IL‑1β increases the expression of inflammatory factors in synovial fluid‑derived fibroblast‑like synoviocytes via activation of the NF‑κB‑mediated ERK‑STAT1 signaling pathway.

Interleukin (IL)‑1β serves a crucial role in the progression of rheumatoid arthritis. Previous studies have indicated that the ERK/STAT1 signaling pathway may be involved in the inflammatory response in synovial fluid‑derived fibroblast‑like synoviocytes (sfd‑FLSs). However, the molecular mechanisms underlying the pathological effects of the inflammatory factors induced by IL‑1β in sfd‑FLSs remain unclear. The aim of the present study was to investigate the IL‑1β‑mediated signaling pathways involved in the expression of inflammatory factors in sfd‑FLSs and in a rat model of rheumatoid arthritis. Reverse transcription‑quantitative PCR, western blotting, and immunohistochemistry were used to analyze the role of IL‑1β in the rat model of rheumatoid arthritis. The results suggested that IL‑1β administration exacerbated rheumatoid arthritis, bone injury and increased the expression levels of inflammatory factors, such as IL‑17 and tumor necrosis factor α (TNF‑α), whereas treatment with anti‑IL‑1β exhibited opposite effects. In vitro experiments in sfd‑FLSs further suggested that treatment with IL‑1β influenced the expression levels of various inflammatory factors. In specific, IL‑1β increased the expression of IL‑17 and TNF‑α, and decreased the expression of IL‑6 and IL‑10 in sfd‑FLSs. Additionally, treatment with IL‑1β increased the mRNA expression and protein phosphorylation of NF‑κB, ERK and STAT1 in sfd‑FLSs. Treatment with anti‑IL‑1β exhibited opposite effects on the expression levels of inflammatory factors and suppressed the NF‑κB‑mediated ERK‑STAT1 signaling pathway activation in sfd‑FLSs. Finally, treatment with a NF‑κB inhibitor suppressed the effects of IL‑1β, and NF‑κB overexpression reversed the effects of anti‑IL‑1β on the expression levels of IL‑17, TNF‑α, NF‑κB, ERK and STAT1. In conclusion, the present results demonstrated that treatment with IL‑1β increased the expression levels of inflammatory factors in sfd‑FLSs via the regulation of the NF‑κB‑mediated ERK/STAT1 signaling pathway in a rat model of rheumatoid arthritis. Therefore, the NF‑κB/ERK/STAT1 signaling pathway may represent a potential target for the development of novel treatments for rheumatoid arthritis.

Introduction

Rheumatoid arthritis is a chronic autoinflammatory disease characterized by chronic inflammation and bone damage (1–4). Previous studies have demonstrated that rheumatoid arthritis is associated with chronic inflammation of synovial joints, hands and feet (5). Currently, targeted therapy is an available treatment for patients with rheumatoid arthritis (6–9). Numerous studies have demonstrated that targeted therapy for rheumatoid arthritis decreases inflammation, and many anti-inflammatory drugs have been used to improve the prognosis of rheumatoid arthritis, such as non-steroidal anti-inflammatory drugs, methotrexate, glucocorticoid, infliximab, golimumab and adalimumab (10–14). However, identifying the molecular signaling pathways underlying inflammation is required to develop novel treatments for patients with rheumatoid arthritis.

Although the causes underlying rheumatoid arthritis are not fully understood, experimental and clinical evidence suggest that interleukin (IL)-1β may serve an important role in the pathogenesis of rheumatoid arthritis (15–17). A previous study has demonstrated that the human anti-IL-1β monoclonal antibody ACZ885 was effective in blocking inflammatory responses in a mouse model of joint inflammation and in patients with rheumatoid arthritis (18). Theoretically, blocking the IL-1β pathway using specific anti-IL-1β antibodies would suppress the inflammatory process, limiting joint damage (19–21). In addition, patients with rheumatoid arthritis present high circulating levels of pro-inflammatory IL-1, and clinical trials have revealed that an IL-1 antagonist presented beneficial effects in patients with rheumatoid arthritis (22). Furthermore, a previous study revealed that treatment with an IL-1 receptor antagonist was safe and well-tolerated, and was able to regulate immune responses, thus providing clinical benefits (23). ERK and STAT pathways have been identified as potential molecular targets in the treatment of rheumatoid arthritis (24–26). Additionally, NF-κB activity is associated with the severity of rheumatoid arthritis and a decreased response to infliximab (27). A previous study has reported that synovial fluid-derived fibroblast-like synoviocytes (sfd-FLSs) can be used as an in vitro model to evaluate the inflammatory processes in rheumatoid arthritis (28). Therefore, understanding the role of IL-1β signaling in sfd-FLSs may be crucial for an improved understanding of rheumatoid arthritis. Previous studies demonstrated that blocking NF-κB, ERK and STAT1 expression may be beneficial for the treatment of human rheumatoid arthritis (24,29,30). Therefore, the present study investigated the expression levels of NF-κB, ERK and STAT1 in sfd-FLSs to explore the role of IL-1β in rheumatoid arthritis.

