Literature DB >> 31590760

Quercetin facilitates cell death and chemosensitivity through RAGE/PI3K/AKT/mTOR axis in human pancreatic cancer cells.

Chieh-Yu Lan1, Sheng-Yi Chen1, Chia-Wen Kuo1, Chi-Cheng Lu2, Gow-Chin Yen1.   

Abstract

The triggering of gemcitabine (GEM) drug resistance in pancreatic cancer by the receptor for advanced glycation end products (RAGE) has been demonstrated. Hence, finding a safe and effective adjuvant for preventing pancreatic cancer progression is imperative. Quercetin is a flavonoid that is abundant in apples, grapes, red raspberry, and onions and has been reported to inhibit RAGE. This research aimed to investigate the mechanisms of quercetin in regulating cell death and enhancing drug effects through RAGE reduction, especially in GEM-resistant pancreatic cancer cells. Our results showed that silencing RAGE expression by RAGE-specific siRNA transfection significantly increased cell death by apoptosis, autophagy and GEM-induced cytotoxicity by suppressing the PI3K/AKT/mTOR axis in MIA Paca-2 and MIA Paca-2 GEMR cells (GEM-resistant cells). Notably, quercetin showed a dramatic effect similar to RAGE silencing that effectively attenuated RAGE expression to facilitate cell cycle arrest, autophagy, apoptosis, and GEM chemosensitivity in MIA Paca-2 GEMR cells, suggesting that an additional reaction occurred under combined quercetin and GEM treatment. In conclusion, the results demonstrated that the molecular mechanisms of quercetin in regulating apoptosis and autophagy-related pathways and increasing GEM chemosensitivity in pancreatic cancer cells involved inhibition of RAGE expression.
Copyright © 2019. Published by Elsevier Taiwan LLC.

Entities:  

Keywords:  Autophagy; Gemcitabine resistance; Pancreatic cancer; Quercetin; RAGE

Mesh:

Substances:

Year:  2019        PMID: 31590760      PMCID: PMC9306979          DOI: 10.1016/j.jfda.2019.07.001

Source DB:  PubMed          Journal:  J Food Drug Anal            Impact factor:   6.157


1. Introduction

Pancreatic cancer is the 7th most frequent cause of cancer death in the world and presents the lowest five-year survival rate of 6%, with approximately 460,000 new cases in 2018. Despite the existence of many academic institutes devoted to improving the diagnosis and treatment of pancreatic cancer, it remains the most lethal cancer, can rarely be treated by surgical resection, and exhibits a poor prognosis and high mortality rate [1]. The poor prognosis of pancreatic cancer patients may mainly be attributed to its early metastasis and highly aggressive nature, which accelerate cancer progression and reduce the effects of treatment [2]. Currently, surgical resection is regarded as the only effective method for pancreatic cancer patient treatment [3]. Unfortunately, less than 20% of stage I or II pancreatic cancer patients are suitable for resection because most patients exhibit local vascular growth and distant metastatic disease that preclude curative surgery [4]. Thus, chemotherapy is the most common method for metastatic pancreatic cancer treatment. Gemcitabine (GEM), an analog of deoxycytidine for DNA synthesis inhibition, is the first approach for pancreatic cancer treatment and is also used to treat head and neck cancers, breast cancer, melanoma, nonmuscle-invasive urothelial carcinoma, and nonsmall cell lung carcinoma [5-7]. Despite the wide use of GEM, intrinsic and acquired drug resistance frequently leads to treatment failure [8], and the underlying mechanism of chemoresistance is poorly understood. The receptor for advanced glycation end products (RAGE) is expressed by cancer cells such as those of pancreatic, colonic, breast, prostate, liver, and lung cancers [9,10]. RAGE activation is responsible for increasing inflammation, promoting the development of a variety of cancers, causing the cancer metastasis phenomenon, and increasing the development of drug-resistant pancreatic cancer [11,12]. RAGE-initiated signals accelerate pancreatic tumor development; therefore, clarifying the cancer-related RAGE pathways may reduce the length of pancreatic cancer treatment and drug resistance. In recent years, phytochemicals have been used as cancer chemopreventive agents [13,14]. Quercetin is a flavonoid found in many foods, including apples, grapes, red raspberry, vegetables, cabbage, broccoli, onions, shallots, tea, tomatoes, and nuts [15]. Research has indicated that quercetin exerts anti-cancer effects in different ways, such as anti-oxidation and anti-proliferation activities, cell cycle arrest, apoptosis induction, and metastasis inhibition [16,17]. A study on drug-resistant uterine sarcoma showed that quercetin inhibits multidrug resistance protein 1 (MDR1) expression, blocks drug efflux via P-glycoprotein (Pgp) transport proteins, and increases the activity of anti-cancer drugs in MES-SA cells, suggesting that quercetinmay act as a chemopreventive agent and plays an important role in modulating chemotherapy drug sensitivity [18]. However, the role of quercetin in the inhibition of RAGE-initiated pancreatic cancer progression and drug resistance remains unknown. Therefore, this study analyzed the impact of RAGE expression on cell viability and drug efflux in human pancreatic cancer cells. In addition, we investigated the role of quercetin in promoting cell death and reducing drug resistance via the RAGE-associated signaling pathway.

