Literature DB >> 31660874

Exploring Leishmania infantum cathepsin as a new molecular marker for phylogenetic relationships and visceral leishmaniasis diagnosis.

Ryan Emiliano da Silva1, Bruna Matarucco Sampaio1, Renata Tonhosolo2, Andrea Perei Ra da Costa3, Luiz Eduardo da Silva Costa1, Fernanda Ap Nieri-Bastos1, Márcia Aparecida Sperança3,4, Arlei Marcili5,6.   

Abstract

BACKGROUND: Leishmania infantum, the etiological agent of visceral leishmaniasis, is a neglected zoonosis that requires validation and standardization of satisfactory diagnostic methodologies. Thus, the aim of the present study was to evaluate the effectiveness of cathepsin L-like protease as a target for making molecular diagnoses and as a phylogenetic marker enabling to understand the intraspecies variations and evolutionary history of L. infantum in Brazil.
METHODS: We used 44 isolates of L. infantum. The cathepsin L-like gene fragments were amplified, sequenced, manually aligned and analyzed using inference methods. The sequences generated were used to search and design oligonucleotide primers to be used in reactions specific to the target parasite.
RESULTS: The cathepsin L-like gene did not show any intraspecies variability among the isolates analyzed. The pair of primers proposed amplified the target deoxyribonucleic acid (DNA) of L. infantum isolates and were effective for DNA amplification at concentrations of as low as 10- 11 ng/μl. The proposed marker did not present cross-reactions with other hemoparasites. When used for making the diagnosis in a panel of clinical samples from dogs, a positivity rate of 49.03% (102/208) was obtained, versus 14.42% (30/208) for a ribosomal internal transcribed spacer (ITS) marker. In samples from sandflies, the rate was 6.25% and from humans, 14.28%.
CONCLUSIONS: The results described in this work allow us to infer that CatLeish-PCR is a sensitive and specific marker for use in diagnostic trials of L. infantum and in clinical and epidemiological surveys.

Entities:  

Keywords:  Cathepsin L-like; Cysteine proteases; Leishmania (Leishmania) infantum; Molecular diagnosis

Year:  2019        PMID: 31660874      PMCID: PMC6819481          DOI: 10.1186/s12879-019-4463-8

Source DB:  PubMed          Journal:  BMC Infect Dis        ISSN: 1471-2334            Impact factor:   3.090


Background

Leishmania (Leishmania) infantum is a flagellate protozoon with a heterogenic cycle that belongs to the genus Leishmania, which is in the family Trypanosomatidae of the order Kinetoplastida [1]. This parasite is the etiological agent for visceral leishmaniasis, a zoonosis with worldwide distribution. Most of the cases are concentrated in Bangladesh, Nepal, India, South Sudan and Brazil. The development of this parasite comprises two morphological forms, whose main differences are the position of the kinetoplast in relation to the nucleus and the presence of a free flagellum associated with the undulating membrane [2, 3]. The promastigote form is found in arthropod vectors, represented by insects of the phlebotomine group [4], while amastigote forms are found inside cells of the mononuclear phagocytic system of vertebrate hosts such as rodents, marsupials, bats, canids and humans [5, 6]. The severity of the disease is explained by the high virulence of its etiological agents, which results from the action of a set of functional molecules with intense biological activity in their hosts. The role of protease inhibitors in the development of pathogenic mechanisms was investigated [7]. These enzymes can be divided into endopeptidases and exopeptidases, depending on the site of hydrolysis. If the residue present at the catalytic site is taken into account, they are divided into metalloproteases, serine proteases, aspartic proteases and cysteine proteases [8]. In the genus Leishmania, cysteine proteases are the most abundant class of enzymes and are concentrated inside megasomes, where they act towards regulation of metabolic routes, cell differentiation in vertebrates and vectors, cell invasion and transposition of tissue barriers, degradation of hemoglobin and other hematopoietic proteins, evasion of the immune response, activation of inflammatory responses and programmed cell death [9]. Cathepsin L-like cysteine proteases in Leishmania have three isoforms, named cysteine protease A (CPA), cysteine protease B (CPB) and cysteine protease C (CPC). These are biochemically organized into four domains (predomain, prodomain, catalytic domain, C-terminal extension) that result from expression of a multigenic family arranged in tandem. In the specific case of L. infantum, two isoforms are expressed, the CPB isoform expressed in the promastigote forms found in the insect vectors and the CPA isoform, in which transcriptomic studies revealed a unique expression profile of the amastigote forms [10]. They are, therefore, used to construct phylogenetic inferences of close sequences and to resolve problems regarding polytomy and inferences of low support [11, 12]. Cathepsin genes have already been used for understanding phylogenetic relationships and as a target for making molecular diagnoses regarding other trypanosomatid species [13-15]. However, there are no studies that characterize this gene in L. infantum or that investigate it as a possible diagnostic marker that might help to solve recurrent problems regarding diagnostic investigation of this parasite within the clinical routine and in epidemiological investigations. Despite the high importance of this disease, there is some difficulty in standardizing diagnostic methodologies with high predictive values for reservoir surveys. Making a direct diagnosis is invasive and laborious, and only low levels of sensitivity are reached [16-18]. The serological tests also have a series of technical limitations, such as low specificity values resulting from cross-reactions with other trypanosomatids, low concordance indices between different serological tests and lack of consensus regarding the nature and use of the antigenic product to be employed [19-22]. Thus, the objective of this study was to evaluate the CPA isoform of cathepsin L-like sequences as a marker for genetic analysis on intraspecific variability of L. infantum and as a marker for making molecular diagnoses on visceral leishmaniasis.