In the present study, the expression, the role and the molecular mechanism underlying IL-1β in sfd-FLSs and in a rat model of rheumatoid arthritis were investigated. The findings identified that IL-1β was a pro-inflammatory factor upstream of NF-κB, which regulated the ERK/STAT1 pathway in sfd-FLSs and in a rat model of rheumatoid arthritis.

Materials and methods

Establishment of a rat model of rheumatoid arthritis

A total of 30 8 week-old female Sprague Dawley rats (200–250 g body weight) were purchased from The Experimental Animal Center of Jinzhou Medical University (Jinzhou, China). All rats were housed at 23±1°C, 50±5% humidity with a 12 h light/dark cycle and free access to food and water. The induction of type II collagen-induced arthritis was achieved as previously described (31), by the subcutaneous injection of 2 mg collagen (ModiQuest Research) per rat (n=10 in each group). Rats were treated with IL-1β (10 mg/kg, Sigma-Aldrich; Merck KGaA), PBS (control; equal volume) or anti-IL-1β (10 mg/kg, ACZ885, Sigma-Aldrich; Merck KGaA) by subcutaneous injection every 4 days for a total of seven times.

Evaluation of arthritis

Rats were examined 28 days after collagen injection, and an arthritis score was assigned to each rat. The arthritis scores of experimental rats were evaluated using a scale of 0–2 for each paw, with a maximum total score of 8, as previously described (32). A score for each paw was assigned as follows: 0, normal paw; 0.25, 1–2 swollen toes; 0.5, 3–4 swollen toes; 0.75, slightly swollen footpad or ankle; 1, swollen footpad or ankle; 1.25, 1–2 swollen toes and swollen footpad or ankle; and 2.0, swollen toes and swollen footpad and ankle.

H&E staining

The tibias in experimental rats (n=5 per group) were fixed in 4% paraformaldehyde for 24 h, decalcified in 10% EDTA (pH = 7.4) for 5 days and embedded in paraffin. The tibias were cut into 4 µm tissue sections and then stained with 1% haematoxylin and eosin (H&E) for 15 min at room temperature. The tissue sections were imaged using a light microscope (TE2000S; Nikon Corporation).

ELISA

Blood samples were collected from all rats 28 days after collagen injection. Samples were centrifuged at 4,000 × g for 15 min at 4°C. The circulating levels of TNF-α (cat. no. RTA00, R&D Systems, Inc.) and IL-17 (cat. no. HS170, R&D Systems, Inc.) were analyzed using ELISA kits according to the manufacturer's protocol.

Immunohistochemical staining

Synovial membranes were collected from rats 28 days after collagen injection. Tissues were fixed with 4% paraformaldehyde at room temperature for 12 h. Paraffin-embedded tissue samples of synovial membranes were obtained and cut into 4 µm sections, deparaffinized and rehydrated using a descending alcohol series. Sections were prepared and epitope retrieval was performed using Tris-HCl buffer (cat. no. AP-9005-050; Thermo Fisher Scientific, Inc.) for 30 min at 37°C. Tissue sections were stained H&E (Sigma-Aldrich) for 15 min at room temperature. Sections were treated with 3% hydrogen peroxide for 15 min at 37°C and subsequently blocked with 5% BSA (Sigma-Aldrich; Merck KGaA) for 2 h at 37°C. Sections were washed with PBS and incubated with rabbit anti-rat IL-17 (1:1,000; ab193955; Abcam), TNF-α (1:1,000; ab109332; Abcam), ERK (1:1,000; ab32537; Abcam), phosphorylated ERK (pERK; 1:1,000; ab201015; Abcam) and STAT1 (1:1,000; ab2071; Abcam) at 4°C overnight. Sections were washed three times and incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin G (IgG; 1:2,000; cat. no. 1706515; Bio-Rad Laboratories, Inc.) for 1 h at 37°C. Diaminobenzidine was used as substrate for the immunohistochemical reaction. Tissue sections were visualized at ×200 magnification using a confocal microscope (LSM780; Carl Zeiss AG).