2. Materials and methods

2.1. Cell maintenance and GEM-resistant cell establishment

The human pancreatic cancer cell lines MIA Paca-2 (BCRC NO. 60139), BxPC-3 (BCRC NO. 60283), AsPC-1 (BCRC NO. 60494), HPAC (BCRC NO. 60495) and PANC-1 (BCRC NO. 60284) were purchased from the Bioresource Collection and Research Center (Hsin Chu, Taiwan). A stable GEM-resistant pancreas carcinoma cell line (designated MIA Paca-2 GEMR cells) was established from 0.05 μM GEM concentration and gradually increasing GEM concentrations for developing a cellular model tolerance of 0.5 μM GEM. All tumor cells were maintained according to ATCC guidelines and cultured in an incubator supplemented with 5% CO2 at 37 °C. The stimulants GEM and quercetin were purchased from Sigma–Aldrich (St. Louis, MO, USA).

2.2. Transfection of small interfering RNA (siRNA)

Cells were seeded into six-well plates and transfected with 25 nM siRNA for 24 h. The procedure was performed according to the manufacturer’s instructions for the Dharmacon transfection kit (GE Healthcare, Lafayette, CO, USA).

2.3. MTT assay

A total of 5 × 104 cells/well were seeded into 24-well plates, followed by incubation for 24 h. After cell attachment, the MTT solution (5 mg/mL) was added, followed by incubation for 2 h. Then, 500 μL of DMSO solution was added to each well to determine cell viability. The absorbance was read at 570 nm. As control 100%, % = [Abs (sample)/Abs (control)] x 100.

2.4. RNA preparation and PCR

Total RNA of MIA Paca-2 cell was extracted by TRIzol plus RNA purification kit (Thermo Fisher Scientific, Waltham, MA, USA) according the description of the manufacturer’s manual. Then, cDNA was synthesis and amplified by reverse transcription-PCR analysis to detect RAGE and 18s (as an internal standard) gene expression. The primers used for amplification were as follows: RAGE (forward 5′CACCTTCTCCTGTAGCTTCA3′; reverse 5′TGCCACAAGATGACCCCAAT3′); 18s (forward 5′TTGGAGGGCAAGTCTGGTG3′; reverse 5′CCGCTCCCAAGATCCAACTA3′).

2.5. Western blotting analysis

Western blotting was performed according to our previous reported [17]. Antibodies of RAGE, phospho-mTOR (Millipore, Billerica, MA, USA), Bcl-2, Bax, Akt, phospho-Akt, PI3K, phospho-PI3K (Cell signaling technology, Danvers, MA, USA), β-actin, becline-1, ATG5, LC3 (Novus Biologicals, Littleton, Colorado, USA), and NF-κB p65 (Abcam, Cambridge, UK) were used in this study. The protein-relative intensity were quantified by VisionWorks LS 6.3.3 (UVP, Cambridge, UK) and normalized to the β-actin control.

2.6. Cell cycle measurement

The cells were treated with GEM and quercetin, respectively. Cell cycle was measured by propidium iodide (PI) staining assay according to our previous reported [19] by using FACS-can flow cytometry (FACScan®. BD Co). The distribution of sub-G1 was analyzed using CellQuest software.

2.7. Annexin V-FITC/PI staining

After treatment, the FITC Annexin V Apoptosis Detection Kit (BD Biosciences, San Jose, CA, USA) was used to measure apoptotic cells staining with Annexin-V and PI solution and then analyzed by Flow Cytometer.

2.8. Caspase 3 activity analysis

Caspase-3 activity was analyzed according to our previous report [19]. After treatment and preparation, cell lysates were measured by caspase-3/CPP32 fluorometric assay kit (Bio-Vision, Inc., Milpitas, CA, USA). Activity was calculated by FLUOstar glaxy fluorescence plated reader.