Methods

Leishmania isolates, DNA preparation, amplification and sequencing of cathepsin L-like gene

DNA from 44 Leishmania isolates (Table 1) was extracted from culture supernatants using the phenol-chloroform method and from primary samples (human blood, urine, conjunctival swabs from dogs and sandfly material) in accordance with the protocol established for the Purelink kit (Thermo Fisher Scientific Inc., 2012, USA).
Table 1

Leishmania infantum isolates, host, geographical origin and sequences of Cathepsin L-like employed in the phylogenetic analysis performed in this study

CBTaHostGeographical originAccession numberb
01 Canis familiaris SPMH427793
12 Canis familiaris RecreioRJMH427794
13 Canis familiaris MangaratibaRJMH427795
14 Canis familiaris Ilha GrandeRJMH427796
15 Canis familiaris Barra da TijucaRJMH427797
16 Canis familiaris RecreioRJMH427798
17 Canis familiaris CuiabáMTMH427799
18 Canis familiaris Ilha de GuaratibaRJMH427800
20 Canis familiaris CuiabáMTMH427801
22 Canis familiaris CaucaiaCEMH427802
23 Canis familiaris FortalezaCEMH427803
24 Canis familiaris JequiéBAMH427804
25 Canis familiaris Campo GrandeMSMH427805
26 Canis familiaris DFMH427806
27 Cerdocyon thous PAMH427807
28 Canis familiaris TeresinaPIMH427808
29 Canis familiaris TeresinaPIMH427809
30 Canis familiaris UruguaianaRSMH427810
31 Canis familiaris UruguaianaRSMH427811
34 Canis familiaris PetrolinaPEMH427812
37 Canis familiaris PetrolinaPEMH427813
39 Canis familiaris SantarémPAMH427814
40 Canis familiaris SantarémPAMH427815
43 Canis familiaris SantarémPAMH427816
44 Canis familiaris SantarémPAMH427817
49 Canis familiaris Campo GrandeMSMH427818
50 Canis familiaris Campo GrandeMSMH427819
54 Canis familiaris TeresinaPIMH427820
55 Canis familiaris TeresinaPIMH427821
56 Canis familiaris Campo GrandeMSMH427822
57 Canis familiaris Campo GrandeMSMH427823
62 Canis familiaris PetrolinaPEMH427824
96 Canis familiaris CaxiasMAMH427825
105 Canis familiaris NatalRNMH427826
106 Canis familiaris NatalRNMH427827
107 Canis familiaris NatalRNMH427828
108 Canis familiaris NatalRNMH427829
124 Canis familiaris NatalRNMH427830
125 Canis familiaris NatalRNMH427831
126 Canis familiaris NatalRNMH427832
153 Canis familiaris São DomingosMAMH427833
179 Canis familiaris PatosPBMH427834
211 Homo sapiens MaríliaSPMH427835
212 Homo sapiens MaríliaSPMH427836