sfd-FLSs culture

The sfd-FLS line HIG-82 (American Type Culture Collection cat. no. 1832) was purchased from BeNa Culture Collection. sfd-FLSs were grown in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) at 37°C with 5% CO2. Cells were treated with IL-1β (1 mg/ml; cat no. SRP6551; Sigma-Aldrich; Merck KGaA), anti-IL-1β (1 mg/ml; cat no. PRS4877; Sigma-Aldrich; Merck KGaA) and/or NF-κB inhibitor (1 mg/ml; cat no. 481412; Sigma-Aldrich; Merck KGaA) for 12 h at 37°C for further analysis.

Cells transfection

sfd-FLSs were seeded in 6-well plates at a density of 1×104 cells/well in 2 ml RPMI-1640 supplemented with 10% FBS. Cells were cultured for 12 h and washed with PBS three times. NF-κB cDNA was cloned into a pcDNA3.1 plasmid (pcDNA3.1-NF-κB; Thermo Fisher Scientific, Inc.), and the empty plasmid pcDNA3.1 (Thermo Fisher Scientific, Inc.) served as control. sfd-FLSs were transfected with pcDNA3.1-NF-κB (5 µg) or empty pcDNA3.1 (5 µg) using Lipofectamine 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Cells were harvested after 72 h for further analysis.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from sfd-FLSs using the RNAeasy mini kit (Qiagen GmbH) according to manufacturer's protocol. RNA was reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen GmbH) at 42°C for 2 h according to on the manufacturer's instrument. All forward and reverse primers were purchased from Invitrogen (Thermo Fisher Scientific, Inc.) and are listed in Table I. qPCR was performed as follows: Initial denaturation at 95°C for 2 min, followed by 45 cycles of 95°C for 30 sec, 59°C for 30 sec and 72°C for 30 sec. The total volume of each reaction was 25 µl and contained 50 ng of cDNA, 200 µM dNTP, 2.5 units of Taq DNA polymerase (Takara Biotechnology, Co., Ltd.) and 200 µM primers using the SYBR® Premix Ex Taq™ kit (Takara Biotechnology, Co., Ltd.). Relative mRNA expression levels were calculated using the 2−ΔΔCq method (33). The results are presented as fold-change relative to the expression level of β-actin, used as internal control.

Table I.

Primers used in the present study.

Gene symbol	Primer sequence (5′-3′)
TNF-α	F: CCCTCACACTCAGATCATCTTCT
	R: GCTACGACGTGGGCTACAG
IL-17	F: GGGCCTGGCTTCTGTCTGA
	R: AAGTTCGTTCTGCCCCATCA
NF-κB	F: CACCCTCACCCTCCAACAAA
	R: TTCTCTTTCGTTCCCGGTGG
ERK	F: TGGTCCAGGGGTCTTACTCC
	R: TAAAGCCATGCCAATCTC
STAT1	F: GCAGGTTCACCAGCTTTATGA
	R: TGAAGATTACGCTTGCTTTTCCT
β-actin	F: CGGAGTCAACGGATTTGGTC
	R: AGCCTTCTCCATGGTCGTGA

TNF-α, tumor necrosis factor α; IL-17, interleukin 17; F, forward; R, reverse.

Western blotting

sfd-FLSs were homogenized using RIPA lysis buffer (Thermo Fisher Scientific, Inc.). Protein concentration was measured using a bicinchoninic acid assay kit (Thermo Fisher Scientific, Inc.). Subsequently, protein samples (20 µg in each lane) were separated by 12.5% SDS-PAGE. Protein were blotted on a nitrocellulose membrane and the membranes were incubated with primary antibodies anti-IL-17 (1:1,000; ab193955; Abcam), TNF-α (1:1,000; ab109332; Abcam), ERK (1:1,000; ab32537; Abcam), pERK (1:1,000; ab201015; Abcam), STAT1 (1:1,000; ab2071; Abcam), pSTAT1 (1:1,000; ab30645; Abcam) and β-actin (1:1,000; ab8226; Abcam) for 12 h at 4°C, after blocking with 5% BSA (Sigma-Aldrich; Merck KGaA) for 1 h at 37°C. Subsequently, the membranes were incubated with HRP-conjugated goat anti-rabbit IgG (1:5,000; cat. no. PV-6001; OriGene Technologies, Inc.) for 24 h at 4°C. The blots were visualized using an enhanced chemiluminescence detection system (cat. no. 32209; Pierce; Thermo Fisher Scientific, Inc.). Densitometric quantification was performed using Quantity-One software (version 1.2; Bio-Rad Laboratories, Inc.).