2.9. Calcein-AM measurement

Cells were plated into 24-well culture plates and added 500 μL (250 nM) calcein incubation at 37 °C for 30-min. After incubation, the fluorescence was measured by Flow Cytometer. The mean fluorescence intensity (MFI) values was represented as calcein accumulation.

2.10. Statistical analysis

Data analysis was performed by using the SPSS statistical program. Results are presented as the mean ± SD. Duncan’s test was used to assess differences between multiple groups by using one-way ANOVA. A P value < 0.05 was considered significant.

3. Results

3.1. Enhanced effect of RAGE-specific siRNA combined with GEM on inducing cell death and drug influx in MIA Paca-2 cells

RAGE activation is responsible for increasing metastasis and the development of drug-resistant pancreatic cancer [12,20]. To assess the role of RAGE in pancreatic cancer cells, endogenous RAGE levels in HPAC, AsPC-1, MIA Paca-2, PANC-1, and BxPC-3 cells were initially measured (Fig. 1A). Furthermore, we established cells with low RAGE expression by siRNA transfection of MIA Paca-2 cells, which exhibited the highest level of endogenous RAGE expression in this study (Fig. 1B–E). After low RAGE-expressing MIA Paca-2 cells were established, the role of RAGE in cell growth was investigated.
Fig. 1

Silencing RAGE mRNA expression in MIA Paca-2 cells. (A) Basal expression of RAGE in the HPAC, AsPC-3, MIA Paca-2, PANC-1 and BxPC-3 cell lines. (B–E) RAGE knockdown efficiency was measured by RT-PCR and Western blotting, respectively. Reported values are means ± SD (n = 3), *p < 0.05 versus the control.

Knocking down RAGE expression did not affect cell viability but significantly increased GEM cytotoxicity in MIA Paca-2 cells (Fig. 2A and B). The same effect was also observed through cell cycle analysis. Treatment of low RAGE-expressing cells with 500 nM GEM for 72 h increased cell cycle arrested at the sub-G1 stage (69.7 ± 1.8%) compared with the control (0.98 ± 0.17%) (Fig. 2C). Previous evidence has shown that cell cycle arrest in an early phase can trigger autophagy through inhibition of the PI3K/AKT/mTOR axis [21,22]. Unexpectedly, autophagy-related 5 (ATG5) and Beclin-1 protein expression was not significantly changed by GEM treatment in RAGE knockdown cells (Fig. 2D). Nevertheless, the autophagy-related light chain 3 (LC3)-II protein level was dramatically increased in both cells subjected to RAGE silencing alone and GEM-treated RAGE-silenced cells (Fig. 2D). To examine the PI3K/AKT/mTOR axis in low RAGE-expressing MIA Paca-2 cells, the phosphorylation activities of PI3K, AKT, and mTOR were reduced in cells subjected to either RAGE silencing alone or RAGE silencing combined with GEM treatment (Fig. 2E and F).
Fig. 2

Enhanced effect of RAGE-specific siRNA and GEM in inducing the cell death of MIA Paca-2 cells. Cells were transfected with RAGE-specific siRNA for 24 h and then treated with 500 nM GEM for 72 h. (A, B) Cell viability. (C) Sub-G1 phase. (D) Autophagy-associated ATG5, Beclin-1, LC3I, and LC3II protein expression. (E) Akt, PI3K, and (F) mTOR protein expression. (G) Apoptotic cells were stained with Annexin V-FITC positive/PI negative staining. (H) Bcl-2 and Bax protein expression. (I) Caspase 3 activity. (J) Protein levels of p65. (K, L) Effect of RAGE knockdown on the mean calcein fluorescence intensity in MIA Paca-2 cells. Reported values are means ± SD (n = 3), *p < 0.05 versus the control. (n.s. = Not significant). MFI: mean fluorescence intensity.

