Literature DB >> 31582445

Complete Genome Sequence of a Papio anubis Simian Foamy Provirus.

Brice Jegado1, Renaud Mahieux2.   

Abstract

The full-length sequence of a Papio anubis simian foamy provirus was obtained by using PCR followed by Sanger sequencing. This simian foamy virus from a P. anubis animal (SFVp.anubis) is 13,393 bp long. Like other proviruses, the genome of SFVp.anubis is organized with long terminal repeats (LTRs), as well as gag, pol, env, tas, and bet genes. SFVp.anubis is closer to Old World African strains than to New World ones.
Copyright © 2019 Jegado and Mahieux.

Entities:  

Year:  2019        PMID: 31582445      PMCID: PMC6776785          DOI: 10.1128/MRA.01063-19

Source DB:  PubMed          Journal:  Microbiol Resour Announc        ISSN: 2576-098X


ANNOUNCEMENT

Similar to humans, nonhuman primates (NHPs) can be infected with the following three different families of exogenous retroviruses: simian immunodeficiency virus (SIV), simian T cell leukemia virus (STLV), and simian foamy virus (SFV), the counterparts of human immunodeficiency virus (HIV), human T cell leukemia virus (HTLV), and human foamy virus (HFV), respectively. However, and contrary to HIV and HTLV-1, the Spumavirus HFV is in fact still a simian virus, given the fact that it always originates from current contacts with NHPs and cannot be transmitted from human to human. SFV infection is asymptomatic, although a recent report described lower levels of hemoglobin in infected humans (1). SFV seroprevalence can reach >75% in captive and wild NHPs (2), and at least 31 and 45 NHP species are infected with STLV-1 and SIV, respectively (3, 4). Since these three retroviruses have common modes of transmission, coinfections are frequent in NHPs and might have a biological impact (5). As an example, it was recently shown that STLV-1/SFV natural coinfection leads to an increased SFV proviral load (6). Only partial sequences of baboon SFV were previously reported (6–8). Full-length foamy virus sequences obtained here from naturally infected captive baboons (Papio anubis housed at the primate center of the Centre National de la Recherche Scientifique [CNRS] [UPS 846] in Rousset-sur-Arc, France) will be useful for performing further investigation on coinfection consequences. The use of animals was approved by the ethics committee (Autorisation de Projet Utilisant des Animaux à des Fins Scientifiques [APAFIS] number 4227-201604130940121) of the French Ministry of Higher Education, Research, and Innovation. The experimental procedure complied with current French laws and European directive 86/609/CEE. Animals were cared for in compliance with French regulations and were anesthetized with ketamine and medetomidine to allow blood draw. Peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll gradient, washed, and lysed. Genomic DNA was extracted from PBMCs using a NucleoSpin tissue kit (Macherey-Nagel). The genomic DNA was then amplified by nested PCR using a series of long terminal repeats (LTRs), as well as gag, pol, env, and bet/tas primers (Table 1). Based on a sequence comparison with SFV from the African green monkey (GenBank accession number MF582544) and guenon (GenBank accession number NC_043445), we ascertained that we had obtained a complete proviral sequence. The SFV strain V909/03F sequence is 13,393 bp long with a GC content of 37.84%. Using PCR products, each nucleotide was sequenced (Eurofins) at least twice on both strands. From the individual PCR product sequences, genome assembly was performed using Genome Compiler software (v2.2.88), NCBI BLASTN, and Clustal W for alignment and analyses. Thirty-five complete SFV sequences available in GenBank were used to make sequence comparisons. The genomic structure organization of V909/03F was similar to that of other SFVs, with the presence of LTRs and gag, pol, env, tas, and bet sequences. As expected, the genome of strain V909/03F is more closely related to Old World monkey SFV strains, in particular from African animals, than to strains from New World animals (Fig. 1). The Pol amino acid sequence is the most conserved (up to 87% identity) between P. anubis and other animal species, while Tas and Bet in the closest strains are only 56% and 63% identical, respectively.
TABLE 1

