| Literature DB >> 31591186 |
Christoph Schaub1, Marcel Rose2, Manfred Frasch3.
Abstract
Lineage reprogramming has received increased research attention since it was demonstrated that lineage-restricted transcription factors can be used in vitro for direct reprogramming. Recently, we reported that the ventral longitudinal musculature of the adult Drosophila heart arises in vivo by direct lineage reprogramming from larval alary muscles, a process that starts with the dedifferentiation and fragmentation of syncytial muscle cells into mononucleate myoblasts and depends on Org-1 (Drosophila Tbx1). Here, we shed light on the events occurring downstream of Org-1 in this first step of transdifferentiation and show that alary muscle lineage-specific activation of Yorkie plays a key role in initiating the dedifferentiation and fragmentation of these muscles. An additional necessary input comes from active dJNK signaling, which contributes to the activation of Yorkie and furthermore activates dJun. The synergistic activities of the Yorkie/Scalloped and dJun/dFos transcriptional activators subsequently initiate alary muscle fragmentation as well as up-regulation of Myc and piwi, both crucial for lineage reprogramming.Entities:
Year: 2019 PMID: 31591186 PMCID: PMC6829659 DOI: 10.1083/jcb.201905048
Source DB: PubMed Journal: J Cell Biol ISSN: 0021-9525 Impact factor: 10.539
Figure 1.Sd and Yki are required for AM dedifferentiation. (A) Schematic depiction of AM lineage reprogramming during metamorphosis. After onset of metamorphosis, Org-1 and Tup expression is initiated specifically in the three anterior pairs of AMs, thus triggering dedifferentiation of the syncytial AMs into mononucleate AMDCs. Each of the mononucleate AMDCs serves as a muscle founder cell, fuses with fusion-competent myoblasts (FCMs), and forms a syncytial muscle cell. The newly formed syncytia migrate to the ventral anterior part of the heart tube and differentiate into the VLM. (B and C) Ex vivo live imaging of dissected pupae carrying the org-1-HN18-RFP (org-1-RFP) and hand-GFP reporter constructs. In larval stage L3, org-1-RFP expression is seen in the first three pairs of AMs (B; arrows) that initiate dedifferentiation in pupal stage P4 (C) and fragment into mononucleated progenitor-like cells, AMDCs (arrows). (D) org-1-RFP drives reporter expression in the VLM attached to the heart of a pharate adult stage P15. (E and F) Induction of CRISPR in the AMs with HN39-org-1-GAL4 (org-1-GAL4) against sd (org-1>>Cas9; t::gRNA-sd; E) or yki (org-1>>Cas9; t::gRNA-yki; F) blocks VLM formation and prevents AM fragmentation during metamorphosis into pharate adult stage P15 (arrows). (G and H) Visualization of the org-1-RFP lineage marker and GFP-tagged versions of Sd (Sd::GFP) and Yki (Yki::GFP). Sd::GFP can be detected at pupal stage P3 in the nuclei (arrowheads) of the syncytial AM (G and G′; arrow) whereas Yki::GFP can be detected during induction of AM fragmentation in the nuclei (H and H′; arrowheads) of the forming AMDCs (arrows) during pupal stage P4. Scale bars in A–E: 100 µm; F and G: 10 µm. Actin is visualized with phalloidin; DNA is visualized with DAPI.
