Mauro Mandrioli1, Deborah Salvatore2, Agnese Ferrari3, Niccolò Patelli4, Gian Carlo Manicardi5. 1. Dipartimento di Scienze della Vita, Università di Modena e Reggio Emilia, Via Campi 213/d, 41125 Modena, Italy. mauro.mandrioli@unimore.it. 2. Dipartimento di Scienze della Vita, Università di Modena e Reggio Emilia, Via Campi 213/d, 41125 Modena, Italy. 224541@studenti.unimore.it. 3. Dipartimento di Scienze della Vita, Università di Modena e Reggio Emilia, Via Campi 213/d, 41125 Modena, Italy. agnese.ferrari@unimore.it. 4. Dipartimento di Scienze della Vita, Università di Modena e Reggio Emilia, Via Campi 213/d, 41125 Modena, Italy. 82225@studenti.unimore.it. 5. Dipartimento di Scienze della Vita, Università di Modena e Reggio Emilia, Via Campi 213/d, 41125 Modena, Italy. manigi04@unimore.it.
Abstract
The availability of genomic data in the last decade relating to different aphid species has allowed the analysis of the genomic variability occurring among such species, whereas intra-specific variability has hitherto very largely been neglected. In order to analyse the intra-genomic variability in the peach potato aphid, Myzus persicae, comparative analyses were performed revealing several clone-specific gene duplications, together with numerous deletions/rearrangements. Our comparative approach also allowed us to evaluate the synteny existing between the two M. persicae clones tested and between the peach potato aphid and the pea aphid, Acyrthosiphon pisum. Even if part of the observed rearrangements are related to a low quality of some assembled contigs and/or to the high number of contigs present in these aphid genomes, our evidence reveals that aphid clones are genetically more different than expected. These results suggest that the choice of performing genomes sequencing combining different biotypes/populations, as revealed in the case of the soybean aphid, Aphis glycines, is unlikely to be very informative in aphids. Interestingly, it is possible that the holocentric nature of aphid chromosomes favours genome rearrangements that can be successively inherited transgenerationally via the aphid's apomictic (parthenogenetic) mode of reproduction. Lastly, we evaluated the structure of the cluster of genes coding for the five histones (H1, H2A, H2B, H3 and H4) in order to better understand the quality of the two M. persicae genomes and thereby to improve our knowledge of this functionally important gene family.
The availability of genomic data in the last decade relating to different aphid species has allowed the analysis of the genomic variability occurring among such species, whereas intra-specific variability has hitherto very largely been neglected. In order to analyse the intra-genomic variability in the peach potato aphid, Myzus persicae, comparative analyses were performed revealing several clone-specific gene duplications, together with numerous deletions/rearrangements. Our comparative approach also allowed us to evaluate the synteny existing between the two M. persicae clones tested and between the peach potato aphid and the pea aphid, Acyrthosiphon pisum. Even if part of the observed rearrangements are related to a low quality of some assembled contigs and/or to the high number of contigs present in these aphid genomes, our evidence reveals that aphid clones are genetically more different than expected. These results suggest that the choice of performing genomes sequencing combining different biotypes/populations, as revealed in the case of the soybean aphid, Aphis glycines, is unlikely to be very informative in aphids. Interestingly, it is possible that the holocentric nature of aphid chromosomes favours genome rearrangements that can be successively inherited transgenerationally via the aphid's apomictic (parthenogenetic) mode of reproduction. Lastly, we evaluated the structure of the cluster of genes coding for the five histones (H1, H2A, H2B, H3 and H4) in order to better understand the quality of the two M. persicae genomes and thereby to improve our knowledge of this functionally important gene family.