Statistical analysis

Data are presented as the mean ± SD. Differences were evaluated for significance using one-way ANOVA followed by Tukey's post hoc test. Data were analyzed using GraphPad Prism (version 6.0; GraphPad Software, Inc.). P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of anti-IL-1β on inflammation and NF-κB-mediated ERK-STAT1 signaling =in a rat model of rheumatoid arthritis

The effects of IL-1β and of an IL-1β inhibitory antibody (anti-IL-1β) on inflammation were investigated in a rat model of rheumatoid arthritis. The results suggested that treatment with anti-IL-1β decreased the rheumatoid arthritis score, whereas treatment with IL-1β exacerbated rheumatoid arthritis in vivo (Fig. 1A). Histopathological analysis demonstrated decreased synovial hyperplasia and bone erosion in the anti-IL-1β group compared with the control and IL-1β-treated groups. Treatment with anti-IL-1β decreased the bone injury score, whereas IL-1β increased the bone injury score compared with the control group (Fig. 1B). Treatment with anti-IL-1β increased the total body weight compared with the control group (Fig. 1C). Anti-IL-1β treatment decreased the serum levels of IL-17 and TNF-α in the rheumatoid arthritis rats, whereas IL-1β treatment increased the serum levels of IL-17 and TNF-α (Fig. 1D). Furthermore, the present results indicated that treatment with anti-IL-1β downregulated the gene and protein expression levels of NF-κB, ERK and STAT1, whereas treatment with IL-1β exhibited the opposite effects (Fig. 1E and F).

Figure 1.

Effects of IL-1β and anti-IL-1β treatment on inflammation and NF-κB, ERK and STAT1 expression in a rat model of rheumatoid arthritis. (A) Therapeutic effects of anti-IL-1β on rheumatoid arthritis determined by analysis of the rheumatoid arthritis score. (B) Bone injury in rat models of rheumatoid arthritis. Magnification ×40. (C) Body weight in the rheumatoid arthritis experimental rats. (D) Effects of treatments on the serum levels of IL-17 and TNF-α in the rheumatoid arthritis rats. Scale bar, 100 µm. (E) Effects of treatments on the mRNA expression levels of NF-κB, ERK and STAT1 in joint tissue from the rheumatoid arthritis rats. (F) Representative immunohistochemistry results showing the protein expression levels of NF-κB, ERK and STAT1. Scale bar=100 µm. **P<0.01, with comparisons indicated by brackets. IL, interleukin; NS, not significant; TNF-α, tumor necrosis factor α.

Anti-IL-1β downregulates the expression levels of the inflammatory factors IL-17 and TNF-α in sfd-FLSs

The effects of anti-IL-1β on the expression levels of various inflammatory factors were analyzed in sfd-FLSs in vitro. The results suggested that treatment with anti-IL-1β decreased the mRNA and protein expression levels of the pro-inflammatory factors IL-17 and TNF-α in sfd-FLSs (Fig. 2A and B). By contrast, treatment with anti-IL-1β increased the expression levels of the anti-inflammatory factors IL-6 and IL-10 in sfd-FLSs (Fig. 2C and D). Treatment with IL-1β exhibited the opposite effects (Fig. 2).

Figure 2.

Effects of IL-1β and anti-IL-1β on the expression levels of various inflammatory factors in sfd-FLSs in vitro. (A) mRNA and (B) protein expression levels of IL-17 and TNF-α. (C) mRNA and (D) protein expression levels of IL-6 and IL-10. **P<0.01, with comparisons indicated by brackets. sfd-FLSs, synovial fluid-derived fibroblast-like synoviocytes; IL, interleukin; TNF-α, tumor necrosis factor α.