Some reports have demonstrated that mTOR-mediated autophagy precedes apoptosis and can induce the apoptosis process [23,24]. In this study, an increase apoptotic cells was observed in GEM-treated RAGE-silenced cells (Fig. 2G). Furthermore, increasing pro-apoptotic Bax protein expression and lower anti-apoptotic Bcl-2 levels were observed in cells subjected to either RAGE silencing alone or RAGE silencing combined with GEM treatment, respectively (Fig. 2H). Additionally, caspase 3 activity was significantly increased in GEM-treated RAGE-silenced cells compared to that in GEM-treated MIA Paca-2 cells (Fig. 2I). Previous studies have found that downregulation of the nuclear factor-kappa B p65 (NF-κB p65) subunit acts synergistically with GEM to restrict the growth of pancreas adenocarcinoma [25]. Knocking down RAGE expression greatly decreased NF-κB p65 nuclear protein production (Fig. 2J), suggesting that RAGE-specific siRNA exerts enhanced effect with GEM treatment in inducing cell death in MIA Paca-2 cells. It has been well documented that Ca2+ influx and MDR1 upregulation are highly associated with GEM metabolism in human pancreatic carcinoma [26]. MDR1 principally regulates drug efflux. In addition, a previous study showed that NF-κB induces drug resistance through MDR1 expression [27]. In this study, RAGE-silenced cells exhibited a higher median fluorescence intensity (MFI) value, implying that a low level of MDR1 expression obstructed metabolization and increased the cytotoxicity effect (Fig. 2K,L). These results suggested that knocking down RAGE resulted in a decrease in NF-κB production, which may decrease MDR1 expression and concentrate GEM-induced intracellular cytotoxicity.

3.2. Quercetin promoted GEM-induced cytotoxicity by suppressing RAGE expression in MIA Paca-2 cells

Research has shown that quercetin protects against amnesic injury through inactivation of the RAGE-mediated ERK/CREB/ BDNF pathway [28]. Our previous results also demonstrated that quercetin inhibits RAGE-mediated oxidative stress and inflammatory responses in THP-1 cells [29]. Here, we first noted that RAGE mRNA and protein expression was significantly suppressed by quercetin treatment in MIA Paca-2 cells, accompanied by cell growth inhibition (Fig. 3A–C). To determine the effect of quercetin on GEM sensitivity in MIA Paca-2 cells, cells were treated with quercetin at various concentrations (6.25, 12.5, 25, and 50 μM) for 24 h and then cultured with 500 nM GEM for 72 h. An additional reaction was observed that reduced the viability level under both 25 and 50 μM quercetin treatment during the GEM incubation period (Fig. 3D). Moreover, autophagy-associated vacuolation was observed in MIA Paca-2 cells treated with quercetin combined with GEM (Fig. 3E). Autophagic cells were further detected by acridine orange staining, and acridine orange-positive cells were increased by 25 or 50 μM quercetin treatment during the GEM incubation period (Fig. 3F).
Fig. 3

Quercetin promoted GEM-induced cytotoxicity by suppressing RAGE expression in MIA Paca-2 cells. Effect of quercetin on (A) cytotoxicity, (B) RAGE mRNA expression, and (C) RAGE protein levels in Mia Paca-2 cells. (D) Cells were pretreated with various concentrations (6.25, 12.5, 25 and 50 μM) of quercetin for 24 h and then treated with 500 nM GEM for 72 h. Cell viability was measured via the MTT assay. (E) Autophagy-associated vacuolation in cells. (F) Percentages of autophagosomes. (G) Autophagy-associated ATG5, Beclin-1, LC3I, and LC3II protein expression. (H) Apoptotic cells were stained with Annexin V-FITC positive/PI-negative staining. (I) Caspase 3 activity. (J) Protein levels of p65. (K) Effect of quercetin on mean calcein fluorescence intensity in MIA Paca-2 cells. Reported values are means ± SD (n = 3), *p < 0.05 versus the control. MFI: mean fluorescence intensity.

Moreover, ATG5 and LC3-II protein expression was increased in both cells subjected to quercetin-treated alone and quercetin combined with GEM-treated cells compared with untreated control cells (Fig. 3G). Quercetin treatment of MIA Paca-2 cells not only induced autophagy but also increased apoptosis-associated caspase 3 activity and NF-κB p65 expression (Fig. 3H–J). Interestingly, the MFI value of calcein was increased in a dose-dependent manner by quercetin treatment in MIA Paca-2 cells (Fig. 3K), implying that a low level of MDR1 expression succeeded in impeding GEM efflux and increasing cytotoxicity.