In the last few decades several insect genomes have been sequenced, assembled and annotated covering six different orders belonging to both holometabolous and hemimetabolous species [1,2,3,4,5,6]. Furthermore, current genomic data are not limited to highly studied ‘model’ insects such as Drosophila melanogaster and Anopheles gambiae, but also other species, like the honey beeApis mellifera [1], the red flour beetleTribolium castaneum [3], the yellow fever mosquitoAedes aegypti [7], the mosquito Culex quinquefasciatus [4], and the blood-sucking bug, Rhodnius prolixus [6].In view of their relevance as serious pests of a variety of crops of agricultural and horticultural importance , several aphid species (Hemiptera: Aphididae) have been studied to date, whilst economic resources are available for the pea aphid, Acyrthosiphon pisum [8], the Russian wheat aphid, Diuraphis noxia [9], the soybean aphid, Aphis glycines (from a composite of multiple North American populations) [10], the cotton aphidAphis gossypii [11], as well as for additional species whose genomes are available in Aphidbase, even if their papers are still unpublished: i.e. Aphis glycines biotype 1, the black cherry aphid, Myzus cerasi; the peach potato aphid, Myzus persicae; and the bird cherry-oat aphid, Rhopalosiphum padi.Genomic resources have prompted several comparisons among species and this approach has allowed, for instance, the identification of the molecular pathways evolving in each aphid species, sometimes fast, and/or the study of gene families, the functions of which are related to environmental adaptation [11,12], together with the identification of species-specific gene expansions or losses [12]. Interestingly, even if aphid genomic resources also include genome assemblies of biotypes/clones belonging to a same species [10], aphid intra-specific variability has been very largely neglected, despite the usefulness of this comparison. Indeed, intra-specific comparative analysis could indeed be useful to validate genomic data, more especially considering the fact that aphid genomes are currently scattered in thousands of contigs, thereby making the evaluation of their quality difficult.The need for this validation is strongly supported by recent analyses pointing to the occurrence of a very high rate of misassembly in the A. pisum genome [13]. Indeed, Jaquiéry et al. [13] identified widespread errors in more than half of the contigs larger than 150kb, suggesting that the pea aphid genome presents considerable assembly problems to a degree that goes beyond the assembly results obtained with current assembly procedures and protocols [14,15].In view of the availability of genomic resources related to two clones of the peach potato aphidMyzus persicae (Sulzer) in the present study, we analysed the occurrence of intra- and inter-specific genomic changes in these clones, using the pea aphidA. pisum genome as a reference in order to understand the quality of the assembled M. persicae genomes and to identify syntenic regions between clones and among aphid species. At the same time, we analysed the structure of the cluster of genes coding for histones H1, H2A, H2B, H3 and H4 in order to better evaluate the quality of the two M. persicae assembled genomes as well as to improve our knowledge of this gene family.
2. Materials and Methods
Genomic data related to M. persicae clones G006 and O were downloaded from Aphidbase (http://bipaa.genouest.org/sp/myzus_persicae/). The genomes of M. persicae clones G006 and O were derived from the sequencing of a single aphid clone, whereas the A. glycines genome, currently available in Genbank and referred as a “hybrid” genome, derived from the simultaneous sequencing of assembling of both laboratory colonies and natural populations collected from soybean fields [10]. The pea aphid genome was downloaded from the website Aphidbase (http://bipaa.genouest.org/sp/acyrthosiphon_pisum/) and has been used as a genomic reference since it is, at present, the most studied and carefully annotated aphid genome.Dot plot comparisons (visualized as 2D scatter plots) and search for syntenic regions/genes were done using the freely available software SynFind (https://genomevolution.org/coge/SynFind.pl) that generates syntenic dot plots [16] and SynMap (https://genomevolution.org/coge/SynMap.pl) that in turn reveals syntenic regions [17]. SynFind analyses were performed using the BLAST-variant last with a gene window size of 40 and setting 4 as the minimum number of gene. The scoring function “collinear” was used so that collinear arrangement of syntenic genes was enabled. SynMap analysis was performed setting "relative gene order" as DAGChainer option, since the absolute distance between genes in nucleotides may vary widely between genomes and even within a genome. In view of the low synteny observed in previous analyses [18], a minimum number of 5 gene-pairs was inserted as a DAGChainer search parameter. The combined use of SynFind and SynMap allowed the identification of both orthologous genes (or regions of homology) between two genomes and collinear sets of genes (or regions) of sequence similarity to infer synteny.The gene order obtained in SynMap for each aphid genome was verified using the JBrowse genome browser available in Aphidbase (http://bipaa.genouest.org/).DNA extraction was performed using the Wizard (Promega), according to the manufacturer’s instructions using 30 female adults. DNA samples were quantified by spectrophotometric absorbance measurements at a wavelength of 260 nm using a Nanodrop ND 1000 Spectrophotometer (NanoDrop Technologies).The Long PCR Enzyme Mix (Fermentas) was used to amplify the complete histone gene cluster using oligonucleotide primers (Table 1) specifically designed on M. persicae sequences with the freely available on-line tool Primer 3 (http://bioinfo.ut.ee/primer3/) [19].
