ronchetti; A Colantoni; M C Fantini; D Di Fusco; G S Sica; P Sileri; T T MacDonald; F Pallone; G Monteleone; C Stolfi
Journal:  Oncogene       Date:  2014-09-01       Impact factor: 9.867

View more
  3 in total

1.  The IL-17A rs2275913 polymorphism is associated with colorectal cancer risk.

Authors:  Shulong Zhang; Xiaoting Wang
Journal:  J Int Med Res       Date:  2020-12       Impact factor: 1.671

2.  Variable roles of interleukin-17F in different cancers.

Authors:  Tiina Mikkola; Rabeia Almahmoudi; Tuula Salo; Ahmed Al-Samadi
Journal:  BMC Cancer       Date:  2022-01-11       Impact factor: 4.430

3.  The associations between interleukin-17 single-nucleotide polymorphism and colorectal cancer susceptibility: a systematic review and meta-analysis.

Authors:  Gaoming Li; Jingfu Ma; Ning Zhang; Xiaogang Li; Fangfang Li; Yuxing Jiang
Journal:  World J Surg Oncol       Date:  2022-04-12       Impact factor: 2.754

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.