3.3. Enhanced effect of RAGE-specific siRNA combined with GEM on inducing chemosensitivity in MIA Paca-2 GEMR cells

To assess whether quercetin treatment is effective against GEM-chemoresistant pancreatic cancer cell growth, we first established a GEM-resistant MIA Paca-2 human pancreatic cancer cell line (designated MIA Paca-2 GEMR cells) and assessed cell viability. As shown in Fig. 4A–D, the resistance to the pharmacologic cytotoxicity of GEM was noteworthy in MIA Paca-2 GEMR cells compared with parental cells. Not surprisingly, a high RAGE expression level was noted in MIA Paca-2 GEMR cells compared with MIA Paca-2 cells (Fig. 4E and F). Neither silencing RAGE gene expression nor GEM treatment reduced cell viability in MIA Paca-2 GEMR cells. However, an enhanced effect on increasing GEM chemosensitivity and reducing cell viability was observed under combined treatment with RAGE small interfering RNA and 500 nM GEM in MIA Paca-2 GEMR cells (Fig. 4G and H).
Fig. 4

High RAGE protein levels in GEM-resistant MIA Paca-2 cells. Cell morphology of (A) MIA Paca-2 and (B) GEM-resistant MIA Paca-2 cells (denoted as MIA Paca-2 GEMR). Effect of GEM on the cell viability of (C) MIA Paca-2 cells and (D) MIA Paca-2 GEMR cells. (E, F) Protein levels of RAGE in both cell types. (G, H) MIA Paca-2 GEMR cells were transfected with RAGE-specific siRNA for 24 h and then treated with 500 nM GEM for 72 h. Cell viability was measured via the MTT assay. Reported values are means ± SD (n = 3), *p < 0.05 versus the control.

3.4. Quercetin induced autophagy and apoptosis by suppressing RAGE expression in MIA Paca-2 GEMR cells

Cell death was exacerbated in a dose-dependent manner by quercetin treatment of MIA Paca-2 GEMR cells at 24 h or 48 h (Fig. 5A–C). The level of RAGE protein expression was decreased by quercetin treatment not only in MIA Paca-2 cells but also in MIA Paca-2 GEMR cells (Fig. 5D and E). Remarkably, the percentages of sub-G1 cell cycle arrest, autophagy, and apoptotic cells were increased by a dose-response effect upon quercetin treatment of MIA Paca-2 GEMR cells (Fig. 5F–H).
Fig. 5

Quercetin induced cell death by inhibiting RAGE protein expression in MIA Paca-2 GEMR cells. (A) Effect of quercetin on the morphology of MIA Paca-2 GEMR cells. Cell viability of MIA Paca-2 GEMR cells after quercetin treatment for (B) 24 h and (C) 48 h. (D, E) Effect of quercetin on RAGE protein expression. (F) Cells were treated with various concentrations (25, 50, 100, and 200 μM) of quercetin for 48 h. The cell cycle was assessed by PI staining. (G) Percentages of autophagosomes in quercetin-treated MIA Paca-2 GEMR cells. (H) Quercetin-induced apoptotic cells were stained with Annexin V-FITC positive/PI negative staining. The data are expressed as the mean ± SD of three independent measurements. Data from the same time point with different letters (a, b, c, d) show significant differences (p < 0.05) by Duncan’s test.

3.5. Additional effect of quercetin pretreatment coupled with GEM treatment in inducing cell death and increasing the MFI in MIA Paca-2 GEMR cells

Cell viability was significantly decreased by quercetin treatment compared with GEM treatment in MIA Paca-2 GEMR cells (Fig. 6A). Interestingly, quercetin pretreatment combined with GEM treatment remarkably inhibited cell growth in MIA Paca-2 GEMR cells (Fig. 6A). Indeed, cell death via both autophagy and apoptosis was elicited by quercetin pretreatment coupled with GEM treatment in MIA Paca-2 GEMR cells (Fig. 6B and C). Moreover, MFI values were increased in a concentration-dependent manner by quercetin treatment in MIA Paca-2 GEMR cells (Fig. 6D), implying a reduction in drug elimination and extension of cytotoxicity effects under quercetin treatment.
Fig. 6

Chemoprotective effect of quercetin in MIA Paca-2 GEMR cells. (A) Cells were pretreated with 100 μM Que for 24 h and then treated with 0.5 μM GEM for 72 h. Cell viability was measured via the MTT assay. (B) Percentages of autophagosomes in quercetin-treated MIA Paca-2 GEMR cells. (C) Percentage of apoptotic cells in quercetin-treated MIA Paca-2 GEMR cells. (D) Mean fluorescence intensity of calcein in MIA Paca-2 GEMR cells treated with quercetin. The data are expressed as the mean ± SD of three independent measurements. Data from the same time point with different letters (a, b, c, d) show significant differences (p < 0.05) by Duncan’s test. MFI: mean fluorescence intensity.