Brazilian states: BA, Bahia; CE, Ceará; DF, Distrito Federal; MA, Maranhão; MS, Mato Grosso do Sul; MT, Mato Grosso; PA, Pará; PB, Paraíba; PE, Pernambuco; PI, Piauí; RJ, Rio de Janeiro; RN, Rio Grande do Norte; RS, Rio Grande do Sul; SP, São Paulo

aColeção Brasileira de Tripanossomatídeos

bGenBank acession number

Leishmania infantum isolates, host, geographical origin and sequences of Cathepsin L-like employed in the phylogenetic analysis performed in this study Brazilian states: BA, Bahia; CE, Ceará; DF, Distrito Federal; MA, Maranhão; MS, Mato Grosso do Sul; MT, Mato Grosso; PA, Pará; PB, Paraíba; PE, Pernambuco; PI, Piauí; RJ, Rio de Janeiro; RN, Rio Grande do Norte; RS, Rio Grande do Sul; SP, São Paulo aColeção Brasileira de Tripanossomatídeos bGenBank acession number First of all, the extracted DNA samples were quantified and submitted to conventional polymerase chain reactions (PCR) using the specific primers to Mammalian Cytochrome B as a constitutive gene, to ensure the quality of the samples [23]. After this quality control, the DNA samples were submitted to the PCR reactions using high-fidelity Taq DNA polymerase with the specific primers designated for Cathepsin L-like CPA from Leishmania [24] which comprised a fragment of around 893 base pairs (bp). All the isolates were included in the Brazilian Trypanosomatid Collection (Coleção Brasileira de Tripanossomatídeos, CBT) of the School of Veterinary Medicine of the University of São Paulo, Brazil.

Phylogenetic analysis

The sequences obtained were aligned with sequences retrieved from GenBank using ClustalX [25] and were adjusted manually using GeneDoc [26] and then deposited in GenBank (Table 1). The cathepsin L-like CPA sequences were used to construct a phylogenetic tree using maximum parsimony, as implemented in PAUP version 4.0b10 [27] with 500 bootstrap replicates. Bayesian analysis was performed using MrBayes v3.1.2 [28] with 1,000,000 replicates. The first 25% of the trees represented burn-in, and the remaining trees were used to calculate Bayesian posterior probability.

Standardization of L. infantum-specific assay based on cathepsin L-like protease

The aligned cathepsin L-like CPA gene sequences were used to search for consensus regions and to design specific primers for diagnosing L. infantum. The criteria used to define the primer pair were the guanine-to-cytosine ratio, formation of guanidine/cytosine (GC) staples, formation of self-homologies, self-dimer formation measured using the ΔG value, melting temperature and in silico specificity of the primers through BLASTn. A specific PCR procedure (designated CatLeish-PCR) was developed for amplification of 223 bp of genomic DNA from L. infantum, using the CatLeishF primer (5′ GACAACGGCACCGTCGGCGCCAAAATAAAAG 3′) and CatLeishR primer (5′ CAGTACGGCGGTTTCGCTTGTCTGTTGAAGC 3′) (Fig. 1). The standard conditions for amplification of the cathepsin L-like CPA sequences comprised 34 cycles of denaturation at 94 °C for 1 min, annealing at 64 °C for 1 min and extension at 72 °C for 45 s.
Fig. 1

Alignment of cathepsin L-like CPA sequences from Leishmania infantum. Schematic representation of primers used for PCR amplification

Alignment of cathepsin L-like CPA sequences from Leishmania infantum. Schematic representation of primers used for PCR amplification

Sensitivity and specificity assay on CatLeish-PCR

For sensitivity tests, DNA from L. infantum was serially diluted at the concentrations of 1 × 10− 7, 1 × 10− 8, 1 × 10− 9, 1 × 10− 10, 1 × 10− 11, 1 × 10− 12, 1 × 10− 13, 1 × 10− 14 and 1 × 10− 15 ng/μl. Specificity tests were performed on DNA samples from other parasite species in the genus Leishmania, including: Leishmania (Viannia) braziliensis, Leishmania (Viannia) guyanensis, Leishmania (Viannia) naiffi, Leishmania (Leishmania) amazonensis, Leishmania (Leishmania) mexicana, Leishmania (Sauroleishmania) gymnodactyli, Leishmania (Sauroleishmania) adleri, Leishmania (Sauroleishmania) tarentolae and Leishmania (Mundinia) enriettii. In addition, the following species in the genus Trypanosoma were tested: Trypanosoma dionisii, Trypanosoma terrestris, Trypanosoma cruzi, Trypanosoma cruzi marinkellei, Trypanosoma theileri and Trypanosoma gennarii; along with two other pathogenic species that are common in dogs: Babesia canis and Ehrlichia canis.