List of primers used to amplify the SFV Papio anubis simian foamy proviral sequence

Target genePrimerSequence (5′−3′)
LTRSFV-TasR4TTAAAAGGGAGACACTCTGGCTGAGGATGA
SFV-TasR5TTGGCACCTCGCCCAAAACCTTAAAGAAGAATA
SFV-LTR-F1AAGACTGCACCTTGCATAAAGAGTTC
SFV-LTR-F2TTAGATTGTACGGGAGCTCACCA
FVLGF1-RCTTACCAAACCTGGAGAGTCTCGAACA
FVRU5-RACTCTCGRCGCAGCGAGYAGTG
3RCACGTTGGGCGCCAATTG
gagSFV-GagF1GGAGGGAAGAACAAAGACCTGTAAATC
SFV-GagF2GTTCAAATGCAAAGGGATGAGTTAG
SFV-GagR3AGCTCCCCATCCAAAATCGG
SFV-GagR4SFV-GagR4 TATCGCTGGAGGAGCACTAGG
SFV-GagF5CAAAGGCAATCTGCCCAACCTCAGTC
SFV-GagF6GGTAATCAGGGACGTGGTGGATACA
SFV-GagFAGGAAGAGGGAACCAAAACCG
polSFV-PolR8TGTGTCCTACTTGATTTTCCCAATGTTGCC
SFV-PolR9GACTGTACCAGTTGCTATGTGATGAG
SFV-PolR6GGATTAAATTGGGTTTCAGCTATAC
SFV-PolR7CAGCTGAGCTGTATGATCTCCAAG
SFVmnd-IntF1GCCACCCAAGGGAGTTATGTGG
SFVmnd-IntF2CCTGGATGCAGAGTTGGATC
SFVmnd-IntR1GCTGCACCCTGATCAGAGTG
SFVmnd-IntR2GAAGGAGCCTTAGTGGGGTA
envSFV-EnvF1GTCATAGACTGGAATGT
SFV-EnvF2CATCCAGAACCCATAAT
SFV-EnvF5CGCAGTTTTCACCCATTGGAT
SFV-EnvF8CAATGCCCACTCCCAGGAATACATGAT
SFV-EnvR6ATCCAATGGGTGAAAACTGCG
SFV-EnvF9TGACTGTCCAGTGACAGCA
SFV-EnvF10AGCATATGTACCCAGTGTGGTC
SFV-EnvR1CATATGCTGGTATTGAG
SFV-EnvR3TTCCCAGGAAGCCATGACA
bet and tasSFV-BetR1GCTAAGATCTGCTAAAGGATTGTCTTCTGGA
SFV-BetR2GGTAAGTTTTCTCATTGGAAGGTC
SFV-BetF3GATGCTTACACTCGGGGCTACCA
SFV-BetF4TTGGCTGTGGCAATGTCAGGA
FIG 1

Phylogenetic relationships between 409 bp of SFV integrase sequences among Old World NHP species. All sequences were aligned by ClustalW with Seaview software (sequences from 61 NHPs infected by SFV). The phylogenetic tree was constructed using the maximum-likelihood method (PhyML) with percentage values and edited with FigTree v1.4.4. Values next to branches are bootstrap values. Each color represents a given NHP genus, as follows: Macaca (black), Cercocebus (red), Cercopithecus and Chlorocebus (pink), Erythrocebus (dark blue), Lophocebus (light blue), Papio (green), Mandrillus (yellow), and Pan troglodytes (orange). The sequence circled in red (for SFVp.anubis, a simian foamy virus from a P. anubis animal.) represents the integrase sequence from our complete SFV genome.