Table 1
Sequence and melting temperature of the primers designed to amplify the histone cluster identified in the contigs 294 and 1711. For both the primer couples an annealing temperature of 54.8 °C was used with a polymerase extension at 67 °C for 15 minutes (25 cycles), according to the manufacturer’s instructions.
Primer
Tm (°C)
Sequence (5′- 3′)
294_clu-hist_F
59.93
ATTTGGAGCTGGTGTACTTGGT
294_clu-histR
60.52
TGCAATGCATTATCACAAACG
1711_clu-hist_F
60.30
TCGAACAGACCGACCAACTAG
1711_clu-hist_R
59.83
TGCAAATGTCTGGGAATGATAC
DNA sequencing was performed with Sanger sequencers at BMR Genomics (Padua, Italy), whereas the search for matrix recognition sites was done using the freely available tool MARSCAN (http://www.bioinformatics.nl/cgi-bin/emboss/marscan) [20].
3. Results
The combined use of SynFind and SynMap allowed the identification of the set of orthologous genes in the two M. persicae clones (Table 2) and their comparison (Figure 1 and Figure 2, Table 3). This approach showed that about half of the identified genes (55.9%) had an orthologue in the two M. persicae clones (depth 1), 27.4% of the annotated genes in clone G006 genes were deleted/rearranged in clone O (depth 0), whilst 15.4% were duplicated (depth 2) or present in more than two copies, since 1.3% of genes were duplicated twice (depth 3) and 0.05% three times (depth 3) in clone G006 in comparison with clone O. Clone O showed 30.5% of genes involved in clone-specific deletions (depth 0), 57.2% had an orthologue in the two M. persicae clones (depth 1), and 4.3% of genes were duplicated (depth 2).
Table 2
A complete gene list for each M. persicae clone has been compiled and data are available at the reported addresses in the COGE web server [21].
Clone
Address
M. persicae clone G006
https://genomevolution.org/r/15r3b
M. persicae clone O
https://genomevolution.org/r/15r40
Figure 1
Dot plot comparison (visualized as 2D scatter plots) of M. persicae clones O (MP-O) and G006 (MP-G006) reveals a greater similarity between the two M. persicae clones in contrast to A. pisum (AP).
Figure 2
Venn diagram showing the number of orthologues in the two M. persicae clones and the number of genes involved in duplications (dup) and those in single copy in each clone.
Table 3
Synteny evaluated in the comparison between the M. persicae clones G006 and O. Synteny has been classified as “syntenic depth” according to the SynFind output.
Syntenic Depth
G006 vs O
O vs G006
0
27.37%
38.50%
1
55.86%
57.19%
2
15.38%
4.32%
3
1.34%
0
4
0.05%
0
The analysis of intra- and inter-specific genome variation identified 2628 orthologous genes conserved among A. pisum and the two M. persicae clones, whereas 363 genes were conserved in A. pisum and M. persicae clone G006b (but not in M. persicae clone O); 140 genes were conserved in A. pisum and M. persicae clone O, but absent in M. persicae clone G006b (Supplementary Tables S1 and S2).The analysis of syntenic regions evidenced an average of 3.7 genes per syntenic block in the comparison between the two M. persicae clones (Figure 3), whereas an average of 2.8 and 2.9 genes per syntenic block was found on comparison of A. pisum with M. persicae clones O and G006, respectively.