Application of CatLeish-PCR to clinical samples

CatLeish-PCR was tested on a panel of clinical samples of purified DNA obtained from dogs in endemic and non-endemic regions in São Paulo state, Brazil. In addition, blood samples (prepared on filter paper), conjunctival swabs and urine samples from dogs that were known to be positive in the parasitological test were used. DNA samples obtained from human patients blood from Marília, São Paulo state and DNA extracted from sandflies caught in Bom Jesus dos Perdões, São Paulo state were also tested in pools. All samples were further tested using the ITS rDNA marker [29].

Results

Forty-four sequences were obtained from cathepsin L-like CPA and they were all identical, without polymorphism, and presented 99% similarity with cysteine peptidase isoform A of Leishmania infantum (XM_001465076.1) from Europe. The sequences of cathepsin L-like CPA from L. infantum were identical and all isolates were clustered together (100% bootstrap/100% posterior probability and 100% similarity) (Fig. 2).
Fig. 2

Dendrogram based on 44 cathepsin L-like sequences from Leishmania infantum, which was used for making maximum parsimony and Bayesian inferences with 892 characteristics. Numbers at nodes are the support values for the major branches (bootstrap/posterior probability; 500 replicates). The sequences obtained in the present study are underlined

Dendrogram based on 44 cathepsin L-like sequences from Leishmania infantum, which was used for making maximum parsimony and Bayesian inferences with 892 characteristics. Numbers at nodes are the support values for the major branches (bootstrap/posterior probability; 500 replicates). The sequences obtained in the present study are underlined Leishmania species were aggregated in a monophyletic group (Fig. 2). The different species of the genus Leishmania were segregated into four groups: I. Leishmania species with mucocutaneous clinical manifestations, including L. guyanensis, L. braziliensis and L. panamensis (0.1% divergence of sequences and 100% bootstrap and 1.0 posterior probability); II. Species with cutaneous manifestations, including L. pifanoi, L. mexicana and L. amazonensis (0.52% divergence of sequences and 100% bootstrap and 1.0 posterior probability); III. Leishmania species causing cutaneous “oriental sore”, including L. major and L. aethiopica (1.53% divergence of sequences and 100% bootstrap and 1.0 posterior probability); and IV. New and Old-World species of visceral leishmaniasis (0.14% divergence of sequences and 100% bootstrap and 1.0 posterior probability), separated according to the geographical origin of the isolates (Fig. 2). The in silico analyses on the primers proposed for the specific PCR did not indicate any possibility of formation of GC staples, self-dimers and auto-homologies. The CatLeishF primer showed a GC ratio of 54.5% with an estimated melting temperature of 66.2 °C, whereas the CatLeishR primer had a GC ratio of 57.6% with a melting temperature corresponding to 65.5 °C. In BLASTn analysis, these primers were specific for L. infantum, with no homology containing sequences from other species deposited in the database. CatLeish-PCR reactions with genomic DNA from L. infantum isolates demonstrated that there was a correct amplification, since amplicon sequencing revealed in BLASTn a percentage of 99% similarity to deposited sequences of cysteine protease genes from European strains of L. infantum (XM_001465076.1) and identical to American L. infantum sequences obtained in this study. Sensitivity measurement demonstrated that the markers were efficient at amplifying the target DNA and forming detectable bands at concentrations of up to 10− 11 ng/μl (Fig. 3).
Fig. 3

CatLeish-PCR for diagnosis of Leishmania infantum based on Cathepsin L-like sequences. a Specificity analysis using DNA, Leishmania and Trypanosoma sequences and other hemoparasites from dogs (Babesia and Ehrlichia). b Sensitivity analysis using DNA from Leishmania infantum in different concentrations