Figure 2.Org-1–dependent derepression of Yki is needed for AM lineage reprogramming. (A) Schematic drawings of Hpo and Yki constructs used for forced expression. Asterisks indicate positions of amino acid exchanges. (B) Frequencies of observed VLM differentiation in pharate adult stages P15 in the respective genetic backgrounds. n, number of animals phenotypically classified. Coexpression of YkiS168A can significantly rescue the phenotypes provoked by forced expression of HpoΔC (n = 62, ***, P ≤ 0.001) as well as the phenotypes induced by RNAi against Org-1 (n = 22, **, P ≤ 0.01) and Tup (n = 52, ***, P ≤ 0.001). (C) Forced expression of phosphorylation-resistant YkiS168A (org-1>>yki.S168A) with org-1-GAL4 does not provoke a VLM phenotype. (D) Forced expression of the N-terminal part of Hpo containing a functional STE20 kinase domain (org-1>>hpo.ΔC) disrupts VLM formation and AM fragmentation. (E–G) Forced expression with org-1-GAL4 of the N-terminal part of Hpo containing a dead STE20 kinase domain (org-1>>hpo.ΔC.K71R; E), full-length Hpo (org-1>>hpo; F), or an N-terminally truncated version of Hpo (org-1>>hpo.ΔN; G) does not provoke a significant VLM phenotype. (H) VLM formation and AM lineage reprogramming can be partially rescued by coexpression of YkiS168A in a HpoΔC background (org-1>>hpo.ΔC; yki.S168A). (I and K) Induction of RNAi with org-1-GAL4 against org-1 (org-1>>dsRNA-org-1; I) or tailup (tup; org-1>>dsRNA-tup; K) disrupts VLM formation and AM lineage reprogramming. (J and L) Coexpression of YkiS168A leads to the partial rescue of the phenotypes induced by the RNAi against either org-1 (org-1>>dsRNA-org-1; yki.S168A; J) or tup (org-1>>dsRNA-tup; yki.S168A; L). Actin is visualized with phalloidin. Scale bars: 100 µm.
Figure 3.The transcriptional effectors of the Hippo and dJNK pathways act synergistically to induce AM fragmentation. (A) org-1-RFP and phalloidin mark the VLM in pharate adult stage P15. (B) Forced expression of a membrane-tethered version of dominant-negative aPKC (org-1>>aPKC.CAAX.DN) with org-1-GAL4 has no effect on AM reprogramming. (C) Induction of a constitutive active form of aPKC (org-1>>aPKC.ΔN) with org-1-GAL4 disrupts VLM differentiation and AM transdifferentiation. (D) The lost VLM phenotype in an aPKC gain-of-function background can be partially rescued by coexpression of phosphorylation-resistant YkiS168A (org-1>>aPKC.ΔN; yki.S168A). (E) org-1-GAL4–mediated induction of a dominant-negative version of dJNK (org-1>>bsk.DN) leads to abolishment of VLM differentiation and AM transdifferentiation. (F) Coexpression of YkiS168A in dJNKDN background (org-1>>bsk.DN; yki.S168A) can rescue formation of VLM fibers, but there are fewer than in wildtype, and the morphology of the VLM is severely disrupted. (G) Frequencies of observed VLM differentiation in the different genetic backgrounds. n, number of animals phenotypically classified. Coexpression of YkiS168A can significantly rescue the phenotypes provoked by forced expression of aPKCΔN (n = 49, ***, P ≤ 0.001) and dJNKDN (n = 52, ***, P ≤ 0.001). (H and H′) The in vivo AP-1 sensor TRE-GFP is activated in org-1-RFP–positive AMDCs (arrows) and (even more strongly) in org-1-RFP–negative apoptotic muscle cells (asterisks) at pupal stage P4. (I and J) Induction of CRISPR in the AMs with org-1-GAL4 against dJun [Jra]; org-1>>Cas9; t::gRNA-Jra; I) or dFos [kay]; org-1>>Cas9; t::gRNA-kay; J) blocks VLM differentiation and AM fragmentation (arrows). Scale bars in A–F, I, and J: 100 µm; H: 10 µm. Actin is visualized with phalloidin; DNA is visualized with DAPI.
Figure 4.The Yki targets Myc and Piwi are indispensable for reprogramming of the AM lineage. (A) org-1-RFP and phalloidin mark the VLM. (B) Induction of CRISPR in the AMs with org-1-GAL4 against Myc (org-1>>Cas9; t::gRNA-Myc) abolishes VLM differentiation and blocks AM dedifferentiation. (C and D) Expression of a GFP-tagged Myc (Myc::GFP) can be detected in the nuclei (arrowheads) of the AMDCs (arrows) shortly after AM fragmentation (C and C′), but is suppressed by forced expression of constitutive active Hpo with org-1-GAL4 (org-1>>hpo.ΔC) in pupae at stage P4 (D and D′). (E) Induction of RNAi in the AMs with org-1-GAL4 against piwi (org-1>>dsRNA-piwi) abolishes VLM differentiation. (F and G) Visualization of org-1-RFP and GFP tagged Piwi (Piwi::GFP) during AM lineage reprogramming. Whereas Piwi::GFP cannot be detected in the forming AMDCs during fragmentation of the AMs (F and F′), the VLM progenitor cells that arises from the AMDCs during reprogramming are clearly positive for cytoplasmic Piwi::GFP (G and G′). (H and H′) Forced expression of constitutive active Hpo with org-1-GAL4 (org-1>>hpo.ΔC) abolishes piwi::GFP expression in pupal stage P4. Scale bars in A, B, and E: 100 µm; C, D, and F–H: 10 µm. Actin is visualized with phalloidin; DNA is visualized with DAPI.