Anti-IL-1β downregulates the NF-κB-mediated ERK/STAT1 pathway in sfd-FLSs

The effects of anti-IL-1β on the NF-κB-mediated ERK/STAT1 signaling pathway were analyzed in sfd-FLSs in vitro. The results indicated that treatment of sfd-FLSs with anti-IL-1β decreased the mRNA expression levels and the protein phosphorylation of NF-κB, ERK and STAT1 (Fig. 3A and B). Conversely, treatment with IL-1β exhibited the opposite effects (Fig. 3A and B). Treatment with an NF-κB inhibitor (NF-κBIR) suppressed the IL-1β-mediated increase in the mRNA expression levels of NF-κB, ERK and STAT1 in sfd-FLSs (Fig. 3). Additionally, NF-κBIR inhibited the IL-1β-mediated increase in pNF-κB/NF-κB, p-ERK/ERK and pSTAT1/STAT1 protein expression ratios in sfd-FLSs (Fig. 3D). Conversely, NF-κB overexpression (NF-κBOR) suppressed the anti-IL-1β-mediated decrease in the mRNA expression and protein phosphorylation levels of NF-κB, ERK and STAT1 (Fig. 3E and F).

Figure 3.

Effects of IL-1β and anti-IL-1β on the activity of the NF-κB-mediated ERK/STAT1 signaling pathway in sfd-FLSs in vitro. (A) mRNA expression levels of NF-κB, ERK and STAT1 in the different cell groups. (B) Protein expression levels of phosphorylated and total NF-κB, ERK and STAT1 in the different cell groups. (C) Effects of NF-κBIR on IL-1β-mediated increase in the mRNA expression and the (D) protein phosphorylation levels of NF-κB, ERK and STAT1 in sfd-FLSs. (E) Effects of NF-κBOR on anti-IL-1β-mediated decrease in the mRNA expression and (F) protein phosphorylation levels of ERK and STAT1 in sfd-FLSs. *P<0.05 and **P<0.01, with comparisons indicated by brackets. sfd-FLSs, synovial fluid-derived fibroblast-like synoviocytes; NF-κBIR, NF-κB inhibitor; NF-κBOR, NF-κB overexpression; IL, interleukin; p, phosphorylated; NS, not significant.

IL-1β increases the expression levels of inflammatory factors in sfd-FLSs via the NF-κB-mediated ERK/STAT1 signaling pathway

The mechanism underlying IL-1β-mediated inflammation was further investigated in sfd-FLSs. The results suggested that NF-κB inhibition suppressed the IL-1β-mediated increase in the mRNA and protein expression levels of IL-17 and TNF-α in sfd-FLSs (Fig. 4A and B). Similarly, NF-κB overexpression inhibited the anti-IL-1β-mediated decrease in the mRNA and protein expression levels of NF-κB, IL-17 and TNF-α in sfd-FLSs (Fig. 4C and D).

Figure 4.

IL-1β enhances inflammatory factor expression via the NF-κB-mediated ERK/STAT1 signaling pathway in sfd-FLSs. (A) Effects of NF-κBIR on IL-1β-mediated increase in the mRNA and (B) protein expression levels of IL-17 and TNF-α in sfd-FLSs. (C) Effects of NF-κBOR on anti-IL-1β-mediated decrease in the mRNA and (D) protein expression levels of NF-κB, IL-17 and TNF-α in sfd-FLSs. **P<0.01, with comparisons indicated by brackets. sfd-FLSs, synovial fluid-derived fibroblast-like synoviocytes; IL, interleukin; TNF-α, tumor necrosis factor α; NF-κBIR, NF-κB inhibitor; NF-κBOR, NF-κB overexpression; NS, not significant.

Discussion

Rheumatoid arthritis affects the function of joints and tissues, which may lead to various pathological symptoms, including fatigue, general discomfort and body weight loss (34). A previous study has demonstrated that NF-κB and various pro-inflammatory cytokines are involved in the inflammation of the joints through multiple signaling pathways both in vivo and in vitro (35). In the present study, the role of the pro-inflammatory cytokine IL-1β was investigated in vitro, using sfd-FLSs, and in vivo, using a rat model of rheumatoid arthritis. The present study suggested the importance of the NF-κB-mediated ERK/STAT signaling pathway in rheumatoid arthritis and revealed a novel mechanism by which IL-1β inhibition ameliorated inflammatory factor expression through inhibition of NF-κB in sfd-FLSs. The decrease in the activity of the ERK/STAT pathway induced by anti-IL-1β was identified to protect rheumatoid arthritis rat against arthritic inflammation, possibly by inhibiting the IL-1β-mediated activation of the NF-κB signaling pathway.