CatLeish-PCR for diagnosis of Leishmania infantum based on Cathepsin L-like sequences. a Specificity analysis using DNA, Leishmania and Trypanosoma sequences and other hemoparasites from dogs (Babesia and Ehrlichia). b Sensitivity analysis using DNA from Leishmania infantum in different concentrations Different species of the genus Leishmania were tested and there was no cross-amplification with any of the species epidemiologically associated with the cutaneous or tegumentary leishmaniasis complex in Brazil. When the molecular diagnosis was tested against hemoparasites belonging to the genera Babesia, Ehrlichia and Trypanosoma, there was no amplification (Fig. 3). The use of CatLeish-PCR in the panel of clinical samples revealed that frequency of positive dogs was 49.03%, thus contrasting with the 14.42% achieved through using primers for the ribosomal ITS gene. All samples that were positive in the reactions for the ITS gene were positive in reactions for the cathepsin gene. In the human samples, 6.25% were positive, whereas in samples from sandflies, the positivity was 14.28% in pools (Table 2).
Table 2

Positivity of naturally infected biological samples based on Cathepsin L-like of Leishmania infantum (CatLeish-PCR) marker

Samples (number)Positives samples (%)
CatLeish-PCRITS
Dogs blood (208)49,03 (102)14,42 (30)
Dogs urine (3)33 (1)
Dogs conjuntival swab (4)50 (2)
Dogs blood in filter paper (4)100 (4)
Human blood (50)6,25 (3)
Sand flies (21)14,28 (3)
Positivity of naturally infected biological samples based on Cathepsin L-like of Leishmania infantum (CatLeish-PCR) marker The samples from parasitologically positive dogs showed different rates of positivity according to the material tested. Urine samples showed 33% positivity, conjunctival swabs 50%, samples preserved on filter paper 100% and whole blood samples 100%. The CatLeish-PCR was replicated several times during standardization with DNA samples from American L. infantum isolates, and subsequently technical replication was tested with clinical samples. Regardless of the samples tested, the technical replication and amplification standard were maintained (Additional file 1).