4. Discussion

The difficulty of early diagnosis of pancreatic cancer and resistance to chemotherapy result in a high mortality rate for pancreatic cancer patients. Accumulating evidence has shown that RAGE plays an important role in mediating pancreatic cancer tumorigenesis through distinct signaling cascades [9,30]. Hence, we knocked down RAGE expression in MIA Paca-2 and MIA Paca-2 GEMR cells to investigate the effects of RAGE on cell death and GEM metabolism. Silencing RAGE gene expression significantly reduced cell viability through cell cycle arrest, autophagy, and apoptosis in both cell lines. Furthermore, suppression of MDR1 levels was observed in RAGE knockdown cells, indicating that GEM efflux was prevented by RAGE inhibition. Interestingly, quercetin treatment significantly inhibited RAGE protein expression in both types of cells. The dramatic additive reaction effectively induced cell death and MDR1 expression in a dose-dependent manner in MIA Paca-2 and MIA Paca-2 GEMR cells. RAGE has been shown to increase tumorigenesis and cancer processes in early pancreatic neoplasia [31]. Knocking down RAGE increases apoptosis and decreases inflammatory responses in mice with 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced skin cancer [32]. Similarly, RAGE is a potential factor involved in autophagy and apoptosis regulation in pancreatic cancer [33]. Accordingly, our results demonstrated that silencing RAGE gene expression significantly reduced cell viability by increasing autophagy and apoptosis in MIA Paca-2 and MIA Paca-2 GEMR cells, respectively (Figs. 2 and 4). Suppression of RAGE gene expression resulted in reduced PI3k/ Akt/mTOR signaling protein expression and increased autophagy by increasing LC3 II protein levels in MIA Paca-2 cells (Fig. 2D–F). Notably, increased PI3k/AKT/mTOR signaling and suppression of autophagy are observed in macrophages isolated from rats with streptozotocin (STZ)-induced diabetic encephalopathy (DE) [34]. In addition, Rottlerin elicits autophagocytosis, which causes apoptosis by inhibition of the PI3K/Akt/mTOR cascade in human pancreatic cancer stem cells [35]. Accordingly, our results showed that autophagy was negatively regulated by the RAGE/PI3K/Akt/mTOR axis. LC3-II, a hallmark of autophagy, is tightly associated with autophagosomes and essential for autophagy [36]. Although other autophagy-associated proteins were not significantly altered by GEM treatment in RAGE knockdown cells, LC3-II protein expression was dramatically increased in RAGE-silenced cells and GEM-treated RAGE-silenced cells (Fig. 2D). In addition, a previous report showed that abnormal induction of autophagy by 6-OHDA-induced ROS accumulation could promote cytochrome c release and ultimately accelerate caspase-3-dependent apoptosis [37]. Moreover, increasing the ratio of Bax to Bcl-2 may activate caspase-3-modulated apoptosis [38]. Here, we found that the induction of autophagy by RAGE suppression led to an increase in the Bax/Bcl-2 ratio and a decrease in NF-κB p65 expression, causing caspase-3-dependent apoptosis in MIA Paca-2 cells (Fig. 2H–J). Convincing evidence has established that NF-κB can induce drug resistance through MDR1 expression [27,39]. In agreement with previous reports, our results showed that down-regulation of NF-κB suppressed MDR1 expression in GEM-treated MIA Paca-2 cells (Fig. 2I-L). As mentioned above, our findings demonstrated enhanced effect of RAGE-specific siRNA combined with GEM treatment in inducing cell death via autophagy and apoptosis and reducing GEM efflux in MIA Paca-2 cells. Quercetin is a flavonoids with outstanding anti-cancer potential due to its anti-proliferation effect and roles in cell cycle arrest, the induction of apoptosis, and the inhibition of cell invasion [16,40]. Our previous results demonstrated that quercetin inhibited RAGE-mediated oxidative stress and inflammatory responses in THP-1 cells [17]. Previous findings have shown that quercetin inhibitsMDR1 expression, prevents drug efflux via Pgp transport proteins, and increases the activity of anti-cancer drugs in MES-SA cells [18]. However, the underlying mechanism of quercetin in reducing MDR1 expression is unknown. As anticipated, treatment with quercetin significantly inhibited RAGE expression in MIA Paca-2 cells (Fig. 3B and C). Similar to what was observed in RAGE siRNA knockdown cells, autophagy, apoptosis, and increased MFI values were observed to promote GEM-induced cytotoxicity under quercetin treatment in MIA Paca-2 cells (Fig. 3). Importantly, a higher RAGE expression level was observed in MIA Paca-2 GEMR cells compared with MIA Paca-2 cells (Fig. 4E and F). Quercetin dramatically reduced cell viability, increased autophagy, and promoted apoptosis in a dose-dependent manner by suppressing RAGE expression in MIA Paca-2 GEMR cells (Fig. 5). Furthermore, autophagy, apoptosis, and chemosensitivity were greatly increased by the additional effect of quercetin combined GEM treatment in MIA Paca-2 GEMR cells (Fig. 6). Collectively, these results indicate that silencing RAGE significantly increases cell death and GEM-induced cytotoxicity through the PI3K/AKT/mTOR axis in MIA Paca-2 and MIA Paca-2 GEMR cells. Notably, quercetin treatment (similar to RAGE silencing) effectively attenuated RAGE expression, resulting in cell cycle arrest, autophagy, apoptosis, and GEM chemosensitivity in MIA Paca-2 GEMR cells, suggesting that an additional reaction occurred under combined quercetin and GEM treatment. This study provides direct evidence for revealing the molecular mechanisms of quercetin in increasing autophagy, apoptosis, and chemosensitivity in pancreatic cancer.
  40 in total