Elevated serum levels of IL-1β have been reported in patients with rheumatoid arthritis (36). Decreasing the expression levels of IL-1β could decrease inflammation and facilitate the treatment of rheumatoid arthritis (37). The present results suggested that inhibition of IL-1β using a IL-1β blocking antibody decreased the mRNA and protein expression levels of IL-17 and TNF-α in sfd-FLSs and in rat models of rheumatoid arthritis. In vivo experiments suggested that blocking IL-1β decreased the rheumatoid arthritis score, bone injury and increased the body weight in rheumatoid arthritis rat. Although treatment with IL-1β affected the serum levels of various cytokines and the pathology of rheumatoid arthritis, it did not affect the body weight of the animals. Notably, further experiments are required to determine the cellular specificity of the protective effects of anti-IL1β treatment by generating transgenic rodents presenting cell-specific IL-1β inhibition.

In the present study it was hypothesized that the inflammatory response induced by IL-1β was able to promote a positive feedback loop leading to the upregulation of IL-17 and TNF-α, which may be potential targets in the treatment of rheumatoid arthritis. Previous studies have reported that the expression levels of IL-6 and IL-10 are downregulated in patients with rheumatoid arthritis (38–40). The present data suggested that IL-1β decreased IL-6 and IL-10 expression, whereas anti-IL-1β increased IL-6 and IL-10 expression in sfd-FLSs, which further indicated the therapeutic potential of anti-IL-1β in treating rheumatoid arthritis. Inhibition of IL-6 modulated type III collagen and C-reactive protein degradation in patients with rheumatoid arthritis exhibiting an inadequate response to anti-TNF therapy (41). IL-6 is an independent predictive factor of drug survival after dose escalation of infliximab in patients with rheumatoid arthritis (38). Additionally, STAT3 increases the expression level of IL-10 in a subset of regulatory B cells in patients with rheumatoid arthritis (42), suggesting that IL-10 may promote the occurrence and progression of rheumatoid arthritis (43). The present results suggested that anti-IL-1β markedly upregulated IL-6 and IL-10 in sfd-FLSs, suggesting that blocking IL-1β may have anti-inflammatory effects that may be beneficial for the treatment of rheumatoid arthritis. Notably, our results demonstrated that anti-IL-1β treatment increased the total body weight compared with the control group, which may suggest contributed to body weight loss of patients with rheumatoid arthritis. The increased total body weight of experimental animals in anti-IL-1B treatment may due to the reduction of inflammation.

NF-κB signaling is essential for the development and progression of rheumatoid arthritis (44). A previous study found that the ERK signaling pathway served a central role in the initiation and progression of rheumatoid arthritis and ERK inhibitors were described as novel potential treatments for rheumatoid arthritis (24). STAT1 expression is increased in inflammatory arthritis, suggesting that its pro-apoptotic and anti-inflammatory effects are not able to effectively counteract inflammation (45–47). In the present study, the mRNA and protein expression levels of NF-κB, ERK and STAT1 were analyzed and the results suggested that anti-IL-1β treatment downregulated NF-κB, ERK and STAT1 expression in sfd-FLSs and in a rat model of rheumatoid arthritis. NF-κB inhibitor suppressed IL-1β-mediated upregulation of IL-17 and TNF-α in sfd-FLSs, whereas NF-κB overexpression suppressed anti-IL-1β-mediated downregulation of IL-17 and TNF-α in sfd-FLSs. In addition, NF-κB overexpression suppressed the anti-IL-1β-mediated decrease in the mRNA expression and protein phosphorylation levels of NF-κB, ERK and STAT1, indicating that anti-IL-1β may regulate the ERK/STAT1 pathway by targeting NF-κB. Therefore, the present results suggested that NF-κB may be involved in the pathogenesis of IL-1β-induced rheumatoid arthritis mediated by the ERK/STAT1 signal pathway, and that anti-IL-1β improved the symptoms associated with rheumatoid arthritis by inhibiting the NF-κB signaling pathway.

Collectively, systemic administration of anti-IL-1β decreased arthritis severity and tissue inflammation in a rat model of rheumatoid arthritis. In addition, IL-1β increased the expression levels of inflammatory factors via the upregulation of the NF-κB-mediated ERK/STAT1 signaling pathway. The present results suggested that IL-1β may be a crucial inflammatory factor involved in rheumatoid arthritis and that the NF-κB-mediated ERK/STAT1 signaling pathway may represent a potential therapeutic target for the treatment of rheumatoid arthritis.