Discussion

The phylogenetic inferences from maximum parsimony and Bayesian analyses revealed a pattern of high similarity for L. infantum isolates, as observed in inferences based on SSUrDNA and gGAPDH genes [30]. The segregation of L. infantum from Europe and America corroborates the notion that this species was introduced to the Americas during the colonization period [30]. This absence of divergence, even among isolates from biomes with different climates, rainfall, vegetation cover and availability of hosts and arthropod vectors, corroborates the theory that this parasite is not autochthonous to the Americas [31]. This finding indicates that the event leading to introduction of this parasite to the New World was recent. It can therefore probably be dated to the process of Ibero-American colonization that began in the fifteenth century, caused by the arrival of infected dogs and rodents [32]. Focusing only on a few specific genes we can speculate that this short evolutionary time interval would be insufficient for the appearance and fixation of possible mutations in the population. These results refute the hypothesis of a scenario in which the parasite responsible for cases of visceral leishmaniasis is native to the Americas [30-33]. Thus, the argument that the parasite is autochthonous in that it is adapted to parasitism in other wild fauna reservoirs can be countered through attributing this adaptation to the eclectic dietary habits of the vector insects [34]. The phylogenetic analysis on the cathepsin L-Like CPA gene showed clustering that reflects the distinct clinical manifestations of Leishmania infection, and it was similar to amino acid analyses on cysteine proteases [24]. In addition, the topology generated using the cathepsin L-like gene also corroborates data generated using ribosomal spacers and cytochrome B [35, 36]. The inferences correctly solved the differentiation of the species that are considered to be the etiological agent of tegumentary forms of the disease. One of the clades grouped L. guyanensis, L. panamensis and L. braziliensis, and this reflected the findings of studies in which, analyzing otorhinolaryngological conditions, most of the etiology of mucocutaneous leishmaniasis was attributed to L. braziliensis and L. panamensis, as well as results in which clinical situations of mucosal involvement were attributed to L. guyanensis [37, 38]. A second group included L. amazonensis and L. mexicana, species that have been widely associated with cutaneous manifestations of tegumentary leishmaniasis in the New World [39-43]. The L. pifanoi sequences were positioned in this same group. Although this species has lower epidemiological impact regarding disease transmission, it belongs to the L. mexicana complex [44]. Therefore, this result corroborates the data demonstrating similarity among the species of this complex, with regard to proposing specific markers for kinetoplast DNA (kDNA) [45]. These results confirm that the cathepsin L-like CPA gene is a good marker for phylogenetic positioning of species of the genus Leishmania, which suggests that this gene may be a good target for making the molecular diagnosis of leishmaniasis. This would enable satisfactory differentiation between the clinical forms of the disease, including among the variants of the tegumentary forms, which may aid in prescribing therapy, establishing the medical prognosis for the disease and mitigating the recurrent problems of specific diagnosis. We agree that the number of isolates collected in this work is sufficient to portray the dispersal of the parasite in Brazil. Cathepsin gene-based assays have shown excellent results with regard to diagnosing the following Trypanosoma species: T. vivax [13], T. congolense [46], T. theileri [47], T. cruzi [48] and T. rangeli [49]. However, the low numbers of copies of this gene in the genome are very specific and especially sensitive [13]. Cathepsin L-like protease is differentially expressed in different forms of the parasite [50, 51]. The CPA isoform is preferentially expressed in amastigote forms. In vertebrates (both human and animal hosts), amastigotes are the replicative form and cathepsin L-like CPA is continuously expressed [24]. The expression pattern of cathepsin L-like CPA and the presence of immunogenic epitopes may indicate it as an interesting target in diagnostic-serological tests, which are preferentially used in the clinical routine [25]. The diagnostic marker based on the cathepsin L-like CPA gene has shown high sensitivity and was specific for L. infantum, which enables direct use in clinical samples both in non-endemic areas with imported cases and in endemic areas in which different species of Leishmania may be circulating. Thus, it has been proven to be effective for epidemiological surveys on human hosts, animal reservoirs and arthropod vectors. Another advantage that makes CatLeish-PCR feasible is that there is no need for complementary restriction enzyme digestion steps or use of robust high-resolution melting equipment for identifying L. infantum, which makes the method less costly and less cumbersome than other methodologies that are available [52]. In comparison with the markers for the ITS gene, CatLeish-PCR demonstrated higher prevalence of leishmaniasis, which thus corroborated the diagnostic sensitivity of the marker. The marker was effective in making the diagnosis, both from positive swab samples from conjunctival lesions and from blood samples fixed on filter paper, reinforcing the high sensitivity of CatLeish-PCR. The positive animals in the parasitological examination were also positive when submitted to molecular diagnosis based on the cathepsin L-like gene, except for the urine samples given the low amount of DNA in two animals. This versatility is important because samples fixed on filter paper are easier to transport and store, given their stability, as well as exempt invasive collection methodologies [29]. The diagnostic method works very well for blood samples and even though the number of samples from other sources is reduced, the method borrows our hypothesis of good molecular marker for diagnosis in biological samples with DNA. Amplification was observed even in samples extracted from urine, whose DNA concentration is considerably reduced, corresponding only to fragments of the dead parasite excreted in the urinary system [53]. It should be noted that even with low levels of positivity in the assays using biological samples as a template, we still support our indication of the use of the Cathepsin gene for PCR diagnosis, since even in biological samples where the genetic material of the parasites is scarce or damaged, we obtained satisfactory amplifications. Considering this, CatLeish-PCR may have potential for monitoring the remission of infection in patients with visceral leishmaniasis and as an indicator of the efficacy of possible therapeutic approaches [54]. The results presented here allow us to propose that CatLeish-PCR is a tool that can be used for diagnosing visceral leishmaniasis. It surmounts the recurrent problems of low sensitivity that direct visualization methodologies present and those of low specificity and agreement among the serological methods that have preferentially ben recommended for diagnosing this disease [55]. The molecular diagnostic assays used and described in the literature have low sensitivity and specificity. Markers based on the cytochrome b gene are non-specific [56]. Markers based on genes present in the kinetoplast have high sensitivity, but their specificity is low [57, 58]. Markers based on ribosomal genes are specific, but not very sensitive [59]. Other assays such as restriction fragment length polymorphism (PCR-RFLP) have been standardized, but these raise the cost of making the diagnosis or still require sequencing of the product [60-62]. Epidemiological studies are important for recognizing active transmission cycles or introduction of parasites into new areas. Therefore, precise diagnostic methods are essential for diagnosing the presence of a parasite that is still emerging in many regions. Moreover, making a precise diagnosis minimizes the need to destroy dogs, which are the main reservoirs, given that in some countries this prophylactic measure used in combating human leishmaniasis.