1.  Gemcitabine reduces recurrence.

Authors:  Louise Stone
Journal:  Nat Rev Urol       Date:  2018-08       Impact factor: 14.432

2.  In situ formed reactive oxygen species-responsive scaffold with gemcitabine and checkpoint inhibitor for combination therapy.

Authors:  Chao Wang; Jinqiang Wang; Xudong Zhang; Shuangjiang Yu; Di Wen; Quanyin Hu; Yanqi Ye; Hunter Bomba; Xiuli Hu; Zhuang Liu; Gianpietro Dotti; Zhen Gu
Journal:  Sci Transl Med       Date:  2018-02-21       Impact factor: 17.956

Review 3.  Gemcitabine resistance in pancreatic ductal adenocarcinoma.

Authors:  Yoav Binenbaum; Shorook Na'ara; Ziv Gil
Journal:  Drug Resist Updat       Date:  2015-11-03       Impact factor: 18.500

4.  RAGE regulates autophagy and apoptosis following oxidative injury.

Authors:  Rui Kang; Daolin Tang; Michael T Lotze; Herbert J Zeh
Journal:  Autophagy       Date:  2011-04-01       Impact factor: 16.016

Review 5.  The calcium-cancer signalling nexus.

Authors:  Gregory R Monteith; Natalia Prevarskaya; Sarah J Roberts-Thomson
Journal:  Nat Rev Cancer       Date:  2017-04-07       Impact factor: 60.716

6.  Quercetin induced apoptosis in association with death receptors and fludarabine in cells isolated from chronic lymphocytic leukaemia patients.

Authors:  M Russo; C Spagnuolo; S Volpe; A Mupo; I Tedesco; G-L Russo
Journal:  Br J Cancer       Date:  2010-07-20       Impact factor: 7.640

7.  Publisher Correction: Alpha-fetoprotein inhibits autophagy to promote malignant behaviour in hepatocellular carcinoma cells by activating PI3K/AKT/mTOR signalling.

Authors:  Shanshan Wang; Mingyue Zhu; Qiaoyun Wang; Yuli Hou; Lei Li; Honglei Weng; Yan Zhao; Dexi Chen; Junli Guo; Huiguo Ding; Mengsen Li
Journal:  Cell Death Dis       Date:  2019-03-01       Impact factor: 8.469

8.  RAGE signaling sustains inflammation and promotes tumor development.

Authors:  Christoffer Gebhardt; Astrid Riehl; Moritz Durchdewald; Julia Németh; Gerhard Fürstenberger; Karin Müller-Decker; Alexander Enk; Bernd Arnold; Angelika Bierhaus; Peter P Nawroth; Jochen Hess; Peter Angel
Journal:  J Exp Med       Date:  2008-01-21       Impact factor: 14.307

9.  Quercetin, a Natural Flavonoid Interacts with DNA, Arrests Cell Cycle and Causes Tumor Regression by Activating Mitochondrial Pathway of Apoptosis.