Figure 3
Example of synteny analysis performed comparing the genomes of M. persicae clone G006b (top), A. pisum (centre) and M. persicae clone O (bottom). Genes are displayed as grey bars. Red connectors evidence orthologous regions/genes among species/biotypes and their position in the displayed contig sequence. The complete list of the syntenic regions identified in the M. persicae clones is present in Supplementary Table S2 (including the link to each synteny map).
In order to identify a molecular marker that could help in the evaluation of the genome quality (in addition to classical features, such as N50 and contig length/number), we evaluated the structure of the gene clusters coding for the five histone proteins H1, H2A, H2B, H3 and H4. Using BLAST analysis no complete histone gene cluster was observed in clone O, whereas the contigs 294 and 1711 of the M. persicae clone G006 contained a complete histone gene cluster (Figure 4). However, the two identified histone clusters were different both in length and gene order (Figure 4).
Figure 4
Schematic representation of histone clusters identified in contigs 294 (top) and 1711 (bottom). The length (in bp) of the coding sequence is reported for each histone gene.
To verify whether both the histone clusters were present in M. persicae or if they could result from a chimeric assemblage, two specific couples of primers were designed to perform long PCR amplification. This experimental approach revealed that only the histone cluster identified in the contig 294 was present in both the M. persicae clones tested (Figure 5). Surprisingly, PCR amplification showed two bands, suggesting that two different histone clusters could be present in each clone, so that the amplified DNA fragments were thus sequenced and aligned. Sequence analysis showed that the two histone clusters have the same sequence, but the longer histone cluster results from the insertion of an uncharacterized transposable element (Figure 6).
Figure 5
Agarose gel electrophoresis showing the results of the histone cluster PCR amplification with the primers designed on contigs 294 (lanes 1 and 2) and 1711 (lanes 3 and 4) in M. persicae clone O (lanes 1 and 3) and G006b (lanes 2 and 4).
Figure 6
Schematic representation of two histone clusters identified in contig 294 showing the presence of a mobile element in the longer cluster. The length (in bp) of the coding sequence is reported for each histone gene.
Considering that the histone gene cluster is generally flanked by matrix recognition sites (MRS), we performed a MRS search in the M. persicae sequences flanking the histone clusters, thereby revealing their presence on both sides (Figure 7). From these data, we infer that a putative folding of the M. persicae chromatin occurs in the interphase nuclei so that the histone cluster is located internally in the nucleus with respect to the flanking regions (Figure 8).
Figure 7
Schematic representation of the M. persicae histone cluster together with the two flanking MRS sequences.
Figure 8
Schematic representation of the putative structural conformation of contigs containing the histone gene cluster in the M. persicae nucleus.