Figure 5.Lineage-restricted activation of Yki and JNK triggers dedifferentiation and reprogramming of syncytial AMs into VLM progenitor cells. (A) AM lineage reprogramming is induced by the nuclear activities of Ultrabithorax (Ubx) and ligand bound ecdysone receptor, thus leading to the up-regulation of org-1 and tup expression. (B) Subsequently, Org-1 and Tup promote the derepression of Yki via down-regulation of Hippo (Hpo) as well as the activation of JNK signaling. (C and D) These molecular events mediate the nuclear translocation of Yki/Sd as well as AP-1 and provoke lineage-restricted activation of Myc and piwi expression, inducing the dedifferentiation and fragmentation of the AMs into AM-derived cells (AMDCs; C) as well as the reprogramming of the AMDCs into mononucleate VLM progenitors (D). piwi is required for their redifferentiation into VLMs (not depicted).
Sequences of gRNAs
| gRNA | Sequence (5′ to 3′) |
|---|---|
| sd_gRNA_1 X:15820015..15820037 (+ strand) | CCGCTGATGCCGAAGGTGTATGG |
| sd_gRNA_2 X:15820071..15820093 (+ strand) | TTATCTATATATCCGCCGTGCGG |
| sd_gRNA_3 X:15820113..15820135 (+ strand) | TCCGACGAGGGTAAAATGTACGG |
| sd_gRNA_4 X:15819619..15819641 (+ strand) | CCGTGGACACCAGTGAATGCCGG |
| yki_gRNA_1 2R:24068081..24068103 (- strand) | ATTCGACAGCGTCCTGAATCCGG |
| yki_gRNA_2 2R:24068069..24068091 (+ strand) | GCTTGGCGTCACCCGGATTCAGG |
| yki_gRNA_3 2R:24067961..24067983 (- strand) | CGCCGACTCCACCTACGACGCGG |
| yki_gRNA_4 2R:24067953..24067975 (+ strand) | CTGGGAGCCCGCGTCGTAGGTGG |
| Jra_gRNA_1 2R:10097377..10097399 (- strand) | ACTGAAAGTCCAGTGACATGGGG |
| Jra_gRNA_2 2R:10097513..10097535 (- strand) | ACCGTCTTGGATGACAGATCCGG |
| Jra_gRNA_3 2R:10097421..10097443 (- strand) | GGGACGCTTGTTAGGATTCGGGG |
| Jra_gRNA_4 2R:10097345..10097367 (+ strand) | ATACCTAAAACCGAGCCCGTTGG |
| kay_gRNA_1 3R:29791413..29791435 (- strand) | TCGTCAGTGTGAGAACACTCTGG |
| kay_gRNA_2 3R:29791457..29791479 (- strand) | TGTGTCCTCGATGTTGCGCGTGG |
| kay_gRNA_3 3R:29791485..29791507 (- strand) | TCTGCGTGTCCGAGAGCAAGTGG |
| kay_gRNA_4 3R:29791510..29791532 (+ strand) | GATCGTGTGGCTGGTTGCGCGGG |
| Myc_gRNA_1 X:3375027..3375049 (- strand) | TGGTCGTCCATTATGGAATACGG |
| Myc_gRNA_2 X:3375124..3375146 (- strand) | CTTCTCGAGATCACTCTGAATGG |