List of primers used to amplify the SFV Papio anubis simian foamy proviral sequence Phylogenetic relationships between 409 bp of SFV integrase sequences among Old World NHP species. All sequences were aligned by ClustalW with Seaview software (sequences from 61 NHPs infected by SFV). The phylogenetic tree was constructed using the maximum-likelihood method (PhyML) with percentage values and edited with FigTree v1.4.4. Values next to branches are bootstrap values. Each color represents a given NHP genus, as follows: Macaca (black), Cercocebus (red), Cercopithecus and Chlorocebus (pink), Erythrocebus (dark blue), Lophocebus (light blue), Papio (green), Mandrillus (yellow), and Pan troglodytes (orange). The sequence circled in red (for SFVp.anubis, a simian foamy virus from a P. anubis animal.) represents the integrase sequence from our complete SFV genome.

Data availability.

The complete genome sequence of SFV V909/03F is available in GenBank under accession number MK241969.
  8 in total

1.  High prevalence, coinfection rate, and genetic diversity of retroviruses in wild red colobus monkeys (Piliocolobus badius badius) in Tai National Park, Cote d'Ivoire.

Authors:  Siv Aina J Leendertz; Sandra Junglen; Claudia Hedemann; Adeelia Goffe; Sebastien Calvignac; Christophe Boesch; Fabian H Leendertz
Journal:  J Virol       Date:  2010-05-19       Impact factor: 5.103

2.  Modes of transmission of Simian T-lymphotropic Virus Type 1 in semi-captive mandrills (Mandrillus sphinx).

Authors:  Marion Roussel; Dominique Pontier; Barthélémy Ngoubangoye; Mirdad Kazanji; Delphine Verrier; David Fouchet
Journal:  Vet Microbiol       Date:  2015-06-23       Impact factor: 3.293

3.  Simian foamy virus infections in a baboon breeding colony.

Authors:  E L Blewett; D H Black; N W Lerche; G White; R Eberle
Journal:  Virology       Date:  2000-12-05       Impact factor: 3.616

4.  Characterization of new simian foamy viruses from African nonhuman primates.

Authors:  S R Broussard; A G Comuzzie; K L Leighton; M M Leland; E M Whitehead; J S Allan
Journal:  Virology       Date:  1997-10-27       Impact factor: 3.616

5.  Nonhuman primate retroviruses from Cambodia: high simian foamy virus prevalence, identification of divergent STLV-1 strains and no evidence of SIV infection.

Authors:  Ahidjo Ayouba; Linda Duval; Florian Liégeois; Sopheak Ngin; Steve Ahuka-Mundeke; William M Switzer; Eric Delaporte; Frédéric Ariey; Martine Peeters; Eric Nerrienet
Journal:  Infect Genet Evol       Date:  2013-04-21       Impact factor: 3.342

6.  Clinical Signs and Blood Test Results Among Humans Infected With Zoonotic Simian Foamy Virus: A Case-Control Study.

Authors:  Florence Buseyne; Edouard Betsem; Thomas Montange; Richard Njouom; Chanceline Bilounga Ndongo; Olivier Hermine; Antoine Gessain
Journal:  J Infect Dis       Date:  2018-06-05       Impact factor: 5.226

Review 7.  Simian foamy virus in non-human primates and cross-species transmission to humans in Gabon: an emerging zoonotic disease in central Africa?

Authors:  Augustin Mouinga-Ondémé; Mirdad Kazanji
Journal:  Viruses       Date:  2013-06-19       Impact factor: 5.048

8.  STLV-1 co-infection is correlated with an increased SFV proviral load in the peripheral blood of SFV/STLV-1 naturally infected non-human primates.

Authors:  Sandrine Alais; Amandine Pasquier; Brice Jegado; Chloé Journo; Réjane Rua; Antoine Gessain; Joelle Tobaly-Tapiero; Romain Lacoste; Jocelyn Turpin; Renaud Mahieux
Journal:  PLoS Negl Trop Dis       Date:  2018-10-01
  8 in total
  1 in total

1.  Complete Genome Sequence of a Baboon Simian Foamy Virus Isolated from an Infected Human.

Authors:  Anupama Shankar; Vedapuri Shanmugam; William M Switzer
Journal:  Microbiol Resour Announc       Date:  2020-07-02
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.