Conclusion

This is the first work that characterizes the CPA isoform of the L-like cathepsin gene of L. infantum, demonstrating the lack of genetic variability among the Brazilian isolates of L. infantum. We propose that the gene studied here be an efficient phylogenetic marker for parasites of the genus Leishmania, and also the developed CatLeish-PCR has been shown to be sensitive and specific for the effective clinical diagnosis of this zoonosis in dogs and humans. Additional file 1. Amplification patterns of CatLeish-PCR for diagnosis of Leishmania infantum in samples from dogs, humans and sand flies.
  48 in total

1.  Internal-transcribed-spacer (ITS) sequences used to explore phylogenetic relationships within Leishmania.

Authors:  A M Dávila; H Momen
Journal:  Ann Trop Med Parasitol       Date:  2000-09

2.  Dynamics of Leishmania chagasi infection in small mammals of the undisturbed and degraded tropical dry forests of northern Colombia.

Authors:  B L Travi; Y Osorio; M T Becerra; G H Adler
Journal:  Trans R Soc Trop Med Hyg       Date:  1998 May-Jun       Impact factor: 2.184

3.  Evaluation of an ELISA rapid device for the serological diagnosis of Leishmania infantum infection in dog as compared with immunofluorescence assay and Western blot.

Authors:  E Ferroglio; E Centaro; W Mignone; A Trisciuoglio
Journal:  Vet Parasitol       Date:  2006-10-13       Impact factor: 2.738

4.  Evaluation of dot enzyme-linked immunosorbent assay (dot-ELISA) for the serodiagnosis of canine leishmaniosis as compared with indirect immunofluorescence assay.

Authors:  F Mancianti; F Pedonese; A Poli
Journal:  Vet Parasitol       Date:  1996-10-15       Impact factor: 2.738

5.  High genetic diversity in field isolates of Trypanosoma theileri assessed by analysis of cathepsin L-like sequences disclosed multiple and new genotypes infecting cattle in Thailand.

Authors:  Herakles A Garcia; Ketsarin Kamyingkird; Adriana C Rodrigues; Sathaporn Jittapalapong; Marta M G Teixeira; Marc Desquesnes
Journal:  Vet Parasitol       Date:  2011-03-17       Impact factor: 2.738

Review 6.  Cysteine peptidases as virulence factors of Leishmania.

Authors:  Jeremy C Mottram; Graham H Coombs; James Alexander
Journal:  Curr Opin Microbiol       Date:  2004-08       Impact factor: 7.934

7.  Proteinases as virulence factors in Leishmania spp. infection in mammals.

Authors:  Mariana Silva-Almeida; Bernardo Acácio Santini Pereira; Michelle Lopes Ribeiro-Guimarães; Carlos Roberto Alves
Journal:  Parasit Vectors       Date:  2012-08-07       Impact factor: 3.876

Review 8.  A Historical Overview of the Classification, Evolution, and Dispersion of Leishmania Parasites and Sandflies.

Authors:  Mohammad Akhoundi; Katrin Kuhls; Arnaud Cannet; Jan Votýpka; Pierre Marty; Pascal Delaunay; Denis Sereno
Journal:  PLoS Negl Trop Dis       Date:  2016-03-03

9.  High Resolution Melting Analysis Targeting hsp70 as a Fast and Efficient Method for the Discrimination of Leishmania Species.

Authors:  Ricardo Andrade Zampieri; Maria Fernanda Laranjeira-Silva; Sandra Marcia Muxel; Ana Carolina Stocco de Lima; Jeffrey Jon Shaw; Lucile Maria Floeter-Winter
Journal:  PLoS Negl Trop Dis       Date:  2016-02-29

10.  Identification of BALB/c Immune Markers Correlated with a Partial Protection to Leishmania infantum after Vaccination with a Rationally Designed Multi-epitope Cysteine Protease A Peptide-Based Nanovaccine.

Authors:  Maria Agallou; Maritsa Margaroni; Evita Athanasiou; Dimitra K Toubanaki; Katerina Kontonikola; Konstantina Karidi; Olga Kammona; Costas Kiparissides; Evdokia Karagouni
Journal:  PLoS Negl Trop Dis       Date:  2017-01-23
View more
  1 in total

1.  First molecular-based detection study of Leishmania infantum in the Tapirapé indigenous population in the Brazilian Amazon.

Authors:  D S C Freitas; R E Silva; J O J Costa; D V Markus; H S Soares; A H H Minervino; J T R Lima; S M Gennari; A Marcili
Journal:  Braz J Med Biol Res       Date:  2022-02-04       Impact factor: 2.590

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.