| Myc_gRNA_3 X:3375537..3375559 (+ strand) | GAGGTCCATTTAATACCGCCCGG |
| Myc_gRNA_4 X:3375978..3376000 (- strand) | CTATCAGAGCCGGTCGTCGGCGG |
Primers used for the assembly of the respective pCFD6 construct gRNAs
| Primer | Sequence (5′ to 3′) |
|---|---|
| sd_PCR1F | CGGCCCGGGTTCGATTCCCGGCCGATGCACCGCTGATGCCGAAGGTGTAGTTTCAGAGCTATGCTGGAAAC |
| sd_PCR1R | CACGGCGGATATATAGATAATGCACCAGCCGGGAATCGAACC |
| sd_PCR2F | TTATCTATATATCCGCCGTGGTTTCAGAGCTATGCTGGAAAC |
| sd_PCR2R | TACATTTTACCCTCGTCGGATGCACCAGCCGGGAATCGAACC |
| sd_PCR3F | TCCGACGAGGGTAAAATGTAGTTTCAGAGCTATGCTGGAAAC |
| sd_PCR3R | ATTTTAACTTGCTATTTCTAGCTCTAAAACGCATTCACTGGTGTCCACGGTGCACCAGCCGGGAATCGAACC |
| yki_PCR1F | CGGCCCGGGTTCGATTCCCGGCCGATGCAATTCGACAGCGTCCTGAATCGTTTCAGAGCTATGCTGGAAAC |
| yki_PCR1R | GAATCCGGGTGACGCCAAGCTGCACCAGCCGGGAATCGAACC |
| yki_PCR2F | GCTTGGCGTCACCCGGATTCGTTTCAGAGCTATGCTGGAAAC |
| yki_PCR2R | CGTCGTAGGTGGAGTCGGCGTGCACCAGCCGGGAATCGAACC |
| yki_PCR3F | CGCCGACTCCACCTACGACGGTTTCAGAGCTATGCTGGAAAC |
| yki_PCR3R | ATTTTAACTTGCTATTTCTAGCTCTAAAACCCTACGACGCGGGCTCCCAGTGCACCAGCCGGGAATCGAACC |
| Jra_PCR1F | CGGCCCGGGTTCGATTCCCGGCCGATGCAACTGAAAGTCCAGTGACATGGTTTCAGAGCTATGCTGGAAAC |
| Jra_PCR1R | GATCTGTCATCCAAGACGGTTGCACCAGCCGGGAATCGAACC |
| Jra_PCR2F | ACCGTCTTGGATGACAGATCGTTTCAGAGCTATGCTGGAAAC |
| Jra_PCR2R | CGAATCCTAACAAGCGTCCCTGCACCAGCCGGGAATCGAACC |
| Jra_PCR3F | GGGACGCTTGTTAGGATTCGGTTTCAGAGCTATGCTGGAAAC |
| Jra_PCR3R | ATTTTAACTTGCTATTTCTAGCTCTAAAACACGGGCTCGGTTTTAGGTATTGCACCAGCCGGGAATCGAACC |
| kay_PCR1F | CGGCCCGGGTTCGATTCCCGGCCGATGCATCGTCAGTGTGAGAACACTCGTTTCAGAGCTATGCTGGAAAC |
| kay_PCR1R | CGCGCAACATCGAGGACACATGCACCAGCCGGGAATCGAACC |
| kay_PCR2F | TGTGTCCTCGATGTTGCGCGGTTTCAGAGCTATGCTGGAAAC |
| kay_PCR2R | CTTGCTCTCGGACACGCAGATGCACCAGCCGGGAATCGAACC |
| kay_PCR3F | TCTGCGTGTCCGAGAGCAAGGTTTCAGAGCTATGCTGGAAAC |
| kay_PCR3R | ATTTTAACTTGCTATTTCTAGCTCTAAAACGCGCAACCAGCCACACGATCTGCACCAGCCGGGAATCGAACC |
| Myc_PCR1F | CGGCCCGGGTTCGATTCCCGGCCGATGCATGGTCGTCCATTATGGAATAGTTTCAGAGCTATGCTGGAAAC |
| Myc_PCR1R | TTCAGAGTGATCTCGAGAAGTGCACCAGCCGGGAATCGAACC |
| Myc_PCR2F | CTTCTCGAGATCACTCTGAAGTTTCAGAGCTATGCTGGAAAC |
| Myc_PCR2R | GGCGGTATTAAATGGACCTCTGCACCAGCCGGGAATCGAACC |
| Myc_PCR3F | GAGGTCCATTTAATACCGCCGTTTCAGAGCTATGCTGGAAAC |
| Myc_PCR3R | ATTTTAACTTGCTATTTCTAGCTCTAAAACCCGACGACCGGCTCTGATAGTGCACCAGCCGGGAATCGAACC |