Authors:  Shikha Srivastava; Ranganatha R Somasagara; Mahesh Hegde; Mayilaadumveettil Nishana; Satish Kumar Tadi; Mrinal Srivastava; Bibha Choudhary; Sathees C Raghavan
Journal:  Sci Rep       Date:  2016-04-12       Impact factor: 4.379

10.  Metformin induces autophagy and G0/G1 phase cell cycle arrest in myeloma by targeting the AMPK/mTORC1 and mTORC2 pathways.

Authors:  Yan Wang; Wenbin Xu; Zixun Yan; Weili Zhao; Jianqing Mi; Junmin Li; Hua Yan
Journal:  J Exp Clin Cancer Res       Date:  2018-03-20
View more
  31 in total

Review 1.  Natural Products in Preventing Tumor Drug Resistance and Related Signaling Pathways.

Authors:  Chuansheng Yang; Zhikai Mai; Can Liu; Shuanghong Yin; Yantao Cai; Chenglai Xia
Journal:  Molecules       Date:  2022-05-30       Impact factor: 4.927

2.  Exploration of the System-Level Mechanisms of the Herbal Drug FDY003 for Pancreatic Cancer Treatment: A Network Pharmacological Investigation.

Authors:  Ho-Sung Lee; In-Hee Lee; Kyungrae Kang; Sang-In Park; Minho Jung; Seung Gu Yang; Tae-Wook Kwon; Dae-Yeon Lee
Journal:  Evid Based Complement Alternat Med       Date:  2022-05-10       Impact factor: 2.650

3.  Ursolic acid restores sensitivity to gemcitabine through the RAGE/NF-κB/MDR1 axis in pancreatic cancer cells and in a mouse xenograft model.

Authors:  Zih-Ying Li; Sheng-Yi Chen; Ming-Hong Weng; Gow-Chin Yen
Journal:  J Food Drug Anal       Date:  2021-06-15       Impact factor: 6.157

Review 4.  Regulation and function of autophagy in pancreatic cancer.

Authors:  Jingbo Li; Xin Chen; Rui Kang; Herbert Zeh; Daniel J Klionsky; Daolin Tang
Journal:  Autophagy       Date:  2020-11-20       Impact factor: 16.016

5.  RAGE: A potential therapeutic target during FGF1 treatment of diabetes-mediated liver injury.

Authors:  Peipei Zheng; Zonghao Tang; Jun Xiong; Beini Wang; Jingyu Xu; Lulu Chen; Shufang Cai; Chengbiao Wu; Libing Ye; Ke Xu; Zimiao Chen; Yanqing Wu; Jian Xiao
Journal:  J Cell Mol Med       Date:  2021-03-31       Impact factor: 5.310

Review 6.  Impact of Advanced Glycation End products (AGEs) and its receptor (RAGE) on cancer metabolic signaling pathways and its progression.

Authors:  Yadav Sangeeta Muthyalaiah; Bhavana Jonnalagadda; Cordelia Mano John; Sumathy Arockiasamy
Journal:  Glycoconj J       Date:  2022-01-22       Impact factor: 2.916

Review 7.  AGE-RAGE synergy influences programmed cell death signaling to promote cancer.

Authors:  Bhargav N Waghela; Foram U Vaidya; Kishu Ranjan; Abu Sufiyan Chhipa; Budhi Sagar Tiwari; Chandramani Pathak
Journal:  Mol Cell Biochem       Date:  2020-10-06       Impact factor: 3.396

8.  Quercetin suppresses pancreatic ductal adenocarcinoma progression via inhibition of SHH and TGF-β/Smad signaling pathways.

Authors:  Yangyang Guo; Yu Tong; Hengyue Zhu; Yanyi Xiao; Hangcheng Guo; Lumeng Shang; Wenjing Zheng; Shumei Ma; Xiaodong Liu; Yongheng Bai
Journal:  Cell Biol Toxicol       Date:  2020-10-17       Impact factor: 6.691

Review 9.  Anti-cancer properties of quercetin in osteosarcoma.

Authors:  Parisa Maleki Dana; Fatemeh Sadoughi; Zatollah Asemi; Bahman Yousefi
Journal:  Cancer Cell Int       Date:  2021-07-05       Impact factor: 5.722

10.  Pterostilbene Enhances Cytotoxicity and Chemosensitivity in Human Pancreatic Cancer Cells.

Authors:  Yi-Hao Hsu; Sheng-Yi Chen; Sheng-Yang Wang; Jer-An Lin; Gow-Chin Yen
Journal:  Biomolecules       Date:  2020-05-04
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.