| Literature DB >> 31640938 |
Nicole E Breuner1, Shelby L Ford2, Andrias Hojgaard1, Lynn M Osikowicz1, Christina M Parise1, Maria F Rosales Rizzo1, Ying Bai1, Michael L Levin2, Rebecca J Eisen1, Lars Eisen3.
Abstract
The invasive, human-biting Asian longhorned tick, Haemaphysalis longicornis, was detected in New Jersey in the eastern United States in August of 2017 and by November of 2018 this tick had been recorded from 45 counties across 9 states, primarily along the Eastern Seaboard. The establishment of H. longicornis in the United States has raised the questions of how commonly it will bite humans and which native pathogens may naturally infect this tick. There also is a need for experimental vector competence studies with native pathogens to determine if H. longicornis can acquire a given pathogen while feeding, pass it transstadially, and then transmit the pathogen in the next life stage. In this experimental study, we evaluated the vector competence of a population of H. longicornis originating from the United States (New York) for a native isolate (B31) of the Lyme disease spirochete, Borrelia burgdorferi sensu stricto (s.s.). In agreement with a previous experimental study on the vector competence of H. longicornis for Borrelia garinii, we found that uninfected H. longicornis larvae could acquire B. burgdorferi s.s. while feeding on infected Mus musculus mice (infection prevalence >50% in freshly fed larvae) but that the infection was lost during the molt to the nymphal stage. None of 520 tested molted nymphs were found to be infected, indicating that transstadial passage of B. burgdorferi s.s. is absent or rare in H. longicornis; and based on the potential error associated with the number of nymphs testing negative in this study, we estimate that the upper 95% limit for infection prevalence was 0.73%. An Ixodes scapularis process control showed both effective acquisition of B. burgdorferi s.s. from infected mice by uninfected larvae and transstadial passage to the nymphal stage (infection prevalence of 80-82% for both freshly fed larvae and molted nymphs). We also observed that although H. longicornis larvae could be compelled to feed on mice by placing the ticks within feeding capsules, attachment and feeding success was minimal (<0.5%) when larvae were placed freely on the fur of the mice. We conclude that H. longicornis is unlikely to contribute more than minimally, if at all, to transmission of Lyme disease spirochetes in the United States. Published by Elsevier GmbH.Entities:
Keywords: Borrelia burgdorferi sensu stricto; Haemaphysalis longicornis; Ixodes scapularis; Lyme disease; Transmission; Vector
Mesh:
Year: 2019 PMID: 31640938 PMCID: PMC7054938 DOI: 10.1016/j.ttbdis.2019.101311
Source DB: PubMed Journal: Ticks Tick Borne Dis ISSN: 1877-959X Impact factor: 3.744
Primers and probes used for PCR targets in the in-house multiplex master mix.
| Target | Primer/probe | Sequence (5’– 3’)[ | Reference |
|---|---|---|---|
| fliD-F | TGGTGACAGAGTGTATGATAATGGAA |
| |
| fliD-R | ACTCCTCCGGAAGCCACAA | ||
| fliD-probe | FAM-TGCTAAAATGCTAGGAGATTGTCTGTCGCC-BHQ1 | ||
| 16S rDNA-F | AGCYTTTAAAGCTTCGCTTGTAG |
| |
| 16S rDNA-R | GCCTCCCGTAGGAGTCTGG | ||
| 16S rDNA-probe | HEX-CCGGCCTGAGAGGGTGAWCGG-BHQ1 | ||
| actin-F | GCCCTGGACTCCGAGCAG |
| |
| actin-R | CCGTCGGGAAGCTCGTAGG | ||
| actin-probe | Q670-CCACCGCCGCCTCCTCTTCTTCC-BHQ3 |
BHQ1, BHQ3: Black Hole Quencher 1 and 3, respectively; FAM: 6-carboxyfluorescein; HEX: hexachlorofluorescein phosphramidite; Q670: Quasar 670.
Acquisition of B. burgdorferi s.s. from infected M. musculus mice by uninfected H. longicornis or I. scapularis larvae and transstadial passage of spirochetes to the nymphal life stage.
| Mouse ID | Infection status of mouse[ | No. fed larvae recovered | Detection of | Detection of | Detection of | Confirmation of viable spirochetes in molted nymphs[ | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| No. tested larvae | No. positive larvae | % infected larvae | No. tested nymphs | No. positive nymphs | % infected nymphs | No. tested nymphs | No. positive nymphs | % infected nymphs | ||||
|
| ||||||||||||
| H46 | + | 50 | 2 | 1 | 50 | 20 | 0 | 0 | 27 | 0 | 0 | – |
| H48 | + | 21 | 2 | 0 | 0 | 17 | 0 | 0 | – | – | – | – |
| H49 | + | 48 | 2 | 2 | 100 | 20 | 0 | 0 | 15 | 0 | 0 | – |
| H50 | + | 13 | 2 | 2 | 100 | 9 | 0 | 0 | – | – | – | – |
| H51 | + | 42 | 2 | 1 | 50 | 20 | 0 | 0 | 19 | 0 | 0 | – |
| H52 | + | 34 | 2 | 0 | 0 | 20 | 0 | 0 | 10 | 0 | 0 | – |
| H53 | + | 56 | 2 | 2 | 100 | 20 | 0 | 0 | 28 | 0 | 0 | – |
| H55 | + | 73 | 2 | 2 | 100 | 20 | 0 | 0 | 30 | 0 | 0 | – |
| H56 | + | 12 | 2 | 1 | 50 | 9 | 0 | 0 | – | – | – | – |
| H57 | + | 30 | 2 | 1 | 50 | 20 | 0 | 0 | 7 | 0 | 0 | – |
| H58 | + | 78 | 2 | 2 | 100 | 20 | 0 | 0 | 29 | 0 | 0 | – |
| H59 | + | 24 | 2 | 2 | 100 | 17 | 0 | 0 | – | – | – | – |
| H60 | + | 39 | 2 | 0 | 0 | 20 | 0 | 0 | 8 | 0 | 0 | – |
| H61 | + | 52 | 2 | 2 | 100 | 20 | 0 | 0 | 26 | 0 | 0 | – |
| H62 | + | 34 | 2 | 0 | 0 | 20 | 0 | 0 | 11 | 0 | 0 | – |
| H64 | + | 47 | 2 | 0 | 0 | 20 | 0 | 0 | 18 | 0 | 0 | – |
| All mice | 653 | 32 | 18 | 56 | 292 | 0 | 0 | 228 | 0 | 0 | ||
|
| ||||||||||||
| H65[ | + | 72 | 5 | 3 | 60 | 20 | 13 | 65 | – | – | – | + |
| H66[ | + | 36 | 5 | 5 | 100 | 20 | 20 | 100 | – | – | – | + |
| All mice | 108 | 10 | 8 | 80 | 40 | 33 | 82 | |||||
Process control mouse exposed to I. scapularis larvae.
+, B. burgdorferi s.s. detected by culture of spirochetes from ear biopsies.
+, B. burgdorferi s.s. detected by culture of spirochetes from ticks.