4. Discussion
The genomes of an increasing number of aphid species have been sequenced in the last decade [8,10,11], but few studies have analysed the differences occurring among biotypes/clones belonging to the same aphid species in order to understand the effects of adaptation to different host plants and clonal selection at a genome scale [22,23,24,25,26].At present, the genomes of two different clones of M. persicae (clones G006 and O) are available [23], together with two genomes belonging to the soybean aphidA. glycines [10]. However, the genome of A. glycines biotype 1 has been obtained from an aphid population collected on soybean plants in Illinois, USA, whereas the second A. glycines genome (generally referred as “hybrid” genome) has been obtained by mixing different natural and laboratory populations collected on soybean plants [10], so that it represents a mix of different A. glycines genomes thereby making it much less useful in comparison with other biotypes.M. persicae clone O was sampled in the UK from Chinese cabbage plants, Brassica rapa [26], whereas clone G006 was collected from pepper, Capsicum, annuum in Geneva, Switzerland [26] making the comparison of their genomes useful in evaluating the extant of genome conservation in clones collected in very different habitats [18,27]. Furthermore, an intra-specific comparison could well improve our knowledge about the genome of each aphid species and validate genomic data, more especially considering that aphid genomes are still scattered in thousands of contigs.The combined use of SynFind and SynMap allowed the identification of orthologous genes in the M. persicae clones not only in term of their sequence, but also concerning their presence in syntenic regions. Synteny can be extremely useful to confirm gene homology since it makes data more reliable than the identification of orthologues inferred in relation to sequence similarity alone [16]. Furthermore, standard approaches based on clustering algorithms, such as OrthoMCL [28] and INPARANOID [29], allow successful identification of single copy gene families, but homology cannot be confirmed in the presence of paralogues that are very common in aphids, so that we have included gene positional data in our own analyses.Synteny analysis clearly showed that in M. persicae about 30% of the orthologues were involved in clone-specific deletions/rearrangements. Even considering the high number of contigs that are present in these genomes, these differences are greater than expected in comparison with, for example, Drosophila melanogaster populations, thus suggesting that the combination of apomictic parthenogenetic propagation and holocentric chromosomes as found in aphids could favour clone diversification. These results clearly indicate that the choice of performing genome sequencing mixing populations/clones, as done in the case of the soybean aphidA. glycines [10], could prove much less useful in attempts to understand aphid molecular ecology, since this approach may well underestimate the difference occurring among biotypes/populations.The study of synteny among clones is useful not only to infer homology relationships between genes located within a common genomic neighbourhood [12,30,31,32], but also to better understand the biological specificity of each clone. Indeed, orthologous genes localized at non-syntenic locations generally have relevant differences in their expression pattern, since the different chromosomal localizations may be associated with diverse regulatory sequences [33]. For instance, metabolic responses to insecticides could greatly differ among aphid clones as a consequence of genome rearrangements that in turn could result into diffuse position-effect variegations [24,25], so that future analyses of the genome of each aphid biotypes could foster the development of more efficient aphid control strategies.Previous synteny analyses on aphids have been performed comparing species using manually selected sets of genes [16,18]. Until now, the use of manually curated syntenic gene sets is very common and it represents the primary method by which the broader research community has employed such syntenic information in their research. However, manually curated gene sets are generally limited because they generally cover a small portion of the gene repertoire of a species and cannot be updated due to a lag introduced by the time a given genome assembly is published and/or by the existence of updates in data related to genome assemblies, annotations and gene identifiers [16].Our current analyses gave an average of 3.7 genes per syntenic block in the comparison between the two M. persicae clones, but 2.8 and 2.9 genes per syntenic block when the genome of the two M. persicae clones were compared to the A. pisum genome (in clone O and G006 respectively). Previous studies performed on A. glycines [34] revealed on average less than two genes per syntenic block in the comparison with A. pisum suggesting that gene order in aphid chromosomes is hardly conserved among species due to the holocentric nature of their chromosomes.Interestingly, even if these data could be at least partially influenced by the presence of thousands of contigs in the aphid genomes here analysed, the observed synteny strongly mirror data found in Lepidoptera by d' Alençon et al. [35] comparing Bombyx mori and the noctuid moth species Spodoptera frugiperda and Helicoverpa armigera. Indeed, they showed small conserved syntenic blocks of genes approximately containing 1.3 genes per block between B. mori and the two noctuid species and 2.0 genes per block between S. frugiperda and H. armigera. As suggested by d'Alençon et al. [35], this corresponds to approximately two chromosome breaks per Mb of DNA per million years pointing to an evolutionary rate that is much higher than that found among species in the genus Drosophila [35]. As a whole, these data support the hypothesis that holocentric chromosomes can favour local chromosomal rearrangements in Lepidoptera and probably in aphids also at the clone/biotype level.A further comparison between the two M. persicae clones has been performed looking at the structure of the gene cluster coding for the four core histones (H2A, H2B, H3 and H4) and the linker histone (H1). According to the published literature, in insects these are typically clustered in quintets (H2A, H2B, H3, H4 and H1), although scattered solitary histone genes have also been reported [36,37,38].Both the M. persicae clones presented a histone gene cluster consisting of the five histone coding genes in the order H2B-H2A-H3-H4-H1 with the cluster spanning more than 7kb. This size is similar to that observed in the pea aphidA. pisum [39], confirming that aphids possess larger histone clusters compared with other insects, such as different Drosophila species [36].Furthermore, even if both the aphid species here compared in terms of their genomes presented a typical insect histone gene cluster, where H2A and H2B are adjacent and transcribed in opposite directions and genes H3 and H4 constitute an oppositely transcribed pair [40], the gene order observed in M. persicae is different from that reported in A. pisum, whereupon the order did not vary in more than 20 Drosophila species studied [41]. This reinforces the view that aphid species (and probably also parthenogenetic aphid clones/biotypes) possess a number of genomic rearrangements greater than that present in many other insects.
5. Conclusions
This study suggests that M. persicae clones are more different at the genome level than previously expected and that the holocentric nature of the aphid chromosomes, together with the presence of apomictic parthenogenesis, can greatly favour chromosomal rearrangements and their inheritance. Even if two clones are not sufficiently numerous to study the effect of M. persicae adaptation to different plant hosts, data as here reported prompts further genomic studies aimed at the comparison of such aphid populations adapted to different hosts, especially crops. These data could also help to clarify the real occurrence of generalism and specialisms in aphid feeding [42].
Authors: Olga Dudchenko; Sanjit S Batra; Arina D Omer; Sarah K Nyquist; Marie Hoeger; Neva C Durand; Muhammad S Shamim; Ido Machol; Eric S Lander; Aviva Presser Aiden; Erez Lieberman Aiden Journal: Science Date: 2017-03-23 Impact factor: 47.728
Authors: Peter Arensburger; Karine Megy; Robert M Waterhouse; Jenica Abrudan; Paolo Amedeo; Beatriz Antelo; Lyric Bartholomay; Shelby Bidwell; Elisabet Caler; Francisco Camara; Corey L Campbell; Kathryn S Campbell; Claudio Casola; Marta T Castro; Ishwar Chandramouliswaran; Sinéad B Chapman; Scott Christley; Javier Costas; Eric Eisenstadt; Cedric Feschotte; Claire Fraser-Liggett; Roderic Guigo; Brian Haas; Martin Hammond; Bill S Hansson; Janet Hemingway; Sharon R Hill; Clint Howarth; Rickard Ignell; Ryan C Kennedy; Chinnappa D Kodira; Neil F Lobo; Chunhong Mao; George Mayhew; Kristin Michel; Akio Mori; Nannan Liu; Horacio Naveira; Vishvanath Nene; Nam Nguyen; Matthew D Pearson; Ellen J Pritham; Daniela Puiu; Yumin Qi; Hilary Ranson; Jose M C Ribeiro; Hugh M Roberston; David W Severson; Martin Shumway; Mario Stanke; Robert L Strausberg; Cheng Sun; Granger Sutton; Zhijian Jake Tu; Jose Manuel C Tubio; Maria F Unger; Dana L Vanlandingham; Albert J Vilella; Owen White; Jared R White; Charles S Wondji; Jennifer Wortman; Evgeny M Zdobnov; Bruce Birren; Bruce M Christensen; Frank H Collins; Anthony Cornel; George Dimopoulos; Linda I Hannick; Stephen Higgs; Gregory C Lanzaro; Daniel Lawson; Norman H Lee; Marc A T Muskavitch; Alexander S Raikhel; Peter W Atkinson Journal: Science Date: 2010-10-01 Impact factor: 63.714